Experimental protocols were carried out under a project license according to the European Communities Council Directive of 24/11/1986 (86/609/EEC) regarding the care and use of animals for experimental procedures and under the guidance of the Ethics Committee for Animal Experimentation of the University of Navarra. Twenty, 4–5-year-old, male, 3–5 kg, M. fascicularis were included in the study. Animals were housed in a facility under standard conditions of air exchange (16 l/min), humidity (50%), and light/night cycles, and were fed fresh fruit and commercial pellets, with free access to water.

CAV-GFP (Kremer et al., 2000), HD-GFP (Soudais et al., 2004), and HD-LRRK2^G2019S (Mestre-Francés et al., 2018) have been previously described. CAV-GFP is a replication-defective E1-deleted vector harboring a cytomegalovirus early promoter (CMV), GFP, SV40 polyA cassette. HD-GFP is a HD CAV-2 vector expressing GFP. HD-LRRK2^G2019S contains a Rous sarcoma virus (RSV) promoter, a codon-optimized LRRK2^G2019S cDNA, followed by an internal ribosomal entry site (IRES), GFP, and an SV40 polyA. This cassette was initially cloned into pGut3 and then inserted into a pEJK25 via homologous recombination to create pHD-LRRK2^G2019S. HD-LRRK2^G2019S was amplified and purified similar to that used for HD-GFP with minor modifications (Cubizolle et al., 2013). The HD-GFP stock used during this study was 1.3 × 10¹² pp/ml with an infectious particle to a physical particle ratio of 1:10. The HD-LRRK2^G2019S stocks used during this study were 3–7 × 10¹¹ pp/ml with an infectious particle to a physical particle ratio of ~1:25.

Four monkeys received CAV-GFP injections and were killed 1 month postinjection to assess safety and biodistribution of the CAV-2 in the brain: two of these four monkeys received an injection in the left putamen, and the other two monkeys received bilateral injections in the SN. In one of the latter monkeys, the injections missed the target and therefore was not included in the analyses. Eight monkeys received injections of HD-LRRK2^G2019S: four of the eight monkeys received an injection into the left putamen and were killed as planned 6 months postinjection; and the remaining four monkeys received injections in the SN. One monkey in the latter cohort died due to intracranial hemorrhage at 15 days postinjection. Also, four monkeys received injections of HD-GFP into the left SN. One monkey died due to heart failure. The six remaining monkeys were killed 12 months postinjection. As the neuropathological changes observed 6 months postinjection in the monkeys injected in the putamen with the HD-LRRK2^G2019S were sparse, a different timepoint of 12 months postinjection was used for those monkeys that received a nigral injection, to try to induce more robust neuropathological changes. A cohort of four non-injected (intact) animals were used as a control for histological analyses.

Stereotaxic surgery was performed according to the coordinates for stereotaxic injections based upon MRI guidance and ventriculography. Before surgery, a brain MRI was performed in each animal under light sedation with an intramuscular injection of ketamine (10 mg/kg) and midazolam (0.5 mg/kg) and. Initial coordinates for injection sites were ascertained using the Osirix Medical Image Software (version 3.9.1). On the day of surgery, the monkeys were anesthetized by intramuscular injections of ketamine and midazolam at the same doses above mentioned. Supplementary doses were given during surgery if necessary. The animals were placed in the stereotaxic frame and the vector delivery was performed following the convection-enhanced delivery (CED) method using an infusion pump (KDS200, LabNet Biotecnica, Madrid, Spain) at a rate of 1 μl/min the first 10 μl, 1.5 μl/min until 20 μl and 2 μl/min until 30 μl. CAV-GFP and HD-LRRK2^G201S were injected in 60 μl [1 × 10¹⁰ physical particles (pp)] of the corresponding vector divided in two 30 μl injections in left putamen (target 1: X = 10, Y = +1, Z = +1 and target 2: X = 12, Y = 4, Z = +3). A volume of 10 μl with 1 × 10¹⁰ pp of the corresponding vector was injected in each SN in CAV-GFP and left SN in HD-LRRK2^G2019S and HD-GFP groups (target: X = 4, Y = −8, Z = −4). These volumes were used based on the relative size of the structure being targeted and the advice and collective results from the Bankiewicz lab (UCSF). Coordinates were derived from Martin and Bowden (1996).

