<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mar. Sci.</journal-id>
<journal-title>Frontiers in Marine Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mar. Sci.</abbrev-journal-title>
<issn pub-type="epub">2296-7745</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmars.2024.1408561</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Marine Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Insights into epigenetic regulation of <italic>cyp19a</italic> via comparative analysis using the scombrid chub mackerel as model</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Galotta</surname>
<given-names>Mariel</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2681425"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Dam</surname>
<given-names>Anh Tuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2628551"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Eto</surname>
<given-names>Yuhei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Toyoda</surname>
<given-names>Atsushi</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/441173"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Itoh</surname>
<given-names>Takehiko</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/130455"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mohapatra</surname>
<given-names>Sipra</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ogino</surname>
<given-names>Yukiko</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1811787"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Saitou</surname>
<given-names>Marie</given-names>
</name>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Matsuyama</surname>
<given-names>Michiya</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/451237"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Chakraborty</surname>
<given-names>Tapas</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1139031"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ohta</surname>
<given-names>Kohei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1411302"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Laboratory of Marine Biology, Faculty of Agriculture, Kyushu University</institution>, <addr-line>Fukuoka</addr-line>, <country>Japan</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Advanced Genomics Center, National Institute of Genetics</institution>, <addr-line>Shizuoka</addr-line>, <country>Japan</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>School and Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology</institution>, <addr-line>Yokohama</addr-line>, <country>Japan</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Aqua-Bioresource Innovation Center, Kyushu University</institution>, <addr-line>Fukuoka</addr-line>, <country>Japan</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Laboratory of Aquatic Molecular Developmental Biology, Faculty of Agriculture, Kyushu University</institution>, <addr-line>Fukuoka</addr-line>, <country>Japan</country>
</aff>
<aff id="aff6">
<sup>6</sup>
<institution>Center for Integrative Genetics, Faculty of Biosciences, Norwegian University of Life Sciences</institution>, <addr-line>Oslo</addr-line>, <country>Norway</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Vikash Kumar, Central Inland Fisheries Research Institute (ICAR), India</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Amit Kumar Sinha, University of Arkansas at Pine Bluff, United States</p>
<p>Aparna Chaudhari, Central Institute of Fisheries Education (ICAR), India</p>
<p>Biswajit Maiti, Nitte University, India</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Tapas Chakraborty, <email xlink:href="mailto:tapas_ch@agr.kyushu-u.ac.jp">tapas_ch@agr.kyushu-u.ac.jp</email>; Kohei Ohta, <email xlink:href="mailto:k_ohta@agr.kyushu-u.ac.jp">k_ohta@agr.kyushu-u.ac.jp</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>07</day>
<month>06</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>11</volume>
<elocation-id>1408561</elocation-id>
<history>
<date date-type="received">
<day>28</day>
<month>03</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>03</day>
<month>05</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Galotta, Dam, Eto, Toyoda, Itoh, Mohapatra, Ogino, Saitou, Matsuyama, Chakraborty and Ohta</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Galotta, Dam, Eto, Toyoda, Itoh, Mohapatra, Ogino, Saitou, Matsuyama, Chakraborty and Ohta</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Sexual development and reproduction are largely linked to epigenetic changes in many fish species. However, understanding of epigenetic regulation in scombrid species, such as tunas and mackerels, is limited. This study investigates DNA methylation&#x2019;s impact on <italic>cyp19a</italic> expression, crucial for estrogen synthesis, focusing on chub mackerel. Given the commercial significance of scombrids and susceptibility of marine fish to environmental changes, elucidating epigenetic mechanisms, particularly in the context of global warming, becomes imperative. We aimed to generalize observations from chub mackerel to other scombrids. Additionally, we studied DNA methylation patterns across fish with different sexual systems to understand aromatase regulation&#x2019;s phenotypic plasticity. Our <italic>in silico</italic> analysis revealed highly conserved promoter sequences within scombrids, sharing TFBS like Foxl2, FOS::JUN, ESRR, and Sox3, while CpG content varies. This indicates a conserved regulatory network controlling gene expression. We found sexual dimorphism in DNA methylation, with males hypermethylated and aromatase expression downregulated. Despite similar <italic>dnmt1</italic> expression, <italic>tet1</italic>, <italic>tet2</italic>, and <italic>tet3</italic> were higher expressed in females, suggesting that the observed DNA methylation patterns are maintained through active demethylation rather than differential methylation. Gonochoristic Japanese anchovy and protogynous bamboo leaf wrasse displayed similar trends, but species-specific methylation patterns highlight DNA methylation&#x2019;s complex role in gonadal changes. <italic>In vitro</italic> assays confirmed methylation&#x2019;s regulatory role and identified an SF-1 binding site relevant for promoter activation in chub mackerel. Another studied SF-1 site, present in both chub mackerel and bamboo leaf wrasse, showed regulatory effects, indicating potential similar regulatory mechanisms for <italic>cyp19a</italic> expression. Overall, our findings suggest that while global methylation affects <italic>cyp19a</italic> transcription, the variation in CpG density and location could be introducing nuances in its epigenetic regulation. This study contributes to our understanding of the <italic>cyp19a</italic> regulation in fish gonad maturation.</p>
</abstract>
<kwd-group>
<kwd>DNA methylation</kwd>
<kwd>cyp19a expression</kwd>
<kwd>scombrid</kwd>
<kwd>aromatase</kwd>
<kwd>epigenetics</kwd>
<kwd>sexual plasticity</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="36"/>
<page-count count="12"/>
<word-count count="5890"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Aquatic Physiology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Environmental changes, including disturbances to fish breeding grounds, pose a threat to successful breeding, embryo/larval survival, and sexual differentiation, impacting viability in aquaculture and natural environments (<xref ref-type="bibr" rid="B2">Barange and Perry, 2009</xref>). Epigenetic modifications at the genome level, triggered by global changes, drive acclimatization and adaptation across generations (<xref ref-type="bibr" rid="B26">Ryu et&#xa0;al., 2018</xref>). Specifically, DNA methylation plays a pivotal role in fine-tuning gene expression during reproductive maturation. Reproduction is finely controlled by the hypothalamic-pituitary-gonadal (HPG) axis and subsequent modulation of sex steroid production. Some studies have shown that epigenetic marks are disrupted by environmental factors, triggering changes in fish phenotypes. For example, in the article by <xref ref-type="bibr" rid="B1">Anastasiadi et&#xa0;al., 2017</xref> larvae of European sea bass exposed to an increase in temperature experienced changes in global methylation and subsequent expression of genes linked to stress response, growth and differentiation.</p>
<p>Among the genes regulated by DNA methylation, Cytochrome P450 Family 19 Subfamily A (<italic>Cyp19a</italic>), stands out for its essential role in estrogen synthesis across vertebrates. Highly expressed in ovarian tissue, Cyp19a catalyzes the conversion of androgens into 17&#x3b2;-Estradiol (E<sub>2</sub>) in granulosa cells, which then acts over the liver to produce vitellogenin (<xref ref-type="bibr" rid="B12">Kime, 1993</xref>) during the reproductive season. <italic>Cyp19a</italic> is modulated by a plethora of transcription factors (TF), including the Forkhead box L2 (Foxl2), which is essential for sex differentiation and maintenance (<xref ref-type="bibr" rid="B10">Huang et&#xa0;al., 2017</xref>), and can activate aromatase transcription by binding to its promoter. Additionally, in the presence of steroidogenic factor 1 (SF-1), Foxl2 synergistically upregulates Cyp19a expression (<xref ref-type="bibr" rid="B34">Wang et&#xa0;al., 2007</xref>). Other TF have been found to influence aromatase expression as well. For instance, the estrogen-related receptor (ESRR) gamma stimulates aromatase synthesis in human placental cells and, when knockdown, drastically inhibits its expression (<xref ref-type="bibr" rid="B15">Kumar and Mendelson, 2011</xref>), while FOS::JUN (also known as AP-1) motif is implicated in aromatase expression up-regulation induced by leptin in MCF-7 cell line (<xref ref-type="bibr" rid="B5">Catalano et&#xa0;al., 2003</xref>).</p>
