The strains, their derivatives and plasmids used in this study are listed in Table 1. L. paracasei was grown in De Man-Rogosa-Sharpe (MRS; Merck GmbH, Darmstadt, Germany) medium at 30°C. Lactococcus lactis subsp. lactis was grown at 30°C in M17 medium (Merck) supplemented with 0.5% glucose (GM17). Pseudomonas aeruginosa PAO1 and E. coli DH5α and M15 used for cloning and propagation of constructs were routinely grown in Luria-Bertani medium (LB) at 37°C with aeration. To obtain solid medium, agar (15 g/l; Torlak, Belgrade, Serbia) was added. Erythromycin was added to a final concentration of 10 μg/ml and 300 μg/ml for LAB and E. coli, respectively. Ampicillin and kanamycin were added to a final concentration of 100 μg/ml for E. coli. When necessary, 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-Gal; Fermentas, Vilnius, Lithuania) was added to LB medium plates at a final concentration of 40 μg/ml for blue/white color selection of colonies.

Electrocompetent Lc. lactis subsp. lactis BGKP1-20 cells was prepared as described by Holo and Nes (1989). Transformations were done by electroporation using an Eppendorf Electroporator (Eppendorf, Hamburg, Germany), except E. coli DH5α and M15, which was transformed by heat shock (Hanahan, 1983). Appropriate agar plates with antibiotics were used for the selection of transformants.

Plasmid DNA from E. coli DH5α was isolated by QIAprep Spin Miniprep kit (Qiagen GmBH, Hilden, Germany). Digestion with restriction enzymes was conducted according to the supplier’s instructions (Fermentas). DNA fragments were purified from agarose gels using a QIAquick Gel extraction kit as described by the manufacturer (Qiagen). DNA was ligated with T4 DNA ligase (Agilent technologies, USA) according to the manufacturer’s recommendations.

Specific primers used in this study are listed in section: Construction of the aggLb gene variants. KapaTaq DNA polymerase (Kapa Biosystems, Inc., Boston, MA, USA) was used to amplify DNA fragments by PCR using a GeneAmp PCR system 2700 thermal cycler (Applied Biosystems, Foster City, CA, USA). PCR products were purified with a QiaQuick PCR purification kit (Qiagen) according to the protocol of the supplier and sequenced by the Macrogen Sequencing Service (Macrogen, Netherlands). The DNA Strider program was used for open reading frame (ORF) prediction. Commercial pGEM-T-Easy (Promega, Madison, WI, USA), pCR2.1-TOPO (Thermo Scientific) and pCRII (Thermo Scientific) vectors were used for cloning of PCR products.