Positron emission tomography (PET) with ¹¹C-(+)-α-dihydro-tetrabenazine (DTBZ; used to quantify the nigrostriatal terminal density) and with ¹⁸F-deoxyglucose (FDG; to evaluate the glucose metabolism) were performed as previously described (Blesa et al., 2010).

After an overdose of a mixture of ketamine and midazolam, animals were transcardially perfused with 0.01 M PBS/4% paraformaldehyde (PFA, Sigma–Aldrich, St. Louis, MO, USA). Brains were immediately removed, blocked using a monkey brain matrix (ASI Instruments, Warren, MI, USA) and post-fixed for 2 days in 4% PFA/PBS. The brains were then cryoprotected in a 30% sucrose (Sigma–Aldrich, St. Louis, MO, USA) solution in 0.01 M PBS until processing. Brains were sliced into 40-μm-thick coronal sections along the rostral axis with a freezing microtome (SM 2000R, Leica, Germany) and collected in 0.125 M PBS containing 2% dimethylsulphoxide (Sigma–Aldrich, St. Louis, MO, USA), 20% glycerine (Panreac, Barcelona, Spain) and 0.05% sodium azide (Sigma–Aldrich, St. Louis, MO, USA) and were stored at −20°C until ulterior analysis.

Total DNA was extracted from fifteen 40-μm-thick PFA-fixed sections from the putamen, motor cortex and the SN of each animal with the QIAamp DNA FFPE Kit (Qiagen, Gaithersburg, MD, USA) and according to manufacturer’s protocol (without the deparaffinization step). Right and left hemispheres were analyzed separately. DNA integrity was confirmed by electrophoresis, and its concentration and purity assessed spectrophotometrically. CAV-2 vector genomes were then quantified by PCR (qPCR) using the inverted terminal repeats (ITR) sequences. To detect the amplification products, qPCR was performed on these DNAs with Power SYBR^® Green (Applied Biosystems, Foster City, CA, USA) and specific primers using an ABI Prism 7300 sequence detector (Applied Biosystems, Foster City, CA, USA). The primer sequences used for qPCR were forward: AGGACAAAGAGGTGTGGCTTA; reverse: GAACTCGCCCTGTCGTAAAA. The samples were run in triplicate. Data were normalized against the GAPDH sequence amplified using the primers GAPDH forward: CCACCCAGAAGACTGTGGAT; GADPH reverse: TTCAGCTCAGGGATGACCTT. Reference curves were established by determining cycle threshold (Ct) values for the amplification of serial dilutions of the CAV-2 genome.

Immunohistochemistry (IHC) and immunofluorescence (IF) staining were performed on free-floating sections (see Table 1 for primary antibodies and Table 2 for secondary antibodies). Tissue sections were washed in bi-distilled water and 0.01 M PBS to remove the cryoprotectant solution and incubated in PBS with 0.02% hydrogen peroxide (H₂O₂; Merck Millipore, Darmstadt, Germany) for endogenous peroxidase inhibition. After that, they were blocked in 5% normal serum (goat or donkey in the function of the secondary antibody used) with 0.2% Triton X-100 (Sigma–Aldrich, St. Louis, MO, USA) for 60 min and then incubated overnight in the same solution containing a primary antibody. After being rinsed in 0.01 M PBS, tissue sections were incubated in 0.01 M PBS with 5% normal serum and containing the corresponding secondary antibody. The type of antibody, the time of incubation and subsequent steps were dependent on IHC or IF technique performed. In the IHC, the sections were incubated at room temperature with the corresponding biotin secondary antibody for 30 min and after, the sections were rinsed with the vector avidin-biotin complex (1:200 Vectastain ABC kit, Vector Laboratories, Burlingame, CA, USA) for 30 min. Staining for peroxidase was performed with the DAB substrate kit (Vector Laboratories, Burlingame, CA, USA). Finally, the sections were rinsed in double-distilled water and 0.01 M PBS, mounted on gelatin-coated slides and air-dried. The next day, almost all the sections were Nissl counterstained and coverslipped using DPX (VWR, Radnor, PE, USA). In the IF, the corresponding secondary antibody was incubated for 2 h in 0.01 M PBS containing normal donkey/goat serum (1:20). Finally, some sections were counterstained with a nucleic acid stain (TO-PRO-3 iodide, Molecular Probes, Waltham, MA, USA) and coverslipped with mounting medium (Immu-mount, Thermo-Shandon).