<p>The epigenetic regulation of <italic>cyp19a</italic>, has been extensively investigated in commonly consumed fish species such as the Chinese sea perch (<xref ref-type="bibr" rid="B6">Chen et&#xa0;al., 2018</xref>), the Japanese flounder (<xref ref-type="bibr" rid="B35">Wen et&#xa0;al., 2014</xref>) and the European sea bass (<xref ref-type="bibr" rid="B22">Navarro-Mart&#xed;n et&#xa0;al., 2011</xref>). However, little is known about the epigenetic regulation of <italic>cyp19a</italic> in the Scombridae family, which encompasses the most commercially valuable and widely consumed fish, including tunas and mackerels (<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure S1</bold></xref>). There is a significant gap in our knowledge regarding the epigenetic mechanisms affecting these important food fishes. It is said that pelagic fish are more susceptible to environment changes (<xref ref-type="bibr" rid="B24">Petrik et&#xa0;al., 2020</xref>). Given that <italic>cyp19a</italic> modulation has proven to be influenced in early developmental stages by environmental factors, such as temperature, inducing masculinization in fish (<xref ref-type="bibr" rid="B25">Piferrer and Bl&#xe1;zquez, 2005</xref>), studying <italic>cyp19a</italic> modulation in the context of global warming is imperative. Furthermore, understanding how DNA methylation influences <italic>cyp19a</italic> expression in species with varied sexual systems, such as gonochorists and sequential hermaphrodites, could provide crucial information about the flexibility and adaptability of reproductive strategies in different ecological contexts.</p>
<p>In our study, we aim to investigate the conservation level of the <italic>cyp19a</italic> promoter sequence within the Scombridae family, shedding light on its evolutionary significance and the regulatory mechanisms that operate across related species. Using chub mackerel (<italic>Scomber japonicus</italic>) as a model, we aimed to unravel the modulation of <italic>cyp19a</italic> expression by DNA methylation and identify potential epigenetically influenced regulatory elements within this region. To achieve this, we conducted <italic>in silico</italic> comparative analysis, assessed methylation levels in the ovaries and testes of mature chub mackerel and performed <italic>in vitro</italic> assays to further study potential transcription factors within the promoter. Additionally, we compared its DNA methylation patterns with those of <italic>Engraulis japonicus</italic> and <italic>Pseudolabrus sieboldi</italic> to gain insights into the similarities and differences among species with different sexual systems. This study revealed the evolutionary and ecological drivers behind reproductive diversity, enhancing our knowledge of the complexity of epigenetic regulation in marine fish species.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>
<italic>In silico</italic> comparative study of scombrids&#x2019; <italic>cyp19a</italic> promoter</title>
<p>Sequences from scombrids, including southern bluefin tuna (<italic>Thunnus maccoyii</italic>), yellowtail tuna (<italic>T. albacares</italic>), and chub mackerel, along with the non-scombrid teleosts Japanese medaka (<italic>Oryzias latipes</italic>), Nile tilapia (<italic>Oreochromis niloticus</italic>) and Japanese flounder (<italic>Paralichthys olivaceus</italic>), were obtained from the NCBI database (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>). Two additional sequences from our laboratory, chub mackerel (here after referred as Q-saba strain) and the bamboo leaf wrasse (<italic>P. sieboldi</italic>) were also aligned. As a reference, we constructed a phylogenetic tree of the Scombridae family using the online tool TimeTree 5 (<xref ref-type="bibr" rid="B16">Kumar et al., 2022</xref>), which is included in the Supplementary Materials. A sequence spanning approximately 1500bp upstream of the start codon and covering both the first exon and intron, was selected for the analysis. The alignment was conducted with Clustal Omega software (<xref ref-type="bibr" rid="B20">Madeira et&#xa0;al., 2022</xref>) and transcription factor binding sites (TFBSs) search was done using JASPAR (<xref ref-type="bibr" rid="B4">Castro-Mondragon et&#xa0;al., 2022</xref>) and AnimalTFDB (<xref ref-type="bibr" rid="B27">Shen W et&#xa0;al., 2023</xref>) databases. The search was conducted using default parameters, and a minimum relative score of 85% was applied. A bibliographic search was conducted to pre-select and identify relevant TFBSs in the database.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Fish rearing and handling</title>
<p>50 Q-saba brooders were reared in a 5-ton semi-circular FRP tank, with continuous water exchange. Fish were maintained at 18~20&#xb0;C with a constant photoperiod of 16:8 (light: dark) hours for a period of 3 months. Food was fed twice a day at 2% of fish body weight using commercial pelleted food. After checking the maturity status, fish were injected with human chorionic gonadotrophin (400IU/kg fish) and artificial fertilization was conducted. 3 days after hatching (dah), fish were fed with live feed, followed by artificial food from 21dah. Later, at around, 50dah (Fork length ~8cm), fish were transferred to 10mX10m in open sea cages in Ao-suisan&#x2019;s fish farm, at Karatsu bay, Japan. Fish were fed with commercial pelleted feed (Marubeni Nissin, Japan) and regularly examined for reproductive status. 11-month-old fish were euthanized and sampled for further analysis. All experiments were conducted in accordance with the Kyushu University Animal Husbandry Guidelines, and all protocols were approved by the competent committee.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>DNA isolation and bisulfite conversion treatment</title>
<p>gDNA and total RNA were isolated from gonads of 11-month-old mature fish (4 females and 4 males), which were stored in DNA/RNA shield (Zymo Research, USA), using the Quick-DNA/RNA Magbead kit (Zymo Research, USA) and following manufacturer&#x2019;s instructions. Then, around 200ng of gDNA was subjected to bisulfite conversion treatment employing EZ-96 DNA Methylation-Gold MagPrep (Zymo Research, USA). Bisulfite-converted DNA was stored at -20&#xb0;C until use.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>
<italic>Cyp19a</italic> regulatory regions PCR and DNA methylation pattern scoping</title>
<p>Bisulfite sequencing (BS-seq) was conducted to study the DNA methylation patterns of <italic>cyp19a</italic> promoter in chub mackerel. Primers were designed targeting the regulatory region surrounding <italic>cyp19a</italic> start codon, with amplicons with average 250bp in length (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>). Primer design criteria mainly focused on including all <italic>in silico</italic> detected CpGs in the analyzed region. Bisulfite-converted DNA was amplified with KOD -Multi &amp; Epi enzyme (Toyobo, Japan). Reaction conditions were as follows: pre-denaturation at 94&#xb0;C for 2 min, followed by 45 cycles of 98&#xb0;C for 10 s, 59&#xb0;C for 30 s and extension at 68&#xb0;C for 15 s. PCR products were then purified with the NucleoSpin Gel and PCR Clean-up kit (Takara, Japan). Since the fragments obtained after PCR were blunt-ended, an A-tailing step was added, using dA-overhang reaction Mix (Nippongene, Japan). The fragments were then ligated into a pGEM-T Easy Vector (Promega, USA) following manufacturer&#x2019;s instructions. After incubating the ligation reactions overnight at -4&#xb0;C, bacteria were transformed, insert-positive colonies cultured and plasmid then purified, with the FastGene Plasmid Mini Kit (NIPPON Genetics, Japan) and sent to sequence, using Sanger platform. Relative methylation levels per position were calculated as the percentage of unmethylated cytosines over the total coverage for that position.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Expression measurement of <italic>cyp19a</italic> and genes involved in maintenance of DNA methylation</title>
<p>To study gene expression of <italic>cyp19a, dnmt1, tet1, tet2</italic> and <italic>tet3</italic> in ovaries and testes, RT-qPCR was conducted. Used primers can be found in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>. Around 1 &#xb5;g of total RNA was reverse transcribed into cDNA with Superscript IV (Invitrogen, USA). RT-qPCR was carried out using SSoFast EvaGreen Supermix (Bio-Rad, USA) in a qTOWER3 G touch machine (Analytik jena, Germany). Samples were run in duplicate and a final melting curve step was added to confirm single amplicon amplification. The housekeeping <italic>rpl8</italic> gene was also measured for expression normalization.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Inter-species DNA methylation analysis</title>
