Abstract
Bovine Genital Campylobacteriosis (BGC) is a worldwide spread venereal disease of cattle caused by Campylobacter fetus subsp. venerealis (Cfv). Although several real-time PCR assays were developed for Cfv identification, most target mobile genetic elements, which may lead to false-positive diagnosis. In this study, a real-time PCR assay coupled with High-Resolution Melting analysis (HRM) was developed for the identification of Campylobacter fetus subspecies and application in BGC diagnosis. Two HRM assays targeting different single nucleotide polymorphisms were validated using 51 C. fetus strains, including 36 Cfv and 15 C. fetus subsp. fetus (Cff). The specificity was assessed in 50 preputial samples previously tested as negative for C. fetus and in 24 strains from other Campylobacter species. The analytical sensitivity was determined with ten-fold dilutions of Cfv genome copies and in preputial samples spiked with Cfv cells. Both HRM assays accurately identified the 51 C. fetus strains, showing 100% concordance with the previous identification. C. fetus subspecies identification by HRM showed concordant results with the glycine test in 98.0% of the isolates. No amplification was obtained in C. fetus negative preputial samples as well as in strains from other Campylobacter species. The assays were able to detect 102 genome copies of Cfv, while for preputial washing samples the limit of detection was 103 CFU/mL. These novel HRM assays represent a highly specific and sensitive tool for the identification of C. fetus subspecies and show potential for direct use in bull preputial samples for BGC diagnosis.
Introduction
Bovine Genital Campylobacteriosis (BGC) is a venereal bacterial disease of cattle caused by Campylobacter fetus subsp. venerealis (Cfv) (). Bulls act as reservoirs of the disease by carrying Cfv in the genital tract for long periods of time (). Infection of females occurs during natural breeding or artificial insemination, and causes endometritis, embryonic mortality and abortion, resulting in cow infertility, poor herd reproductive performance, and economic losses to the cattle industry (; ).
Diagnosis of BGC requires accurate identification of the causative agent, which is challenging due to the two C. fetus subspecies that can be present in cattle, C. fetus subsp. fetus (Cff) and Cfv (). These subspecies have highly syntenic genomes and exhibit similar phenotypic traits, hampering their differentiation by molecular methods or phenotypic assays (; ). Microbiological culture followed by phenotypic identification is the classic approach for C. fetus identification and subspecies differentiation, as recommended by the Organization for Animal Health (OIE) (). This differentiation relies on the 1% glycine tolerance test, in which Cfv is intolerant, while Cff is tolerant to glycine (). Nevertheless, diagnosis of BGC by microbiological culture is challenging due to the fastidious growth and poor survival of the pathogen (). On the other hand, the polymerase chain reaction (PCR) has emerged as a promising technique to differentiate C. fetus subspecies with the advantage of not relying on bacterial viability (; ). Several assays have been developed targeting differences in genomic features such as the parA gene and the insertion element ISCfe1 (; ; ; ). However, these targets can be transferred horizontally, which can lead to lack of specificity when used for diagnostic purposes in clinical samples (; ; ). Recently, Cfv parA and ISCfe1 homologs were detected in another inhabitant of the bovine genital tract, Campylobacter portucalensis (), identifying this microorganism as a cause of false-positive results in molecular Cfv detection assays (). These reports highlight the importance of developing alternative molecular assays for reliable detection and differentiation of C. fetus subspecies.
Previous studies have shown that some single nucleotide polymorphisms (SNPs) in the core-genome of C. fetus differentiate Cff from Cfv (). In this context, real-time PCR followed by High-Resolution Melting (HRM) analysis would allow the detection of such variations in amplicon sequences. This method is based on the amplification of a target of interest in the presence of a dsDNA-binding dye, which exhibits high fluorescence in the bounded state to dsDNA and low fluorescence when unbonded. The high-resolution melting follows the amplification step, with the gradual denaturation of the amplicons due to small increments in the temperature, which originates a melting profile specific of each product (). The equipment captures changes in the fluorescence signal with high precision at different temperature points, detecting accurately differences in the melting behavior of sequences differentiated by only one SNP (). In the last years, this method has been employed as a tool for the identification and differentiation of pathogens (; ; ; ). In this study, we developed two HRM assays to detect SNPs that identify and differentiate the C. fetus subspecies. These assays have the potential to be applied directly in the analysis of clinical samples.