The total number of TH⁺ and VMAT2⁺ neurons in the SN were quantified according to the optical fractionator principle (Olympus CAST system, Denmark). Cells in every 14th section were quantified. To determine the area transduced following CAV-GFP injection in the putamen, 40-μm-thick coronal sections were generated and anti-GFP IHC and Nissl counterstaining was performed. Every 12th section, from +7 to −8 (according to the Martin and Bowden atlas) was used. The striatal volume (caudate + putamen) and the volume of GFP-immunoreactivity were quantified according to the Cavalieri principle using CAST software. The transduced area in SN in the animals of the CAV-GFP group was determined using stereology in consecutive serial coronal sections of SN stained using anti-TH and anti-GFP IHC.

Samples were viewed and digitalized with an Olympus BX-51 microscope equipped with an Olympus DP-70 camera using the CAST grid software package (Olympus, Denmark). The images were analyzed using ImageJ software, converted to an 8-bit (binary) format and the background (20 pixels) subtracted. Consequently, the perimeter of each layer was outlined manually for each image excluding any unwanted immune stained structures (i.e., capillary). Then, the same threshold limits were defined for each image and the percentage of immune-reactive area was determined. The images were obtained from different brain regions and different magnification according to the protein in the study. IHC was performed using the same incubation times. The same investigator performed all quantifications with masked sections.

The histological findings (volume, stereology, and densitometry) were analyzed by parametric tests by comparing intact and animals injected with HD-LRRK2^G2019S in the putamen, whereas the comparisons between SN-injected HD-GFP/LRRK2^G2019S animals were performed with non-parametric analysis. Finally, comparisons between different groups were performed using the Kruskal–Wallis test followed by the Mann–Whitney test (2–2). The results are expressed as a mean ± standard error of the mean (SEM).

Targeting the putamen in the monkey brain is straightforward and allows one to rapidly determine the efficacy of vector transduction and retrograde transport, due to its multiple and well-characterized connections. We, therefore, injected CAV-GFP, a replication-defective CAV-2 vector harboring a GFP expression cassette, in the M. fascicularis left putamen. GFP was observed within cell bodies and projections with neuron-like morphology (Figures 1A–G). The GFP signal in the putamen and caudate (Figure 1A) corresponds to a volume of 540 mm³ (~47% of total striatum (1,140 mm³), with an approximative ratio between injected volume and transduced volume of 1:9. We also detected GFP expression in the soma of cells located in the injected and contralateral motor cortex, claustrum, parafascicularis, centromedian thalamus nuclei, and in the SN, where the majority were NeuN⁺ (Figure 1D). We also quantified the efficacy of retrograde transport from the putamen to the SN. In this pilot assay, ~5% of the ~1,20,000 TH⁺ cells neurons in the ipsilateral SN were GFP⁺. Of note, we also found a handful of GFP⁺/TH⁺ cells in the contralateral SN (Figures 1E–G). Together, these data demonstrate CAV-2 vector infection at the site of injection, the retrograde transport from the putamen to efferent regions, and that the monkey SN sends DA projection to the striatum in each hemisphere.

We then explored the injection of HD-LRRK2^G2019S (Mestre-Francés et al., 2018) in the Macaca fascicularis brain. Because dopaminergic neurons in the SN are lost in Parkinson’s disease patients, our null hypothesis was that one may need to target these neurons to induce disease-like features. Notably, striatal injection of CAV-2 vectors leads to a transduction efficacy of ~70% of the dopaminergic neurons in the SN of the gray mouse lemur (Mestre-Francés et al., 2018). While the injection of CAV-GFP in the monkey putamen suggested that technical improvements would be needed to reach this level, a non-cell autonomous effect of LRRK2^G2019S activity might impact the putamen and/or SN (di Domenico et al., 2019). We, therefore, injected four monkeys in the left putamen with HD-LRRK2^G2019S. Of note, in the gray mouse lemur, we found no adverse physiological, histological, or biological effects from a control vector (HD-GFP) injections. Nonetheless, because a cohort of monkeys injected with HD-GFP was not performed at this stage, the below results are only suggestive.