<p>DNA methylation patterns were also compared across species with different sexual systems. Data on <italic>cyp19a</italic> promoter methylation in the gonochoristic fish Japanese anchovy (<italic>E. japonicus</italic>) and the protogynous fish bamboo leaf wrasse was collected. Using a similar method to the one described above, bisulfite-converted gonad DNA was PCR amplified and then sequenced either by Sanger sequencing or Amplicon sequencing. A comparative analysis was conducted by aligning the target sequences, identifying common TFBSs, and comparing both global and CpG position-wise methylation levels.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>
<italic>Cyp19a</italic> vector construction</title>
<p>Specific primers were designed to amplify the proximal promoter region of <italic>cyp19a</italic>, including the sequence previously studied for DNA methylation patterns (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>) and with an overhang sequence overlapping pGL3-TK vector. PCR was carried out with PrimeSTAR Max DNA Polymerase (Takara, Japan), under the following conditions: 45 cycles of 98&#xb0;C for 10 s, 56&#xb0;C for 15 s and extension at 72&#xb0;C for 15 s. The purified amplicon was then inserted into the Xhol and Bgl II restriction enzyme cutting sites of the pGL3-TK plasmid, using the In-Fusion<sup>&#xae;</sup> Snap Assembly kit (Takara, Japan).</p>
<p>To study whereas methylation of <italic>cyp19a</italic> promoter was actually affecting its activity, whole methylation of the constructed plasmid was conducted with CpG Methyltransferase (M.SssI) enzyme (NEB, USA), as specified by manufacturer&#x2019;s instructions. Verification of successful methylation was achieved through digestion with the <italic>SmaI</italic> enzyme and subsequent gel electrophoresis.</p>
<p>To further investigate regulatory elements and their potential involvement in <italic>cyp19a</italic> promoter activation, some of the previously found TFBSs during the <italic>in silico</italic> analysis were selected for deletion. The process included inverse PCR of the <italic>cyp19a</italic>/pGL3-TK plasmid using PrimeSTAR Max DNA Polymerase (Takara, Japan) and primers designed to be oriented in opposite directions (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>), overlapping the target sequences to be deleted. Three 11bp deletions were introduced in positions -821/-810 (ATGGCCTTCAG), -707/-696 (TTGTCCTTGTG), and -217/-207 (TCAAGGTCGC). The nucleotide positions relative to the ATG start codon site were considered as +1.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Cell culture and dual luciferase reporter assay</title>
<p>Chinese hamster ovary (CHO) cells were cultured in Ham&#x2019;s F-12 (Wako, Japan) and supplemented with 10% fetal bovine serum at 37&#xb0;C in a 5% CO<sub>2</sub> incubator. The cells were seeded in 96 well/plate at an amount 10 000 cells per well and co-transfected the next day with 100ng of a mix of reporter plasmids: <italic>cyp19a</italic>/pGL3-TK (either methylated, control or promoter with deletion) and the inner control pRL-SV40 (Promega, USA), in triplicates. Cells were harvested 24 hours after transfection, and the Dual-Luciferase Reporter (DLR) assay was performed according to the manual (Promega, USA). Measurement was carried out using the luminometer function of the Thermo Scientific Varioskan&#xae; Flash.</p>
<p>All statistical analysis were done with RStudio (version 2023.06.1 + 524). The data didn&#x2019;t follow a normal distribution, so comparisons were made with no parametric Kruskal test and <italic>a posteriori</italic> contrast with Dunn&#x2019;s test. UpSet plots (<xref ref-type="bibr" rid="B18">Lex et&#xa0;al., 2014</xref>) for visualization of TFBSs per fish group were created with ComplexUpset package (<xref ref-type="bibr" rid="B14">Krassowski et&#xa0;al., 2022</xref>).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Surrounding region of <italic>cyp19a</italic> gene is highly conserved within Scombridae group</title>
<p>To investigate how conserved <italic>cyp19a</italic> regulatory region was, and identify common regulatory elements and CpG sites, an <italic>in silico</italic> study was conducted (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). Chub mackerel sequences (Wild and Q-saba strain) were 95.8% identical, which interestingly is slightly lower than that observed for the two species of tunas (98.6%), even though the former correspond to the same species. When comparing chub mackerel sequences with those of other species, the similarity percentage varies, ranging from 44.7% in Japanese medaka to 55% in Japanese flounder (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S2</bold>
</xref>). The TATA box and ATG were consistently aligned in all examined sequences. In most instances, a CpG site is detected within an 11bp proximity to the TATA box. However, in tuna species, the closest CpG is approximately 50bp away. Similarly, for all species except tunas, a CpG site is typically located around 25&#x2013;29bp downstream from the ATG codon.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Comparative analysis of <italic>cyp19a</italic> promoter sequences across several scombrids and non-scombrids. Putative TFBSs as well as TATA box and start codon are highlighted in some way (e.g. colored, highlighted, underlined, etc.).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-11-1408561-g001.tif"/>
</fig>
<p>Within the nucleotide discrepancies found, three potential TFBSs are present in the Q-saba strain mackerel: Sox3 (-919/-910, TCTTTCTTTT), also present in the tunas&#x2019; sequence, Dmrt1 (240/248, TACCAAGTA) and AR (-34/-13, TTCAGAACAACCTGTACACACC) (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>, indicated in red). Conversely, two novel Sox3 were absent in the Q-saba strain mackerel, TTTTTGTCCC (-1033/-1024) and ATACAATGAAA (-1165/-1155) (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>, indicated in yellow). We found that the studied sequence is highly conserved within the Scombridae family, with a similarity of 72.8% in average. Both tuna species, southern bluefin and yellowtail tuna, share all 24 TFBSs discovered, with 12 of them also common to chub mackerel. These TFBSs include SF-1, Nr5A2, Sox3, FOS::JUN, Foxl2, and ESRR. TFBSs conservation varies across species. One Foxl2 site, consistently identified around position -170, is present across all examined species. Additionally, two regions harboring multiple putative TFBSs (ESRR, SF-1, and Nr5A2), located relatively close upstream of this Foxl2 site, are commonly observed in most sequences. Moreover, unique TFBSs were discovered for each fish species. Notably, the Bamboo leaf wrasse distinguishes itself with 20 out of 25 (80%) exclusive TFBSs, predominantly featuring FOS::JUN, Foxl2, and Sox3. Furthermore, this species boasts the highest count of cAMP-response element binding protein (CREB), Foxl2, and Dmrt1 sites identified (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>UpSet plot illustrating unique and shared TFBSs among the analyzed fish species. The stacked bar plot indicates the frequency of each interaction, with each color representing a different TFBS. The gray bar plot on the left shows the total number of TFBSs found for each fish species. Black dots connected by lines indicate TFBSs that overlap in different species, while unconnected dots represent TFBSs unique to a particular species. Interactions highlighted in red denote TFBSs that are novel to the Q-saba strain, while those in yellow indicate TFBSs unique to wild chub mackerel.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-11-1408561-g002.tif"/>
</fig>
<p>Exploring CpG content reveals CpG islands exclusively in Japanese flounder (within the gene body, 108bp long) and Nile tilapia (-1321/-1209 upstream of the start codon, 113bp long), with no overlap. CpG site content is highest in flounder and tilapia (34 and 28 sites, respectively), followed by chub mackerel with 20 sites. In contrast, southern bluefin tuna and yellowtail tuna exhibit the lowest CpG site counts (11 and 12 sites, respectively). Notably, sequences with the highest CpG content, namely Japanese flounder and Nile tilapia, also display the lowest amount of TFBSs (15 TFBSs in both species). Interestingly, additional CpG sites found in chub mackerel but absent in tunas are predominantly within the gene body (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). Despite high sequence conservation between tunas and chub mackerel, their CpG sites differ significantly in distribution and abundance.</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Sexual dimorphism in <italic>cyp19a</italic> DNA methylation patterns and gene expression</title>