From construct pALb35 (Miljkovic et al., 2015) using XbaI-SalI restriction enzymes we made shorter construct pAggLbXS carrying only aggLb gene, in pAZIL vector (Supplementary Figure 1A). PstI restriction site is located in aggLb gene at position to divide it into two regions: first containing leader peptide sequence and six collagen binding domains and second containing 20 CnaB-like domains and anchor domain (Figure 1). In order to facilitate the construction of a large number of variants, aggLb gene was subcloned from pAggLbXS in two parts into pBScript vector (Agilent technologies): first part as XbaI-PstI (construct pBS-XP) and second as PstI-SalI fragments (construct pBS-PS; Supplementary Figure 1A). Bioinformatic analysis showed that HindIII (in both fragments; Supplementary Figures 1B,D) and SspI (only in XbaI-PstI fragment; Supplementary Figure 1C) restriction enzymes dividing AggLb protein to distinct portions that contain the exact number of codons without free base except one in XbaI-PstI fragment, so that they can be deleted or combined because they provide in frame junction. Constructs pBS-XP [consisting of three HindIII fragments of 820 bp, 821 bp (this two cannot be deleted separately since deletion of each fragment changed frame and introduce frameshift mutation) and 1461 bp] and pBS-PS (consisting of four HindIII fragments of 846 bp, 1266 bp, and two of 1410 bp) were partially digested with HindIII restriction enzyme and ligated. We successfully constructed pBS-XP-1, pBS-XP-4, pBS-PS-A, pBS-PS-B, pBS-PS-C, pBS-PS-D, and pBS-PS-E (for details see Table 1 and Supplementary Figure 1). From construct pBS-XP fragment carrying XbaI/PstI was recloned into pCR2.1-TOPO (since does not contain SspI restriction site; Thermo Scientific, Lithuania) giving construct pCR-XP, which was additionally partially digested with SspI restriction enzyme and ligated (constructs pCR-XP-2 and pCR-XP-3; Supplementary Figure 1). In next step, different constructs containing deletion in first part (pBS-XP-1, pBS-XP-4, pCR-XP-2, and pCR-XP-3) were combined with constructs containing deletion in second part (pBS-PS-A, pBS-PS-B, pBS-PS-C, pBS-PS-D, and pBS-PS-E) in pBScript vector (for details see Table 1 and Figure 1). In order to obtained expression in lactococci, lactococcal promoter PlsbB (Uzelac et al., 2015) was cloned into pAZIL vector together with leader sequence of aggLb gene as SacI-EagI fragment (construct pAZIL-pSE). After that different combinations of variants from pBScript vector were cloned as EagI-SalI fragments into pAZIL-pSE (for details see Table 1 and Figure 1). Lc. lactis subsp. lactis BGKP1-20 was transformed with chosen constructs and expression of different AggLb variants were confirmed by Dot blot analysis using anti-AggLb antibody.

In addition, using template clone KPPvScI (Kojic et al., 2011) and specific set of primers: KPFw (5′GCAAAGCGCCATTCGCC3′), KPPstIRev (5′CGTTCCTTCTGCAGTTCCAC3′), after PCR amplification, we obtained clone pCRII-KPI. BamHI-PstI fragment containing first part of AggL (aggregation factor from Lc. lactis subsp. lactis BGKP1) was recloned from pCRII-KPI into pBS-PS, from which entire hybrid molecule as BamHI/XhoI was transferred to pAZIL vector (digested with BamHI/SalI) and finally obtained clone was named as pKP-Lb (Table 1).

The first step of screening strains was visual auto-aggregation assay. The aggregation phenotype was scored as positive when clearly visible snowflakes-like particles, formed by aggregated cells, gravitated to the bottom of the tube, forming a precipitate and leaving clear supernatant.

The auto-aggregation ability of the selected strains and derivatives was tested according to García-Cayuela et al. (2014) with minor modifications. Briefly, cells of overnight culture were harvested by centrifugation (5000 × g, 10 min, 4°C), washed twice with phosphate-buffered saline – PBS (10 mM Na₂HPO₄, 1 mM KH₂PO₄, 140 mM NaCl, 3 mM KCl, pH 7.1) and resuspended in the same buffer. The mixture was vortexed and incubated at 30°C for a period of 5 h. Absorbance (OD₆₀₀) was measured at different time points. Percentage of auto-aggregation was determined using the equation: [1 - (A_t/A₀) × 100] where A_t represents the absorbance at different time points (1, 2, 3, 4 and 5 h) and A₀ is absorbance at time 0. Auto-aggregation assay was done in three independent experiments. Data are presented as average of absorbance values from three independent experiments per each strain. The significance was determined by Student’s t-test.

The ability of selected strains and derivatives to form biofilm was assayed in microtiter plates as previously described by Peter et al. (2013). P. aeruginosa PAO1 and E. coli DH5α were used as positive and negative control strains, respectively. Additionally, PBS buffer was included to ensure that the influence on biofilm formation by strains (resuspended in the same buffer) not attributed to a non-specific binding effect to crystal violet. The results are presented as average of absorbance values from three independent experiments per each strain. The significance was determined by Student’s t-test.