Materials and methods
Campylobacter fetus strains and culture conditions
Fifty-one C. fetus strains identified in previous studies as Cfv (n = 36) or Cff (n = 15; Supplementary Table 1), were used for the development of the HRM assays. Additionally, three C. fetus strains with non-consensual subspecies classification in previous studies were evaluated (Supplementary Table 1). Strains were grown on Columbia Blood Agar Plates, supplemented with 5% sheep blood (COS, Biomerieux, Marcy l’Étoile, France), at 37°C for 48 h under microaerophilic conditions (GenBox Microaer, Biomerieux, Marcy l’Étoile, France).
Glycine tolerance test
Tolerance to 1% glycine was assessed following previously published recommendations (,). Briefly, plates were prepared by adding 1% glycine (Glycine molecular biology grade, AppliChem, Darmstadt, Germany) to Columbia agar (Columbia blood agar base, Hampshire, England) before autoclaving, and supplementing with 5% defibrinated sheep blood (Thermo Scientific, Hampshire, England) after cooling. After 48 h of growth, bacterial suspensions were prepared in phosphate-buffered saline (PBS) with a turbidity adjusted to 0.3 McFarland, using a Densimat densitometer (Biomerieux, Marcy-l’Étoile, France), corresponding to 108 CFU/mL. Blood agar plates supplemented with 1% glycine were inoculated in triplicate with 20 μL drops of a bacterial suspension adjusted to 106 CFU/mL, the spots allowed to dry, and incubated under microaerophilic conditions at 37°C for 72 h. To validate absence of bacterial growth on glycine plates, bacterial growth was confirmed on glycine-free plates. Cfv NCTC 10354 and Cff NCTC 10842 were used as negative and positive controls, respectively.
DNA extraction
Genomic DNA of bacterial strains was isolated using DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) following manufacturer’s instructions. The purified DNA was quantified using a nanodrop 2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States) and stored at −20°C until analysis.
Real-time PCR-high-resolution melting analysis assays
Primer design
Three primer sets were designed to target three previously described SNPs (), with potential to differentiate Cfv from Cff. The loci CFF8240_0641, CFF8240_1016, and CFF8240_1380 from the reference sequence of Cff 82-40 (NCBI accession no. CP000487.1) were selected for primer design, using Primer3web software v.4.1.0 (; ; ) and Primer Express software (Applied Biosystems, Foster City, United States), and Primer-BLAST () for in silico specificity confirmation. The primer-BLAST analysis included 18 C. fetus genomes and revealed an SNP in Cff 04/554 genome (Accession no.: CP008808.1) in the binding site of the reverse primer targeting CFF8240_1016. Although it was not possible to design a primer between this polymorphism and the targeted SNP due to their proximity, the assay was included in the study since among all sequenced genomes of C. fetus from bovines only strain Cff 04/554 displays this polymorphism.
A preliminary analysis revealed that primers targeting locus CFF8240_1380 produced non-specific amplification products in preputial samples negative for C. fetus, and were excluded from further analysis. The assays targeting loci CFF8240_1016 and CFF8240_0641, which encode a phosphatase from Ppx/GppA family and a Hit family protein, respectively, were selected for further analysis (Table 1 and Figure 1).
TABLE 1
| Target | Primer sequence (5′–3′) | Amplicon size (bp) |
| CFF8240_0641 | Fw: GAGTGCATGGAGTTCCGTTTTT | 112 |
| Rv: TCCGCCAGACATCTTACTTTCA | ||
| CFF8240_1016 | Fw: GAGCTGCGTCAAAATCCTCAA | 95 |
| Rv: CGTGGTTGCCTTAAAACTTGGA |
Primer sequences used to identify and differentiate C. fetus subspecies.
FIGURE 1
Real-time PCR-high-resolution melting analysis
Real time PCR assays were carried out in 20 μL reaction mixtures containing 1× MeltDoctor HRM Master Mix (pplied Biosystems, Foster City, United States), 0.3 μM of each primer, 2 ng of bacterial DNA or 1 μL of DNA from preputial samples. All samples were tested in triplicate and C. fetus strains were tested in three independent runs. Cfv NCTC 10354 and Cff NCTC 10842 were included as positive controls and used for variant call. The subspecies classification was based on the melting behavior of the controls included in each run. Amplification was performed on a 7500 FAST System (Applied Biosystems, Foster City, United States) using the following thermal conditions: an initialization step of 95°C for 10 mins, followed by 40 cycles of amplification with denaturation at 95°C for 15 s and annealing at 60°C for 1 min. The generated amplicons were then subjected to the HRM step, which was performed according to the manufacturer’s specifications: denaturation at 95°C for 10 s, annealing at 60°C for 1 min, followed by HRM up to 95°C for 15 s and annealing at 60°C for 15 s. The HRM analysis was performed using the High-Resolution Melt Software v3.0 (Applied Biosystems, Foster City, United States). A threshold cycle (Ct) < 35 was considered positive and the amplification products of eight representative C. fetus strains were sequenced (Stabvida, Almada, Portugal) to confirm the presence of the expected SNP.