<p>Next, to explore the <italic>cyp19a</italic> promoter further and gain insights into the molecular dynamics within a member of the Scombridae family, we conducted BS-seq to examine DNA methylation patterns in chub mackerel. To do so, we first analyzed gonadal DNA methylation levels of <italic>cyp19a</italic> promoter and first exon. The Kruskal-Wallis test revealed significant differences in DNA methylation patterns between females and males (p-value &lt; 0.001). Consistency in CpG methylation levels was observed among individuals of the same sex. Specifically, females exhibited an average DNA methylation of 30.92% &#xb1; 3.42%, while males showed 96.19% &#xb1; 1.12% (expressed as mean &#xb1; S.E.M).</p>
<p>Furthermore, <italic>post-hoc</italic> comparisons using Dunn&#x2019;s test revealed sex-related differences for almost all CpGs included in this study, with DNA methylation levels significantly higher in males (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). Notably, the most significant differences in methylation were observed in the distal part of the promoter, whereas differences within the 5&#x2019;-UTR and the first exon were less pronounced. CpG sites downstream the start codon exhibit an increased in methylation levels in females (58~60%), compared to the sites located further upstream (9~21%). It&#x2019;s noteworthy that the majority of these CpGs are exclusive to <italic>S. japonicus</italic> and not found in tunas.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Relative DNA methylation levels in the promoter region of gonad <italic>cyp19a</italic> for males (blue) and females (pink). Average methylation was computed for each CpG position. Error bars indicate standard error and * denotates significant sexual differences for each CpG position (adjusted p value &lt;0.05). N=8 fish.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-11-1408561-g003.tif"/>
</fig>
<p>When analyzing the link between DNA methylation levels and <italic>cyp19a</italic> expression, a statistically significant negative correlation of -0.52 was identified (p-value &lt; 0.001). This finding suggests that fish with higher gonad DNA methylation levels tend to exhibit lower expression of aromatase. Additionally, the strength of this correlation varies across different CpG positions analyzed, ranging from a robust -0.70 correlation at CpG position 25 to a milder -0.27 correlation at CpG position 107 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Correlation between <italic>cyp19a</italic> expression and DNA methylation in gonad, for each CpG studied (represented in different colors). The global correlation coefficient is -0.52 and this inversely proportional relationship prevails for most CpG positions.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-11-1408561-g004.tif"/>
</fig>
<p>We also measured gene expression of enzymes responsible for maintaining DNA methylation dynamics. While no significant differences were observed in <italic>dnmt1</italic> expression, all three Tet enzymes exhibited significantly higher expression levels in mature ovaries compared to testes. Notably, <italic>tet1</italic>, <italic>tet2</italic>, and <italic>tet3</italic> were expressed approximately 5, 12, and 9 times more in females, respectively (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). This gender-specific variation in the expression of these enzymes aligns with the overall lower methylation levels observed in ovaries.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Mean relative expression of <italic>tet1</italic>, <italic>tet2</italic>, <italic>tet3</italic> and <italic>dnmt1</italic> in ovaries (pink) and testes (blue). Error bars indicate standard error and significant differences are denoted by their p-values (Dun&#x2019;s test). N=15~16 fish.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-11-1408561-g005.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>The sex-biased methylation of <italic>cyp19a</italic> promoter is well conserved, but methylation patterns are species-specific</title>
<p>We compared the DNA methylation patters found in chub mackerel with two other species. The target regions, even though variable in length, were all established around the <italic>cyp19a</italic> start codon (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Data</bold>
</xref>). We found that Japanese anchovy also shares a putative Foxl2 binding site with the other fish previously analyzed, located at position -226/-218. This site is situated relatively close to a well-conserved SF-1 site (position -247/-236), with a CpG site in-between. The SF-1 site is also present in chub mackerel and wrasse and overlaps with an ESRR site in these two species (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S3</bold>
</xref>). When compared, the methylation levels at that CpG site followed the expected trend, with females displaying lower methylation levels (38% and 46%) than males (94% in both cases) for Japanese anchovy and chub mackerel, respectively. In the case of bamboo leaf wrasse, while the trend persists, the difference is much smaller (92% for females and 100% for males). Across all three species, we noted higher <italic>cyp19a</italic> promoter methylation levels in testes compared to ovaries, consistent with the downregulation of aromatase expression (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). However, these differences in methylation were notably smaller in the hermaphrodite fish. While the males of the two gonochoristic fish were between 38 to 69% more methylated than females, this contrast was only 10% in the bamboo leaf wrasse. Furthermore, this pattern completely inverts at the CpG site nearest to the start codon, with hypermethylation observed in females (85%) rather than males (29%). We found several putative TFBSs overlapping that CpG, including CREBL1, CREB3L1, HES2, HES5 and Hey2, which make that region an interesting focus for future research.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Comparative analysis of the methylation patterns within the <italic>cyp19a</italic> promoter region in two gonochoristic fish (<italic>S. japonicus</italic> and <italic>E. japonicus</italic>) and a protogynous hermaphrodite fish (P. sieboldin). Methylation range percentages are depicted in grayscale. On the right, <italic>cyp19a</italic> expression is presented with standard error values in ovaries (pink) and testes (blue) for all three species.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-11-1408561-g006.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>
<italic>Cyp19a</italic> promoter activation <italic>in vitro</italic>
</title>
<p>Finally, to investigate the impact of <italic>cyp19a</italic> promoter methylation on gene expression in chub mackerel, we conducted an <italic>in vitro</italic> experiment involving the artificial methylation of the studied sequence. A significant reduction in the activation of the methylated promoter was observed (adjusted p-value &lt; 0.001). These findings align with our previous observations of decreased <italic>cyp19a</italic> expression under conditions of increased methylation, further strengthening the link between DNA methylation and <italic>cyp19a</italic> downregulation.</p>
<p>Additionally, we investigated specific regulatory elements on the <italic>cyp19a</italic> promoter through deletion analysis. Specifically, we investigated three putative binding sites for SF-1. Two of these sites (positions -821/-810 and -707/-696) were unique to chub mackerel and one (-217/-207) was shared by most species, also overlapping with ESRR and Nr5A2. Interestingly, only the deletion introduced at position -821/-810 upstream of the start codon significantly repressed promoter activity (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). These findings suggest that this deleted region, present in chub mackerel but absent in other scombrids, play a role in the upregulation of <italic>cyp19a</italic>. Moreover, while the other two introduced deletions did not exhibit significant differences, a trend of reduced luciferase activity compared to the control was observed, suggesting potential effects on <italic>cyp19a</italic> regulation. Specifically, the deletion introduced at position -217/-207, shared with bamboo leaf wrasse, contains a differentially methylated CpG (mCpG) site in both species. The sexual dimorphism at this position is evident in both species, but it is more pronounced in chub mackerel, with methylation levels at 46% for females and 94% for males, whereas in wrasse, it stands at 92% for females and 100% for males. These results position the deleted sequence as a TFBS candidate, shared across species.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>
<italic>In vitro</italic> assay of <italic>cyp19a</italic> promoter. Luciferase activity in the methylated <italic>cyp19a</italic> promoter group (purple) was significantly repressed, compared to the unmethylated group (***, adjusted p-value &lt; 0.001). All introduced deletions exhibited lower luciferase activity, (measured as relative luminescence) than the control, but only the -821/-810 deletion was significantly different (****, adj. p-value &lt; 0.0001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-11-1408561-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<sec id="s4_1">