The wells of Maxisorb plates (Nunc, Roskilde, Denmark) were coated with type I collagen (from rat tail, BD Bioscience, Franklin Lakes, NJ, United States; 100 μg/ml) and human fibronectin (Serva, Heidelberg, Germany; 100 μg/ml) for 16 h at 4°C. The collagen binding ability of the selected strains and derivatives was tested according to Miljkovic et al. (2015), while the ability of tested strains and derivatives to bind to fibronectin was assayed as previously described by Ahmed et al. (2001). After immobilization, wells were washed with PBS and blocked with 2% BSA in PBS. Upon removal of BSA solution and washing wells with PBS, the test cultures (100 μl, 10⁸ CFU/ml) were added and plates were incubated on an orbital platform shaker for 2 h at 37°C. Non-adherent cells were removed by washing the wells three times with 200 μl of PBS. The adhered cells were fixed at 60°C for 20 min and stained with crystal violet (100 μl/well, 0.1% solution) for 45 min. Wells were subsequently washed tree times with PBS to remove the excess stain. The stain bound to the cells was dissolved by 100 μl of citrate buffer (pH 4.3). The absorbance was measured at 570 nm, after 45 min, using the microtiter plate reader. Collagen and fibronectin binding was assayed as described above and the average of absorbance values from three independent experiments per each strain was presented. The significance was determined by Student’s t-test.

Plots of correlation were produced using Python 2.7.8 and scipy library (version 0.14.0).

Since whole AggLb protein was not able to be expressed in E. coli the part of AggLb protein containing the inter region of 190 amino acids between collagen binding and CnaB-like domains (from 1096 aa to 1286 aa) present in all variants was expressed using pQE₃₀ vector with 6 × His tag (Qiagen) for production of anti-AggLb polyclonal antibody. Using clone pALb35 (Miljkovic et al., 2015), HindIII fragment of 560 bp containing PstI restriction site was cloned into pBScript. This fragment was recloned from pBScript vector as BamHI/SalI in frame into expression vector pQE₃₀ with 6 × His tag (pQE₃₀-AggBS). Fusion His-tagged protein was expressed in E. coli M15 cells. His-tag affinity purification of part of AggLb protein was conducted under denaturing conditions: the refolding method using urea to disrupt non-covalent bonds and increase protein solubility was used to solubilise and make the His-tagged AggLb more accessible to the nickel-nitrilotriacetic acid (Ni-NTA) resin. Purification of the fusion protein was applied according to protocol recommended by The QIAexpressionist. The eluted protein was dialyzed by ultrafiltration (Centrifugal Filter Units, Amicon Ultra-15 Centrifugal Filter Devices, 3K, Millipore). Polyclonal antibodies were produced by immunization of mice with the synthetic or purified fusion proteins in animal house of ICGEB, Trieste, Italy.

Samples (2 μl of serial dilutions of total proteins dissolved in buffer which contains: 100 mM NaH₂PO₄, 10 mM Tris-HCl, 8 M urea, pH 8.0) were loaded into a PVDF membrane (Merck Millipore, Darmstadt, Germany) by directly spotted on membrane as described by Niedergang et al. (2000). The same quantity of non-diluted samples was loaded on PAGE-SDS gel stained with Coomassie brilliant blue (Supplementary Figure 2). Membrane was incubated with 10% skim milk diluted in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) over night at 4°C in order to block non-specific reactions. Following blocking, the membrane was incubated 1 h at room temperature with gentle agitation in dilutions of primary antibody (mouse polyclonal antibody anti-AggLb-Ab). Primary antibodies were diluted in 5% skim milk diluted in TBS-T. After washing three times in TBS-T for 15 min, membrane was incubated for 1 h with horseradish peroxidase-labeled anti-mouse IgG (A9044 anti-mouse; Sigma, Germany) at a 1:10000 dilution in 5% skim milk diluted in TBS-T. The blots were washed three times in TBS-T for 15 min. Spots were detected using EMD Millipore Immobilon^TM Western Chemiluminescent HRP Substrate (ECL; Fisher Scientific, USA) following the manufacturer’s instructions.