Specificity and analytical sensitivity
The specificity of the assays was evaluated in 24 strains from other Campylobacter species (Supplementary Table 2), including Campylobacter portucalensis (n = 5), Campylobacter sputorum (n = 6), Campylobacter lari (n = 1), Campylobacter lanienae (n = 1), Campylobacter coli (n = 4), Campylobacter jejuni (n = 3), and Campylobacter hyointestinalis (n = 4). Additionally, a total of 50 preputial washing samples previously tested as negative for C. fetus by real time-PCR targeting the nahE gene () were analyzed to evaluate the specificity of the HRM assay in clinical samples.
The analytical sensitivity was assessed by using 10-fold serial dilutions of DNA from Cfv strain NCTC 10354, as previously described (). Dilutions ranging from 1 × 101 to 1 × 106 genome copies were tested in triplicate, in three independent runs, to ensure reproducibility. The standard curve was analyzed for evaluation of linearity (r2), amplification efficiency (E) and reproducibility as previously described ().
Additionally, preputial samples from three bulls were spiked with Cfv strain NCTC 10354 to simulate positive samples. Briefly, bacterial cultures were suspended in PBS and adjusted to 0.3 McFarland (≈1 × 108 CFU/mL), and suspensions diluted and added to preputial samples to attain final mixture concentrations ranging from 1 × 105 to 1 × 101 CFU/mL in 2 mL of preputial sample. DNA extraction was performed using 2 mL of sample, centrifuged at 5,000 × g for 10 min and the pellet was resuspended in 180 μL of buffer ATL (DNeasy Blood and Tissue kit, Qiagen, Hilden, Germany) for DNA isolation as described above for C. fetus isolates. The final step of elution was performed using 100 μL of buffer AE (DNeasy Blood and Tissue kit, Qiagen, Hilden, Germany).
Reproducibility
The intra- and inter-assay reproducibility were evaluated for all C. fetus strains, using the coefficient of variation (CV) of the melting temperature (Tm) value in three replicates tested on the same plate and in three independent runs, respectively.
Statistical analysis
Differences in the mean Tm between Cfv and Cff amplicons were evaluated with Student’s t-test using IBM SPSS Statistics 27.0 (IBM Corporation, Armonk, United States). Results of melting temperature are reported as mean of three independent runs ± standard deviation (SD). Values of P < 0.05 were considered statistically significant.
Results
Classification of Campylobacter fetus strains
The 51 C. fetus strains were evaluated by two real-time PCR assays directed to loci CFF8240_0641 and CFF8240_1016, followed by HRM analysis. Both real time PCR-HRM assays were able to segregate C. fetus strains in two distinct populations based on the Tm of the amplification products (Figure 2). The amplification of a single amplicon was confirmed by the presence of a single peak in each melt curve plot and by agarose gel electrophoresis. In addition, the differences in the Tm were confirmed to be associated with the expected SNPs by Sanger sequencing of five amplicons representative of both curve profiles. Both HRM assays identified Cfv and Cff isolates in agreement with the initial classification of the strains. All Cfv strains were sensitive to glycine, whereas Cff strains grew in glycine plates, with the exception of strain 98/v445.
FIGURE 2
The melting temperatures obtained for each isolate in the three independent runs are shown in Supplementary Table 3. The assay targeting CFF8240_0641 differentiated Cfv from Cff through a mean amplicon Tm of 73.34 and 73.74°C (P < 0.001), respectively (Table 2). The assay targeting CFF8240_1016 differentiated Cfv from Cff through a mean Tm of 73.11°C and 73.59°C (P < 0.001), respectively (Table 2). These assays showed low intra-assay coefficients of variation for all strains tested, which were less than or equal to 0.085 and 0.095% using primers for loci CFF8240_0641 and CFF8240_1016, respectively (Table 2), evidencing a good reproducibility between replicates. For both assays, strains were tested in different runs and the Tm results showed only minor differences across assays, as evidenced by the inter-assay CV less than or equal to 0.337 and 0.176% for CFF8240_0641 and CFF8240_1016, respectively (Table 2).