<label>4.1</label>
<title>The regulatory elements of the <italic>cyp19a</italic> promoter are highly conserved across scombrid species, though their CpG content varies</title>
<p>The comparative <italic>in silico</italic> examination of the <italic>cyp19a</italic> promoter reveals several remarkably conserved elements among tunas and chub mackerel, which are absent in other species. Southern bluefin and yellowtail tuna share all 24 TFBSs discovered, half of them also common in chub mackerel. These shared putative TFBSs include Foxl2, Sox3, SF-1, and ESRR, indicating potential roles in gene expression regulation. For instance, Foxl2 has been found to upregulate <italic>cyp19a</italic> gene expression by directly binding to the promoter in Nile tilapia (<xref ref-type="bibr" rid="B34">Wang et&#xa0;al., 2007</xref>), consistent with other studies reporting a female-biased expression of Foxl2 in gonad (<xref ref-type="bibr" rid="B19">Li et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B29">Shu et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B28">Shen X. et&#xa0;al., 2023</xref>). Similarly, we also found that <italic>foxl2</italic> gene is highly expressed in ovaries of mature chub mackerel (data not shown). Furthermore, the co-transfection of Foxl2 with SF-1 was shown to have a synergetic influence in the <italic>in vitro</italic> activation of <italic>cyp19a</italic> promoter, effect lost when the promoter is hypermethylated (<xref ref-type="bibr" rid="B22">Navarro-Mart&#xed;n et&#xa0;al., 2011</xref>). Likewise, Sox3 has also been found to be differentially higher expressed in females (<xref ref-type="bibr" rid="B19">Li et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B28">Shen X. et&#xa0;al., 2023</xref>) and is suggested to affect <italic>cyp19a</italic> transcription by directly binding to the promoter in a frog species (<xref ref-type="bibr" rid="B23">Oshima et&#xa0;al., 2009</xref>). The presence of these common regulatory elements across scombrids suggests a conserved regulatory network governing gene expression. The modulation of <italic>cyp19a</italic> expression, may exhibit similar regulatory mechanisms across these species. Moreover, the methylation status of the promoter could influence the binding of a combination of these TFs and consequently modulate aromatase expression in the gonad. To this date, there are several articles discussing the relationship of DNA methylation with transcription. In a global analysis of the human TF and CpG methylation, for example, researchers found that most of the 542 TFBSs analyzed were affected by mCpG, with the great majority being inhibited while some TF preferred to bind to methylated DNA (<xref ref-type="bibr" rid="B36">Yin et&#xa0;al., 2017</xref>). The location and content of CpGs also hold importance in gene regulation. While the majority of CpG sites located in the distal part of the promoter were conserved in both tunas and chub mackerel, those closer to the start codon were largely absent in tunas. Despite the high conservation of the <italic>cyp19a</italic> promoter region within the Scombridae family, the same level of conservation does not extend to individual CpG sites. On a broader scale, we also observed a variation in CpG content across species, with some exhibiting CpG islands (notably in Japanese flounder and Nile tilapia), and higher CpG content. We identified conserved SF-1 and Foxl2 sites, along with a CpG site in-between, across all species examined (with the CpG site absent only in the medaka sequence). Some TFBSs were present in most species, but shifted location, like the androgen receptor (AR). We found CpG sites surrounding the TATA box at varying distances across different species. In a study conducted in 2007, Kitazawa and Kitazawa observed that a single-CpG site adjacent to the TATA box of the mouse RANKL gene exhibited a tissue-specific methylation pattern and, when methylated, influenced TBP binding subsequently affecting gene expression. It is likely that certain CpG sites play varying roles in the regulation of aromatase expression, with some contributing more significantly while others exerting a lesser impact.</p>
</sec>
<sec id="s4_2">
<label>4.2</label>
<title>Differential DNA methylation patterns of <italic>cyp19a</italic> promoter were found in adult chub mackerel gonad, consistent with sex-biased <italic>cyp19a</italic> expression</title>
<p>We found a clear difference in methylation patterns between adult female and male chub mackerel. We detected significantly higher methylation levels in male fish, matching the lower observed aromatase expression, which suggests a potential downregulation effect on <italic>cyp19a</italic> expression. Methylation of the promoter may influence the activation of <italic>cyp19a</italic> transcription by disrupting the binding of TF to the promoter. Conversely, while still displaying sexual dimorphism, the observed differences in methylation levels were considerably smaller for most mCpG sites located downstream of the start codon. Interestingly, almost all CpG sites located within <italic>cyp19a</italic> gene body were exclusively present in chub mackerel. Whether methylation of these intragenic CpGs is relevant or not on expression modulation is yet to be confirmed. There is limited information regarding potential explanations in fish models, but some studies in other vertebrates suggest that methylation within gene bodies may not exert the same regulatory influence as methylation within promoters. For instance, gene body methylation was found not to be associated with gene repression on the human X chromosome (<xref ref-type="bibr" rid="B9">Hellman and Chess, 2007</xref>). Moreover, in mammalian genes, active expression has been observed in presence of extensive methylation of intragenic CpG islands (<xref ref-type="bibr" rid="B17">Larsen et&#xa0;al., 1993</xref>; <xref ref-type="bibr" rid="B33">Unoki and Nakamura, 2003</xref>). These findings collectively emphasize that DNA methylation has context-dependent effects on gene expression regulation. Intragenic CpG sites, absent on other scombrids, could be affecting the overall modulation of <italic>cyp19a</italic> to a lesser extent, affecting transcription elongation or alternative splicing (<xref ref-type="bibr" rid="B11">Jones, 2012</xref>). It is also worth mentioning that, due to experimental limitations of the bisulfite treatment, commonly included in most DNA methylation related studies, it is not possible to differentiate between mCpG and hydroxymethylated CpGs. Cytosine hydroxymethylation is an epigenetic modification of DNA which effects on gene regulation may vary from those of DNA methylation. It was found to be enriched on tissue-specific gene bodies and associated with active transcription (<xref ref-type="bibr" rid="B7">Cui et&#xa0;al., 2020</xref>), in contrast with the common association of DNA methylation with gene repression. There is a possibility that the higher methylation levels observed within actively transcribed gene bodies correspond to hydroxymethylated cytosines.</p>
<p>Continuing our analysis, we performed <italic>in vitro</italic> experiments to evaluate the impact of promoter methylation on transcriptional activation. Our results indicated a significant repression of luciferase activity in the methylated <italic>cyp19a</italic> promoter group compared to the unmethylated control, confirming the regulatory role of methylation in gene expression. To elucidate the underlying mechanisms, we then explored the involvement of three previously identified SF-1 binding sites in gene regulation. We successfully identified a putative SF-1 binding site that, when deleted, led to a remarkable reduction in promoter activity, comparable with the methylated promoter group, suggesting an essential role of this motif in aromatase regulation. In addition, the other two deletions, even though not significant, negatively affected luciferase activity. Remarkably, the deleted sequence from position -217 to -207 contains three TFBSs (SF-1, ESRR, and Nr5A2) and is shared by most of the analyzed fish species. Additionally, it overlaps with a CpG site present in scombrids and bamboo leaf wrasse. Our previous analysis of <italic>sf-1</italic> gene expression in gonads revealed comparable levels between females and males (data not shown). Given SF-1 is present in both ovaries and testes, methylation of the promoter may serve to obstruct the binding of available SF-1, which is partially responsible for the downregulation of <italic>cyp19a</italic>.</p>