We performed functional studies of the various domains of the AggLb protein. To produce many different domain variants of the AggLb protein, the aggLb gene was subcloned into two parts SacI-PstI and PstI-SalI fragments, using the pBscript vector. Both cloned fragments first partially digested using the HindIII restriction enzyme, and the first part of the gene was also digested using SspI; importantly, both of these enzymes leave the residual aggLb gene in frame. After obtaining different variants of both fragments they were combined to obtain constructs with different numbers of collagen binding and CnaB-like domains. The construct pPI1E did not contain any collagen binding domains and contained only two CnaB-like domains, whereas pPIAggLb contained the complete aggLb gene. For details of all the constructs see Figure 1 and Table 1. All the different combinations were recloned into the pAZIL vector using the lactococcal promoter PlsbB to provide identical transcription activity of all the constructs (Uzelac et al., 2015). The constructs (Figure 1; Table 1) were transformed into Lc. lactis subsp. lactis BGKP1-20 (the lactococcal derivative BGKP1-20 was used because the original lactobacilli strains had an extremely low efficiency of transformation) and expression was analyzed by Dot blot (Figure 2) using an anti-AggLb antibody raised against the transitional region covering the last part of the first region and the beginning of the second subclone of AggLb because this part is present in all of the constructs. Similar expression was obtained for all of the constructs regardless of the length of the protein (34.2 kDa pPI1E, 63.9 kDa pPI1D, 65.0 kDa pPI2E, 87.6 kDa pPI3E, 94.8 kDa pPI2D, 117.3 kDa pPI3D, 132.0 kDa pPI3C, 139.3 kDa pPI2B, 145.5 kDa pPI4E, 207.3 kDa pPI1A, and 318.6 kDa pPIAggLb). In addition, the hybrid molecule pKP-Lb (314.2 kDa), consisting of the first part of the lactococcal aggL gene from Lc. lactis subsp. lactis BGKP1 (Kojic et al., 2011) as a PvuI-PstI fragment and a second part of the lactobacilli aggLb gene from L. paracasei subsp. paracasei BGNJ1-64 as a PstI-SalI fragment, was constructed (Figure 1D; Table 1). All of the variants constructed were used for functional assays in order to determine the role of various domains of the AggLb aggregation protein. The correct in-frame joining of all the fragments was confirmed by DNA sequencing and expression analysis using a Dot blot (Figure 2; Supplementary Figure 2).

The auto-aggregation ability of the wild-type strain and of the derivatives harboring the different variants of aggLb in the Lc. lactis subsp. lactis BGKP1-20 (see above) was measured for a period of 5 h, and the results are presented in Supplementary Table 1. We concluded that only the constructs carrying all six collagen binding domains and the first two CnaB-like domains were able to strongly auto-aggregate (BGKP1-20/pPI4E; Figure 3; Supplementary Table 1). Alternatively, the absence of the other CnaB-like domains, did not cause a significant effect on auto-aggregation (BGKP1-20/pPI3C, BGKP1-20/pPI3D, BGKP1-20/pPI3E, BGKP1-20/pPI2B, BGKP1-20/pPI2D, BGKP1-20/pPI2E, BGKP1-20/pPI1A, BGKP1-20/pPI1D, and BGKP1-20/pPI1E; Figure 3; Supplementary Table 1). It is also interesting to note that an additive effect dependent on the number of collagen binding domains on auto-aggregation was not linear, indicating that individual collagen binding domains do not have the same contribution. Careful observation revealed that the derivatives BGKP1-20/pPI2E, BGKP1-20/pPI1A, and BGKP1-20/pPI1E formed small aggregates (resembling sand or dust) that did not contribute to the rapid aggregation of the cells. Nevertheless, a negligible level of aggregation that was visible after overnight growth in a test tube was often observed in our collection of LAB. This observation may indicate a relationship between the type and number of collagen binding domains and/or CnaB-like domains within the aggregation factor(s) and the level or types of auto-aggregation. It was, therefore, concluded that the auto-aggregation ability of strains/derivatives was directly dependent on the collagen binding domains, while the 18 C-terminal CnaB-like domains were not required for auto-aggregation. Transformants of Lc. lactis subsp. lactis BGKP1-20 carrying the hybrid construct pKP-Lb composed of the first part of the aggL gene (carrying three collagen binding domains originating from the Lc. lactis subsp. lactis BGKP1) and the second part of the aggLb gene were unable to form big aggregates, which indicated that the resulting hybrid molecule was not functional in strong auto-aggregation, collagen, or fibronectin binding (BGKP1-20/pKP-Lb; Figures 3–5) as wild-type strains (L. paracasei subsp. paracasei BGNJ1-64 and/or Lc. lactis subsp. lactis BGKP1).