TABLE 2
| Target | Mean Tm ± SD (°C) | Coefficient of variation (%) | ||
| Cfv | Cff | intra-assay | inter-assay | |
| CFF8240_0641 | 73.34 ± 0.083a | 73.74 ± 0.101b | ≤ 0.085 | ≤ 0.337 |
| CFF8240_1016 | 73.11 ± 0.106a | 73.59 ± 0.056b | ≤ 0.095 | ≤ 0.176 |
Melting temperature in high-resolution melting assays to differentiate Campylobacter fetus subspecies.
Results of the melting temperature are presented as mean melting temperature (Tm) ± standard deviation (SD). Different letters in the mean Tm ± SD indicate statistically significant differences (P < 0.001). Cfv, C. fetus subsp. venerealis; Cff, C. fetus subsp. fetus.
Three C. fetus strains (98/v444, BT 34/99, and 110800-21-2) with non-consensus subspecies classification in previous reports were also evaluated in this study. According to the glycine tolerance test and HRM assays, strains 98/v444 and BT 34/99 were here classified as Cfv, while strain 110800-21-2 was classified as Cff (Supplementary Table 3).
Specificity and analytical sensitivity of the high-resolution melting analysis assays
The specificity of the assays was assessed by testing DNA from other Campylobacter species (Supplementary Table 2) and preputial washing samples previously classified as negative for C. fetus. No amplification and consequently no melting curves were obtained when using DNA of C. portucalensis, C. sputorum, C. lari, C. lanienae, C. coli, C. jejuni, and C. hyointestinalis. Both assays also produced negative results in the 50 preputial washing samples tested, which is consistent with the absence of amplification of the nahE gene, indicating the absence of non-specific amplification. Overall, both assays revealed 100% sensitivity and 100% specificity.
The analytical sensitivity of the assays was evaluated by ten-fold serial dilutions of genomic DNA of Cfv NCTC 10354. Results revealed that both real time PCR-HRM assays were able to detect 102 genome copies with a cycle threshold (Ct) lower than 35 (Ct = 34.71 ± 0.12 for CFF8240_0641 and Ct = 34.60 ± 0.03 for CFF8240_1016) (Table 3). These results were reproducible in three independent runs, showing the same amplicon melting temperature. The standard curve revealed an amplification efficiency of 91.45 and 93.16% for CFF8240_0641 and CFF8240_1016 assays, respectively, with an r2 of 0.99 and coefficients of variation ≤ 1.7% (Table 4).
TABLE 3
| Genome copies/reaction | CFF8240_0641 | CFF8240_1016 |
| 1000000 | 20.68 ± 0.05 | 20.79 ± 0.11 |
| 100000 | 23.95 ± 0.10 | 24.15 ± 0.05 |
| 10000 | 28.09 ± 0.25 | 27.92 ± 0.07 |
| 1000 | 31.34 ± 0.06 | 31.35 ± 0.06 |
| 100 | 34.71 ± 0.12 | 34.60 ± 0.03 |
Amplification results for Campylobacter fetus subsp. venerealis NCTC 10354 genome copies.
Values are presented as the mean Ct of three runs ± standard deviation for assays targeting loci CFF8240_0641 and CFF8240_1016.
TABLE 4
| Target | Slope | Y-intercept | r2 | E (%) | Intra-assay CV (%) | Inter-assay CV (%) |
| CFF8240_0641 | −3.5454 | 41.937 | 0.99 | 91.45 | ≤1.70 | ≤1.08 |
| CFF8240_1016 | −3.4975 | 41.722 | 0.99 | 93.16 | ≤1.48 | ≤0.6 |
Performance parameters of the real-time PCR assays.
To evaluate the suitability of the assays for diagnosis in clinical samples, the limit of detection (LOD) was also assessed in preputial washing samples spiked with Cfv. The LOD of both assays was 103 CFU/mL in three independent runs using preputial washing samples from three bulls. Amplification of preputial samples with 103 CFU/mL occurred in thresholds cycles of 34.13 ± 0.23 and 33.86 ± 0.55 for assays targeting CFF8240_0641 and CFF8240_1016, respectively.