<p>When analyzing gene expression of enzymes involved in methylation dynamics, we found that <italic>dnmt1</italic> expression levels were similar in all fish, whereas Tet enzymes expression exhibited a significant increase in the female group. Dnmt1 plays a crucial role in maintaining methylation patterns within the genome (<xref ref-type="bibr" rid="B3">Bestor, 2000</xref>), while Tet enzymes are responsible for catalyzing the oxidation of methyl groups (<xref ref-type="bibr" rid="B30">Tahiliani et&#xa0;al., 2009</xref>). Tet enzymes, due to facilitating active DNA demethylation, offer a dynamic mechanism for modulating gene expression in response to environmental cues. Interestingly, despite similar levels of <italic>dnmt1</italic> mRNA abundance, the notably elevated synthesis of oxidases could be indicating active mCpG oxidation and consequently activation of epigenetically modulated genes. Our findings suggest that the distinct sexual dimorphic methylation patterns observed in chub mackerel <italic>cyp19a</italic> promoter are due to active demethylation by tet enzymes, rather than male-biased dnmt1 activity.</p>
</sec>
<sec id="s4_3">
<label>4.3</label>
<title>DNA methylation patterns are species-specific and may differ depending on the sexual system</title>
<p>The link between promoter methylation and <italic>cyp19a</italic> expression has been previously studied in other species of fish. Sex differences in methylation levels were also found in the <italic>cyp19a</italic> promoter of Chinese sea perch (<xref ref-type="bibr" rid="B6">Chen et&#xa0;al., 2018</xref>) and Japanese flounder (<xref ref-type="bibr" rid="B35">Wen et&#xa0;al., 2014</xref>), among others. In our laboratory, we also conducted similar experiments with bamboo leaf wrasse, a hermaphrodite fish, and Japanese anchovy. We found conserved binding sites for Foxl2 and SF-1, both of which have been shown to enhance the <italic>in vitro</italic> activation of the <italic>cyp19a</italic> promoter (<xref ref-type="bibr" rid="B21">Nakamoto et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B22">Navarro-Mart&#xed;n et&#xa0;al., 2011</xref>), suggesting that these two closely located TFBSs jointly play a role in <italic>cyp19a</italic> regulation.</p>
<p>In this study, we observed an increased methylation level in the testes&#x2019; aromatase promoter, consistent with the previously mentioned studies in other species. We also identified sexually and species-variable DNA methylation patterns. The overall sexual difference in methylation levels is much more distinct in the gonochoristic species analyzed, whereas for the bamboo leaf wrasse, the differences were much smaller. In a specific case, we examined the methylation levels of a single CpG position (-210 in chub mackerel and -131 in bamboo leaf wrasse), which coincides with one of the deletions introduced in the experiment mentioned above (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>, position -217/-207). This deleted sequence encompasses two shared TFBSs by these fish, SF-1 and ESRR. At this position, the sexual bias in methylation is much more pronounced in chub mackerel. We observed a trend of repression when deleting the sequence in chub mackerel, suggesting that this site may have a mild effect on promoter activation. However, further investigation is needed to determine the extent to which the methylation of this common site is relevant.</p>
<p>Sex-change is a complex process that usually involves gonadal transformation. Previously, a sharp downregulation of ovarian aromatase was found to precede sex-change in three species of wrasse (<xref ref-type="bibr" rid="B31">Thomas et&#xa0;al., 2019</xref>), supporting the idea of <italic>Cyp19a</italic> as a proximal regulator of gonadal change in protogynous species. Hypermethylation of the aromatase promoter during sex-change has also been investigated before. In one study, scientists observed an overall rise in methylation levels following masculinization of bluehead wrasse, which is also evident in the hypermethylation of a CpG island associated with the transcription start site (TSS) (<xref ref-type="bibr" rid="B32">Todd et&#xa0;al., 2019</xref>). This aligns with the overall increase in methylation discovered in the bamboo leaf wrasse but contrasts with the specific decrease in methylation observed at the CpG site nearest to the TSS. An overall hypermethylated promoter with a punctual hypomethylated CpG site was also observed in the protogynous orange-spotted grouper after sex-change (<xref ref-type="bibr" rid="B8">Guo et&#xa0;al., 2021</xref>). As mentioned earlier, even differential methylation at a single CpG site can sufficiently modulate gene expression (<xref ref-type="bibr" rid="B13">Kitazawa and Kitazawa, 2007</xref>). Given their capacity for sex change, we anticipate that hermaphrodite fish will display greater variability and plasticity in their methylation patterns. Furthermore, this fish presented the highest unique TFBS count among the rest of fish analyzed earlier, which highlights how distinct its regulatory region is from those of gonochoristic fishes. DNA methylation shifts during sex change seem to globally increase, while DNA methylation patterns exhibit unique species-specific characteristics. This implies that while the global increase in DNA methylation is a commonality, the nuanced patterns are intricately tailored to the specific genetic makeup of each species, contributing to the complexity of the observed phenomenon.</p>
<p>This study contributes to our understanding of <italic>Cyp19a</italic> regulation and gonad maturation in fish. Our research confirms that DNA methylation of <italic>cyp19a</italic> exhibits sex-specific patterns and is prevalent among adult fish. Notably, our findings reveal that the <italic>cyp19a</italic> promoter is highly conserved in scombrids, suggesting that the results obtained from chub mackerel could provide valuable insights into the same process in other members of the Scombridae family. Moreover, we discovered that, while overall methylation affects <italic>cyp19a</italic> activity, differences in CpG content may introduce subtle distinctions in its regulation. These findings are pivotal in advancing our comprehension of sexual development and reproductive processes in fish, shedding light on the intricate mechanisms underlying these biological phenomena.</p>
</sec>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The data presented in the study are deposited in the NCBI repository (<uri xlink:href="https://www.ncbi.nlm.nih.gov/">https://www.ncbi.nlm.nih.gov/</uri>), accession numbers PP825915 and PP825916.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Kyushu University Animal Husbandry Guidelines. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>MG: Writing &#x2013; original draft, Methodology, Investigation, Formal analysis, Conceptualization. AD: Writing &#x2013; review &amp; editing, Methodology. YE: Writing &#x2013; review &amp; editing, Methodology. AT: Writing &#x2013; review &amp; editing. TI: Writing &#x2013; review &amp; editing. SM: Writing &#x2013; review &amp; editing. YO: Writing &#x2013; review &amp; editing. MS: Writing &#x2013; review &amp; editing. MM: Writing &#x2013; review &amp; editing. TC: Writing &#x2013; review &amp; editing. KO: Writing &#x2013; review &amp; editing.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article.This research was financially supported by JSPS KAKENHI grant numbers: JP16H04981, JP16H06279 (PAGS), JP19H03049, JP22H00386, JP22K05832,and JP22K19211.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors thank all the staff of Aqua-BioResource Innovation Center (ABRIC) Karatsu satellite, Kyushu University, for fish maintenance and sampling support. </p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmars.2024.1408561/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmars.2024.1408561/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anastasiadi</surname> <given-names>D.</given-names>
</name>
<name>
<surname>D&#xed;az</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Piferrer</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Small ocean temperature increases elicit stage-dependent changes in DNA methylation and gene expression in a fish, the European sea bass</article-title>. <source>Sci. Rep.</source> <volume>7</volume>, <fpage>12401</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598&#x2013;017-10861&#x2013;6</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Barange</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Perry</surname> <given-names>R. I.</given-names>
</name>
</person-group> (<year>2009</year>). &#x201c;<article-title>Physical and ecological impacts of climate change relevant to marine and inland capture fisheries and aquaculture</article-title>,&#x201d; in <source>Climate change implications for fisheries and aquaculture: Overview of current scientific knowledge (FAO Fisheries and Aquaculture Technical Paper No. 530</source>. Eds. <person-group person-group-type="editor">
<name>
<surname>Cochrane</surname> <given-names>K.</given-names>
</name>
<name>
<surname>De Young</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Soto</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Bahri</surname> <given-names>T.</given-names>
</name>