In our previous studies, we found that isolates carrying the aggL or aggLb genes exhibited a direct correlation between auto-aggregation and their collagen binding ability (Miljkovic et al., 2015). All domain variants of the aggLb gene constructed in this study were tested for the ability to bind to collagen and fibronectin. Transformants carrying the different constructs adhered to immobilized collagen (Figure 4) and fibronectin (Figure 5) to different extents. Significant differences in the adherence to immobilized collagen and fibronectin were apparent between aggregation-positive strains (L. paracasei subsp. paracasei BGNJ1-64 and Lc. lactis subsp. lactis BGKP1) and their aggregation-negative derivatives (L. paracasei subsp. paracasei BGNJ1-641 and Lc. lactis subsp. lactis BGKP1-20) and also between strains carrying the first part of the aggLb gene (consisting of six collagen binding domains and the first two CnaB-like domains; BGKP1-20/pPIAggLb, BGKP1-20/pPI4E) and those variants that had only two or fewer collagen binding domains; these results indicate a role of the collagen binding domains in the interaction with collagen and fibronectin, but the last 18 CnaB-like domains are not indispensable (Figures 4 and 5). As observed in other experiments reported in this study (see above), we noticed that the additive effect dependent on the number of collagen binding domains was much lower than the impact of the specific collagen binding domains (II, III, and IV). The specific binding of AggLb to collagen and fibronectin was dependent on the collagen binding domains in a manner similar to the auto-aggregation ability. It appears that all the three phenotypes (auto-aggregation, collagen and fibronectin binding) are determined by the presence of the same structures of the AggLb protein such as the collagen binding domains.

We determined the role of the AggLb in biofilm formation. Its ability to form biofilms was tested in the wild-type strain, aggregation deficient derivatives and transformants carrying different variants of aggLb using the adherence of the cells to the surfaces of microtiter plates. The strongest biofilm formation was observed for the transformant carrying the construct pPI2D, followed by pPI3C, pPI3D, and finally, pPI3E (Figure 6). A comparative analysis of the variants led to the conclusion that the biofilm formation ability has a negative correlation with auto-aggregation, collagen, and fibronectin binding. It appears that the presence of collagen binding domains determines the formation of certain structures on AggLb that play a role in the interaction with collagen and fibronectin, but simultaneously enable the cells to auto-aggregate (pPI4E). Most likely, the absence of the collagen-binding domain (especially II, III, and IV) allows other structures to come to the fore (i.e., they are unmasked) which promotes biofilm formation. The difference between pPI1D and pPI2D is limited to the presence of a sixth collagen binding domain of AggLb in pPI2D (Figure 1; Table 2); thus, this result indicates that this domain is probably required in combination with the other domain(s) to allow biofilm formation.

We established correlations between auto-aggregation, collagen/fibronectin binding and biofilm formation ability of transformants carrying different variants of the aggLb gene. A comparative analysis of the variants led to the conclusion that the biofilm formation ability has a negative correlation with auto-aggregation – R² squared 0.312 (Supplementary Figure 3A), binding to collagen – R² squared 0.260 (Supplementary Figure 3B), binding to fibronectin – R² squared 0.242 (Supplementary Figure 3C). In addition using Python 2.7.8 and scipy library (version 0.14.0) we proved positive correlation between auto-aggregation and collagen binding – R² squared 0.652 (Supplementary Figure 3D) and aggregation and fibronectin binding – R² squared 0.636 (Supplementary Figure 3E).