Discussion
The accurate identification of Cfv is crucial for the diagnosis of BGC since only subspecies venerealis is recognized as the etiologic agent of the disease (). Misidentification of subspecies fetus as venerealis originates considerable economic costs related to testing, culling, and control strategies such as artificial insemination. On the other hand, misidentification of a Cfv as Cff perpetuates the disease in the herd with the associated costs related to decreased reproductive efficiency. In the last years, several real-time PCR assays have been developed to detect subspecies venerealis-specific sequences, such as the insertion element ISCfe1, parA, and virB11 genes (; ; ; ). However, these sequences can be horizontally transferred and have been associated to specificity failures in real-time PCR assays (; ; ). Thus, accurate molecular diagnosis of BGC still requires the identification of molecular targets specific to Cfv.
A recent study based on whole-genome sequencing data identified SNPs differentiating ISCfe1 positive genomes, proposed as Cfv, from the remaining C. fetus strains (). Real-time PCR coupled with HRM can differentiate SNPs and has emerged as a fast, easy to perform and cost-effective method for identification and differentiation of several bacterial pathogens (; ; ).
In the present study, three of the SNPs proposed to differentiate the subspecies () were selected to develop real-time PCR assays coupled with HRM analysis to identify C. fetus subspecies. The most promising primer pairs target a Ppx/GppA family phosphatase (locus CFF8240_1016) and a Hit family protein (locus CFF8240_0641). Although these sequences differ by only one SNP, the melting behavior of the amplification products was significantly shifted, thus allowing subspecies differentiation. Both real-time PCR-HRM assays accurately identified the subspecies of 51 C. fetus strains, with unambiguously distinct melt curve profiles and melting temperature. Moreover, both assays revealed a good intra- and inter-assay reproducibility of the Tm values in all strains tested, evidenced by the low CV values. Although the Tm values showed slight differences between HRM runs, as observed in other studies (; ; ), these differences were balanced by the inclusion of Cfv and Cff controls in each run. The subspecies classification was assigned based on the melting behavior of the Cfv and Cff controls included in each plate, whose inclusion is mandatory in all runs. We also evaluated strains with discrepant subspecies classification results in previous studies. Strains 98/v444 and BT 34/99 were here classified as Cfv, as indicated by , although they were typed as Cff in other studies (; ). Strain 11800-21-2 was previously identified as Cfv () but was in good agreement with other studies (; , ,). The lack of standardized methods for subspecies classification and the absence of an explicit gold standard may be responsible for disagreeing classifications of C. fetus strains across studies. The developed HRM assays also have the potential to be implemented as an accurate method for the direct detection of Cfv in clinical samples. Both assays successfully detected Cfv in preputial samples spiked with 103 CFU/mL. The suitability of the assays was also validated by the absence of non-specific amplification in preputial samples negative for C. fetus. Nevertheless, additional studies with samples from naturally infected animals and different matrixes, namely samples from aborted fetuses, should be tested to fully validate these assays for use in clinical samples. Additionally, the interlaboratory testing of these assays hereafter will be valuable to consider these assays as global diagnostic tools for the diagnosis of Bovine Genital Campylobacteriosis worldwide. Moreover, as we identified a polymorphism in the primer-binding site adjacent to the SNP in locus CFF8240_1016 in one bovine isolate (strain Cff 04/554), we cannot exclude specificity or sensitivity failures when other isolate collections or clinical samples are evaluated. This polymorphism may impact the amplification and/or melting temperature of the amplicons. In contrast, the assay targeting CFF8240_0641 proved to be effective without potential specificity issues, making it a preferential assay to be used for diagnosis.
This study also highlighted specificity failures of the glycine tolerance test, even when using standardized conditions such as inoculum size (106 UFC/mL) and culture conditions. Although all Cfv were correctly identified by this phenotypic test, this would misidentify one Cff isolate. Previous studies already reported the occurrence of Cfv strains with tolerance to glycine (, ), which is acquired through mutation or transduction (), as well as Cff sensitivity to glycine (). Thus, this research also evidences the inconsistencies between the phenotypic analysis and the different molecular methods in the identification of C. fetus subspecies.
In conclusion, this study describes two real-time PCR-HRM assays for the highly specific and sensitive identification and differentiation of Cfv and Cff. Although exhibiting a similar performance in the present collection of strains, the assay targeting CFF8240_0641 is potentially more accurate due to possible, although presumably rare, polymorphisms in Cff strains. Importantly, the assays have the potential to be used for direct analysis of preputial samples and thus could prove to be a valuable tool for the diagnosis and control of BGC.
Statements
Data availability statement
The original contributions presented in this study are included in the article/Supplementary material, further inquiries can be directed to the corresponding author.