</person-group> (<publisher-name>FAO</publisher-name>, <publisher-loc>Rome</publisher-loc>), <fpage>7</fpage>&#x2013;<lpage>106)</lpage>.</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bestor</surname> <given-names>T. H.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>The DNA methyltransferases of mammals</article-title>. <source>Hum. Mol. Genet.</source> <volume>9</volume>, <fpage>2395</fpage>&#x2013;<lpage>2402</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/hmg/9.16.2395</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castro-Mondragon</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Riudavets-Puig</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Rauluseviciute</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Berhanu Lemma</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Turchi</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Blanc-Mathieu</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>JASPAR 2022: the 9th release of the open-access database of transcription factor binding profiles</article-title>. <source>Nucleic Acids Res.</source> <volume>50</volume>, <fpage>D165</fpage>&#x2013;<lpage>D173</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkab1113</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Catalano</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Marsico</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Giordano</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Mauro</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Rizza</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Panno</surname> <given-names>M. L.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Leptin enhances, via AP-1, expression of aromatase in the MCF-7 cell line</article-title>. <source>J. Biol. Chem.</source> <volume>278</volume>, <fpage>28668</fpage>&#x2013;<lpage>28676</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M301695200</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>He</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Expression and DNA methylation analysis of cyp19a1a in Chinese sea perch Lateolabrax maculatus</article-title>. <source>Comp. Biochem. Physiol. Part B Biochem. Mol. Biol.</source> <volume>226</volume>, <fpage>85</fpage>&#x2013;<lpage>90</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cbpb.2018.07.008</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname> <given-names>X. L.</given-names>
</name>
<name>
<surname>Nie</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ku</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Dougherty</surname> <given-names>U.</given-names>
</name>
<name>
<surname>West-Szymanski</surname> <given-names>D. C.</given-names>
</name>
<name>
<surname>Collin</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>A human tissue map of 5-hydroxymethylcytosines exhibits tissue specificity through gene and enhancer modulation</article-title>. <source>Nat. Commun.</source> <volume>11</volume>, <fpage>6161</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-020-20001-w</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>C.-Y.</given-names>
</name>
<name>
<surname>Tseng</surname> <given-names>P.-W.</given-names>
</name>
<name>
<surname>Hwang</surname> <given-names>J.-S.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>G.-C.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>C.-F.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Potential role of DNA methylation of cyp19a1a promoter during sex change in protogynous orange-spotted grouper, Epinephelus coioides</article-title>. <source>Gen. Comp. Endocrinol.</source> <volume>311</volume>, <elocation-id>113840</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2021.113840</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hellman</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chess</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Gene body-specific methylation on the active X chromosome</article-title>. <source>Science</source> <volume>80). 315</volume>, <fpage>1141</fpage>&#x2013;<lpage>1143</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1136352</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Sex determination and maintenance: the role of DMRT1 and FOXL2</article-title>. <source>Asian J. Androl.</source> <volume>19</volume>:<page-range>619&#x2013;624</page-range>. doi: <pub-id pub-id-type="doi">10.4103/1008-682X.194420</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jones</surname> <given-names>P. A.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Functions of DNA methylation: islands, start sites, gene bodies and beyond</article-title>. <source>Nat. Rev. Genet.</source> <volume>13</volume>, <fpage>484</fpage>&#x2013;<lpage>492</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrg3230</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kime</surname> <given-names>D. E.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>Classical and non-clssical reproductive steroids in fish</article-title>. <source>Rev. Fish Biol. Fish.</source> <volume>3</volume>, <fpage>160</fpage>&#x2013;<lpage>180</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/BF00045230</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kitazawa</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Kitazawa</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Methylation status of a single cpG locus 3 bases upstream of TATA-box of receptor activator of nuclear factor-&#x3ba;B ligand (RANKL) gene promoter modulates cell- and tissue-specific RANKL expression and osteoclastogenesis</article-title>. <source>Mol. Endocrinol.</source> <volume>21</volume>, <fpage>148</fpage>&#x2013;<lpage>158</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/me.2006-0205</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Krassowski</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Arts</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Lagger</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Max</surname>
</name>
</person-group> (<year>2022</year>). <article-title>krassowski/complex-upset: v1.3.5</article-title>. <source>Zenodo</source>. doi:&#xa0;<pub-id pub-id-type="doi">10.5281/zenodo.7314197</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Mendelson</surname> <given-names>C. R.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Estrogen-Related receptor &#x3b3; (ERR&#x3b3;) mediates oxygen-Dependent induction of aromatase (CYP19) gene expression during human trophoblast differentiation</article-title>. <source>Mol. Endocrinol.</source> <volume>25</volume>, <fpage>1513</fpage>&#x2013;<lpage>1526</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/me.2011-1012</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Suleski</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Craig</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Kasprowicz</surname> <given-names>A. E.</given-names>
</name>
<name>
<surname>Sanderford</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>TimeTree 5: an expanded resource for species divergence times</article-title>. <source>Mol. Biol. Evol.</source> <volume>39</volume>, <elocation-id>msac174</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molbev/msac174</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Larsen</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Solheim</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Prydz</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>A methylated CpG island 3&#x2019; in the apolipoprotein-E gene does not repress its transcription</article-title>. <source>Hum. Mol. Genet.</source> <volume>2</volume>, <fpage>775</fpage>&#x2013;<lpage>780</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/hmg/2.6.775</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lex</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Gehlenborg</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Strobelt</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Vuillemot</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Pfister</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>UpSet: visualization of intersecting sets</article-title>. <source>IEEE Trans. Visualization Comput. Graphics</source> <volume>20</volume>, <fpage>1983</fpage>&#x2013;<lpage>1992</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1109/TVCG.2014.2346248</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Gonadal transcriptome analysis of sex-related genes in the protandrous yellowfin seabream (Acanthopagrus latus)</article-title>. <source>Front. Genet.</source> <volume>11</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fgene.2020.00709</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Madeira</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Pearce</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tivey</surname> <given-names>A. R. N.</given-names>
</name>
<name>
<surname>Basutkar</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Edbali</surname> <given-names>O.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Search and sequence analysis tools services from EMBL-EBI in 2022</article-title>. <source>Nucleic Acids Res.</source> <volume>50</volume>, <fpage>W276&#x2014;W279</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkac240</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakamoto</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D.-S.</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Matsuda</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Nagahama</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Shibata</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Dax1 suppresses P450arom expression in medaka ovarian follicles</article-title>. <source>Mol. Reprod. Dev.</source> <volume>74</volume>, <fpage>1239</fpage>&#x2013;<lpage>1246</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/mrd.20689</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Navarro-Mart&#xed;n</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Vi&#xf1;as</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ribas</surname> <given-names>L.</given-names>