Ethics statement
Ethical review and approval was not required for the animal study because bovine preputial samples were collected by certified veterinarians using the OIE recommended sampling method as part of the breeding soundness examination of bulls and as a clinical service requested by owners to the Faculty of Veterinary Medicine of the University of Lisbon. As samples were collected for diagnostic purposes, according to EU and national legislation (Directive 2010/63/EU and Decree-law no. 113/2013), no ethical approval from an Institutional Animal Care and Use Committee or other relevant ethics board was required. According to the publicly available regulation of the Veterinary Teaching Hospital of the Faculty of Veterinary Medicine of the University of Lisbon, all clinical and diagnostic procedures and records may be used for teaching and research purposes while maintaining confidentiality. Written informed consent was obtained from the owners for the participation of their animals in this study.
Author contributions
LL-D-C and ES: conceptualization, supervision, project administration, and funding acquisition. MS, LL-D-C, and ES: methodology and validation. MS, GP, LL-D-C, and ES: formal analysis. MS: investigation and writing—original draft preparation. SK, GP, LL-D-C, and ES: resources. SK, GP, LM, LL-D-C, and ES: writing—review and editing. MS, LM, LL-D-C, and ES: visualization. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by Fundação para a Ciência e a Tecnologia (FCT) and Fundo Europeu de Desenvolvimento Regional (FEDER), under the project PTDC/CVT-CVT/30145/2017. This study was also supported by Centro de Investigação Interdisciplinar em Sanidade Animal - CIISA (Project UIDB/00276/2020, funded by FCT) and by the Associate Laboratory for Animal and Veterinary Science (LA/P/0059/2020 - AL4AnimalS). ES was funded by FCT (DL 57/2016/CP1438/CT0001). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Acknowledgments
We acknowledge Elena Velo-Rego and the Animal and Plant Health Agency (APHA) for providing C. fetus subsp. Venerealis isolates from United Kingdom. We also acknowledge J. Wagenaar, M. van Bergen, A. Burnens, S. Hum, M. Blaser, and G. Gorkiewicz for providing C. fetus strains.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2022.969825/full#supplementary-material
Supplementary Table 1Campylobacter fetus strains analyzed by real-time PCR followed by HRM analysis.
Supplementary Table 2Campylobacter spp. strains used for specificity evaluation of real-time PCR-HRM assays.
Supplementary Table 3Results of HRM analysis using primers targeting CFF8240_0641 and CFF8240_1016.
References
1
Abdel-glilM. Y.HotzelH.TomasoH.LindeJ. (2020). Phylogenomic analysis of Campylobacter fetus reveals a clonal structure of insertion element ISCfe1 positive genomes.Front. Microbiol.11:585374. 10.3389/fmicb.2020.585374
2
AbrilC.VileiE. M.BrodardI.BurnensA.FreyJ.MiserezR. (2007). Discovery of insertion element IS Cfe1: A new tool for Campylobacter fetus subspecies differentiation.Clin. Microbiol. Infect.13993–1000. 10.1111/j.1469-0691.2007.01787.x
3
AshrafiR.BruneauxM.SundbergL. R.PulkkinenK.KetolaT. (2017). Application of high resolution melting assay (HRM) to study temperature-dependent intraspecific competition in a pathogenic bacterium.Sci. Rep.71–8. 10.1038/s41598-017-01074-y
4
ChangW.OggJ. E. (1971). Transduction and mutation to glycine tolerance in vibrio fetus.Am. J. Vet. Res.32649–653.
5
ChuaK. H.LimS. C.NgC. C.LimY. A. L.LauT. P.ChaiH. C. (2015). Development of high resolution melting analysis for the diagnosis of human malaria.Sci. Rep.5:15671. 10.1038/srep15671
6
FehlbergH. F.MacielB. M.AlbuquerqueG. R. (2017). Identification and discrimination of Toxoplasma gondii, Sarcocystis spp., Neospora spp., and Cryptosporidium spp. by righ-resolution melting analysis.PLoS One12:e0174168. 10.1371/journal.pone.0174168
7
GhorbaniJ.HashemiF. B.JabalameliF.EmaneiniM. (2022). Multiplex detection of five common respiratory pathogens from bronchoalveolar lavages using high resolution melting curve analysis.BMC Microbiol.22:141. 10.1186/s12866-022-02558-2
8
GorkiewiczG.KienesbergerS.SchoberC.ScheicherS. R.GüllyC.ZechnerR.et al (2010). A genomic island defines subspecies-specific virulence features of the host-adapted pathogen Campylobacter fetus subsp. venerealis.J. Bacteriol.192502–517. 10.1128/JB.00803-09
9
IraolaG.PérezR.BetancorL.MarandinoA.MorsellaC.MéndezA.et al (2016). A novel real-time PCR assay for quantitative detection of Campylobacter fetus based on ribosomal sequences.BMC Vet. Res.12:286. 10.1186/s12917-016-0913-3
10
KoressaarT.RemmM. (2007). Enhancements and modifications of primer design program Primer3.Bioinformatics231289–1291. 10.1093/bioinformatics/btm091
11
KõressaarT.LepametsM.KaplinskiL.RaimeK.AndresonR.RemmM. (2018). Primer3-masker: Integrating masking of template sequence with primer design software.Bioinformatics341937–1938. 10.1093/bioinformatics/bty036
12
Life Technologies Corporation (2010). A guide to high resolution melting (HRM) analysis.Carlsbad, CA: Life Tecnhologies Corporation.
13
McGoldrickA.ChanterJ.GaleS.ParrJ.ToszeghyM.LineK. (2013). Real Time PCR to detect and differentiate Campylobacter fetus subspecies fetus and Campylobacter fetus subspecies venerealis.J. Microbiol. Methods94199–204. 10.1016/j.mimet.2013.06.014
14
McMillenL.FordyceG.DooganV. J.LewA. E. (2006). Comparison of culture and a novel 5′ Taq nuclease assay for direct detection of Campylobacter fetus subsp. Venerealis in clinical specimens from cattle.J. Clin. Microbiol.44938–945. 10.1128/JCM.44.3.938-945.2006
15
MichiA. N.FavettoP. H.KastelicJ.CoboE. R. (2016). A review of sexually transmitted bovine trichomoniasis and campylobacteriosis affecting cattle reproductive health.Theriogenology85781–791. 10.1016/j.theriogenology.2015.10.037
16
MsheliaG. D.AminJ. D.WoldehiwetZ.MurrayR. D.EgwuG. O. (2010). Epidemiology of bovine venereal campylobacteriosis: Geographic distribution and recent advances in molecular diagnostic techniques.Reprod. Domest. Anim.45e221–e230. 10.1111/j.1439-0531.2009.01546.x
17
NazeF.DesvarsA.PicardeauM.BourhyP.MichaultA. (2015). Use of a new high resolution melting method for genotyping pathogenic Leptospira spp.PLoS One10:e0127430. 10.1371/journal.pone.0127430
18
OIE (2021). Manual of diagnostic tests and vaccines for terrestrial animals 2021.Paris: Office international des épizootie.
19
OnS. L.HolmesB. (1991a). Reproducibility of tolerance tests that are useful in the identification of campylobacteria. J. Clin. Microbiol.29, 1785–1788. 10.1128/JCM.29.9.17851788.1991
20
OnS.L.HolmesB. (1991b). Effect of inoculum size on the phenotypic characterization of Campylobacter species. J. Clin. Microbiol.29, 923–926. 10.1128/JCM.29.5.923-926.1991
21
PakbinB.BastiA. A.KhanjariA.BrückW. M.AzimiL.KarimiA. (2022). Development of high-resolution melting (HRM) assay to differentiate the species of Shigella isolates from stool and food samples.Sci. Rep.121–13. 10.1038/s41598-021-04484-1
22
PoloC.GarcÃa-SecoT.HernándezM.FernándezV.RodrÃguez-LázaroD.GoyacheJ.et al (2021). Evaluation of PCR assays for Campylobacter fetus detection and discrimination between C. Fetus subspecies in bovine preputial wash samples.Theriogenology172300–306. 10.1016/j.theriogenology.2021.06.020
23
SilvaM. F.DuarteA.PereiraG.MateusL.Lopes-da-CostaL.SilvaE. (2020a). Assessment of Campylobacter fetus subsp. Venerealis molecular diagnosis using clinical samples of bulls.BMC Vet. Res.16:410. 10.1186/s12917-020-02634-7
24
SilvaM. F.GonçaloP.CarneiroC.HemphillA.MateusL.Lopes-da-CostaL.et al (2020b). Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls.PLoS One15:e0227500. 10.1371/journal.pone.0227500
25
SilveiraC.daS.FragaM.GiannittiF.MacÃas-RiosecoM.Riet-CorreaF. (2018). Diagnosis of bovine genital campylobacteriosis in South America.Front. Vet. Sci.5:321. 10.3389/fvets.2018.00321
26
SpenceR. P.BruceI. R.McFaddenA. M. J.HillF. I.TisdallD.HumphreyS.et al (2011). Short communications: Cross-reaction of a Campylobacter fetus subspecies venerealis real-time PCR.Vet. Rec.168:131. 10.1136/vr.c5264
27
SprengerH.ZechnerE. L.GorkiewiczG. (2012). So close and yet so far — molecular microbiology of Campylobacter fetus subspecies.Eur. J. Microbiol. Immunol.266–75. 10.1556/eujmi.2.2012.1.10
28