</name>
<name>
<surname>D&#xed;az</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Guti&#xe9;rrez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Di Croce</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>DNA methylation of the gonadal aromatase (cyp19a) promoter is involved in temperature-dependent sex ratio shifts in the European sea bass</article-title>. <source>PloS Genet.</source> <volume>7</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pgen.1002447</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oshima</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Naruse</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Sox3: A transcription factor for Cyp19 expression in the frog Rana rugosa</article-title>. <source>Gene</source> <volume>445</volume>, <fpage>38</fpage>&#x2013;<lpage>48</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.gene.2009.05.011</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Petrik</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Stock</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Andersen</surname> <given-names>K. H.</given-names>
</name>
<name>
<surname>van Denderen</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Dani&#xeb;l</surname> <given-names>W. J. R.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Large pelagic fish are most sensitive to climate change despite pelagification of ocean food webs</article-title>. <source>Front. Mar. Sci.</source> <volume>7</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmars.2020.588482</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Piferrer</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Bl&#xe1;zquez</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Aromatase distribution and regulation in fish</article-title>. <source>Fish Physiol. Biochem.</source> <volume>31</volume>, <fpage>215</fpage>&#x2013;<lpage>226</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10695-006-0027-0</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ryu</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Veilleux</surname> <given-names>H. D.</given-names>
</name>
<name>
<surname>Donelson</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Munday</surname> <given-names>P. L.</given-names>
</name>
<name>
<surname>Ravasi</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>The epigenetic landscape of transgenerational acclimation to ocean warming</article-title>. <source>Nat. Clim. Change</source> <volume>8</volume>, <fpage>504</fpage>&#x2013;<lpage>509</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41558-018-0159-0</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shen</surname> <given-names>W.-K.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>S.-Y.</given-names>
</name>
<name>
<surname>Gan</surname> <given-names>Z.-Q.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.-Z.</given-names>
</name>
<name>
<surname>Yue</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>M.-M.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>AnimalTFDB 4.0: a comprehensive animal transcription factor database updated with variation and expression annotations</article-title>. <source>Nucleic Acids Res.</source> <volume>51</volume>, <fpage>D39</fpage>&#x2013;<lpage>D45</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkac907</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Y&#xe1;&#xf1;ez</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Bastos Gomes</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Poon</surname> <given-names>Z. W. J.</given-names>
</name>
<name>
<surname>Foster</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Alarcon</surname> <given-names>J. F.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Comparative gonad transcriptome analysis in cobia (Rachycentron canadum)</article-title>. <source>Front. Genet.</source> <volume>14</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fgene.2023.1128943</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kong</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Function of Foxl2 and Dmrt1 proteins during gonadal differentiation in the olive flounder Paralichthys olivaceus</article-title>. <source>Int. J. Biol. Macromol.</source> <volume>215</volume>, <fpage>141</fpage>&#x2013;<lpage>154</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijbiomac.2022.06.098</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tahiliani</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Koh</surname> <given-names>K. P.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Pastor</surname> <given-names>W. A.</given-names>
</name>
<name>
<surname>Bandukwala</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Brudno</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1</article-title>. <source>Science</source> <volume>324</volume>, <fpage>930</fpage>&#x2013;<lpage>935</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1170116</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thomas</surname> <given-names>J. T.</given-names>
</name>
<name>
<surname>Todd</surname> <given-names>E. V.</given-names>
</name>
<name>
<surname>Muncaster</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lokman</surname> <given-names>P. M.</given-names>
</name>
<name>
<surname>Damsteegt</surname> <given-names>E. L.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Conservation and diversity in expression of candidate genes regulating socially-induced female-male sex change in wrasses</article-title>. <source>PeerJ</source> <volume>7</volume>, <elocation-id>e7032</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.7717/peerj.7032</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Todd</surname> <given-names>E. V.</given-names>
</name>
<name>
<surname>Ortega-Recalde</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Lamm</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Rutherford</surname> <given-names>K. M.</given-names>
</name>
<name>
<surname>Cross</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Stress, novel sex genes, and epigenetic reprogramming orchestrate socially controlled sex change</article-title>. <source>Sci. Adv.</source> <volume>5</volume>, <fpage>1</fpage>&#x2013;<lpage>14</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/sciadv.aaw7006</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Unoki</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Methylation at CpG islands in intron 1 of EGR2 confers enhancer-like activity</article-title>. <source>FEBS Lett.</source> <volume>554</volume>, <fpage>67</fpage>&#x2013;<lpage>72</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0014-5793(03)01092-5</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>D.-S.</given-names>
</name>
<name>
<surname>Kobayashi</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>L.-Y.</given-names>
</name>
<name>
<surname>Paul-Prasanth</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Ijiri</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sakai</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>Foxl2 up-regulates aromatase gene transcription in a female-specific manner by binding to the promoter as well as interacting with ad4 binding protein/steroidogenic factor 1</article-title>. <source>Mol. Endocrinol.</source> <volume>21</volume>, <fpage>712</fpage>&#x2013;<lpage>725</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/me.2006-0248</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wen</surname> <given-names>A. Y.</given-names>
</name>
<name>
<surname>You</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>D. D.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Z. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>CpG methylation of dmrt1 and cyp19a promoters in relation to their sexual dimorphic expression in the Japanese flounder Paralichthys olivaceus</article-title>. <source>J. Fish Biol.</source> <volume>84</volume>, <fpage>193</fpage>&#x2013;<lpage>205</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jfb.12277</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Morgunova</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Jolma</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kaasinen</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Sahu</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Khund-Sayeed</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Impact of cytosine methylation on DNA binding specificities of human transcription factors</article-title>. <source>Science</source> <volume>356</volume>, <elocation-id>eaaj2239</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.aaj2239</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>