UntergasserA.CutcutacheI.KoressaarT.YeJ.FairclothB. C.RemmM.et al (2012). Primer3-new capabilities and interfaces.Nucleic Acids Res.401–12. 10.1093/nar/gks596
29
Van BergenM. A. P.DingleK. E.MaidenM. C. J.NewellD. G.Van Der Graaf-Van BlooisL.Van PuttenJ. P. M.et al (2005). Clonal nature of Campylobacter fetus as defined by multilocus sequence typing.J. Clin. Microbiol.435888–5898. 10.1128/JCM.43.12.5888-5898.2005
30
van der Graaf-van BlooisL.DuimB.MillerW. G.ForbesK. J.WagenaarJ. A.ZomerA. (2016a). Whole genome sequence analysis indicates recent diversification of mammal-associated Campylobacter fetus and implicates a genetic factor associated with H2S production.BMC Genomics17:713. 10.1186/s12864-016-3058-7
31
van der Graaf-van BlooisL.MillerW. G.YeeE.GorkiewiczG.ForbesK. J.ZomerA. L.et al (2016b). Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids.PLoS One11:e0152832. 10.1371/journal.pone.0152832
32
van der Graaf-Van BlooisL.MillerW. G.YeeE.RijnsburgerM.WagenaarJ. A.DuimB. (2014). Inconsistency of phenotypic and genomic characteristics of Campylobacter fetus subspecies requires reevaluation of current diagnostics.J. Clin. Microbiol.524183–4188. 10.1128/JCM.01837-14
33
van der Graaf-van BlooisL.van BergenM. A. P.van der WalF. J.de BoerA. G.DuimB.SchmidtT.et al (2013). Evaluation of molecular assays for identification Campylobacter fetus species and subspecies and development of a C. Fetus specific real-time PCR assay.J. Microbiol. Methods9593–97. 10.1016/j.mimet.2013.06.005
34
WagenaarJ. A.Van BergenM. A. P.NewellD. G.Grogono-ThomasR.DuimB. (2001). Comparative study using amplified fragment length polymorphism fingerprinting, PCR genotyping, and phenotyping to differentiate Campylobacter fetus strains isolated from animals.J. Clin. Microbiol.392283–2286. 10.1128/JCM.39.6.2283-2286.2001
35
YeJ.CoulourisG.ZaretskayaI.CutcutacheI.RozenS.MaddenT. L. (2012). Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction.BMC Bioinformatics13:134. 10.1186/1471-2105-13-134
36
ZhangJ.Peng, LiuZ.Cheng, JiangJ.Xiuet al (2021). Rapid detection of Mycoplasma mycoides subsp. Capri and Mycoplasma capricolum subsp. Capripneumoniae using high-resolution melting curve analysis.Sci. Rep.111–8. 10.1038/s41598-021-93981-4
Summary
Keywords
Campylobacter fetus subsp. venerealis, Campylobacter fetus subsp. fetus, bovine genital campylobacteriosis, real-time PCR, high-resolution melting
Citation
Silva MF, Kienesberger S, Pereira G, Mateus L, Lopes-da-Costa L and Silva E (2022) Molecular diagnosis of bovine genital campylobacteriosis using high-resolution melting analysis. Front. Microbiol. 13:969825. doi: 10.3389/fmicb.2022.969825
Received
15 June 2022
Accepted
23 August 2022
Published
09 September 2022
Volume
13 - 2022
Edited by
Adrian Whatmore, Animal and Plant Health Agency, United Kingdom
Reviewed by
Herbert Tomaso, Friedrich-Loeffler-Institute, Germany; Birgitta Duim, Utrecht University, Netherlands; Mohamed K. Fakhr, University of Tulsa, United States
Updates
Copyright
© 2022 Silva, Kienesberger, Pereira, Mateus, Lopes-da-Costa and Silva.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Elisabete Silva, elisabetesilva@fmv.ulisboa.pt
This article was submitted to Infectious Agents and Disease, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.