To determine if LRRK2^G2019S activity could influence nigrostriatal termini density or DA uptake in the striatum, we measured ¹¹C-DTBZ and ¹⁸F-FDG levels by PET. Compared to pre-injection levels, we found a decrease in DTBZ uptake throughout the injected striatum at 15 days postinjection, which remained stable during the 6-months follow-up (Figure 2A). When the anterior and posterior striatum were analyzed separately, we found that DTBZ uptake was reduced during the first month in the anterior putamen (Figure 2B), and a progressive reduction in the posterior putamen (Figure 2C). DTBZ uptake in the caudate was relatively stable (Figure 2D). FDG-PET scans at 0.5, 3, and 6 months postinjection showed bilateral hypermetabolism in the ventral striatum, thalamus and midbrain at 6 months (Figures 2E–G). Quantification suggested that the ipsilateral pre-frontal gyro, bilateral superior frontal gyro, and bilateral thalamus displayed hypermetabolism 3 months postinjection. We also noted a trend towards a mild, bilateral, parieto-occipital hypometabolism (Figure 2G).

After the in vivo follow-up, the monkeys were killed, the brains fixed, and prepared for downstream assays. Initially, we found no difference in the number of TH⁺ cells between the injected vs. the contralateral hemisphere (1,04,000 ± 24,000 vs. 1,14,000 ± 22,000, respectively), or in the number of VMAT⁺ cells (1,14,000 ± 22,400 vs. 1,19,000 ± 14,000, respectively). In contrast to the contralateral hemisphere, some SN cells in the injected hemisphere presented with dystrophic neurites, and broken and swollen axons (Figures 3A,B). Also, the somas of some nigral neurons were fusiform and more mitochondrially-encoded cytochrome C oxidase II (MTCO2) immunoreactive (Figures 3C,D). The presence of pTau^{Ser395/Ser404} in cortex regions is a common feature in LRRK2 model systems (MacLeod et al., 2006; Li et al., 2009; Melrose et al., 2010) and 79% of LRRK2 mutation carriers have been reported to have tau pathology (Poulopoulos et al., 2012). We, therefore, assayed for pTau^{Ser395/Ser404} accumulation. We found increased IR in the white matter of the prefrontal, motor cortex and internal capsule of the injected vs. that from contralateral hemisphere and intact animals (Figures 4A,B). Finally, we used brain sections from the SN, putamen and motor cortex to isolate total DNA. Using qPCR targeting a conserved part of each vector sequence, we detected genomes in both hemispheres, with levels consistently higher in the injected hemisphere (Table 3).

Together, these data suggest but do not unequivocally demonstrate, that expression of LRRK2^G2019S induces some of the histopathological hallmarks present in patients with genetic Parkinson’s disease. Although HD-CAV-2 vectors lead to long-term transgene expression in vivo, and that it is unlikely that capsid uptake still had an effect on neurons 6 months postinjection (Piersanti et al., 2015; Mestre-Francés et al., 2018; del Rio et al., 2019), further controls need to be performed to show that these phenotypes are not linked to the CAV-2 capsid.

If a cell-autonomous effect of LRRK2^G2019S is responsible for the loss of SN neurons in Parkinson’s disease, then gene transfer needs to be more efficient in these cells. Therefore, in the second set of pilot assays, we bilaterally injected CAV-GFP in the SN to test vector efficacy. GFP⁺ neurons were detected in the SN, motor cortex, putamen, caudate, lateral hypothalamus, and the pedunculopontine nucleus bilaterally (Figures 5A–G). Of note, ~72% of the TH⁺ cells in SNs were GFP⁺.

These data prompted us to compare HD-GFP (a HD CAV-2 vector expressing GFP) and HD-LRRK2^G2019S injections in the SN. The results from six monkeys (three received HD-LRRK2^G2019S and three received HD-GFP) injected in the left SN are shown. During the 6-month follow-up, we found no notable differences in DTBZ or FDG uptake in HD-LRRK2^G2019S-injected vs. the HD-GFP-injected animals, or between the injected and non-injected hemisphere (not shown). The monkeys were killed, and the brains were prepared for histology and stereology. While the number of VMAT2⁺ cells was similar in all 12 SNs (i.e., three HD-GFP- and three HD-LRRK2^G2019S-injected hemispheres, and the six non-injected hemispheres) there was a modest reduction in the number of TH⁺ cells in the injected hemispheres (Table 4). We then compared pTau^{Ser395/Ser404} IR in HD-LRRK2^G2019S- vs. HD-GFP-injected animals. While, we found no differences in pTau^{Ser395/Ser404} IR in the internal capsule, there was a modest increase in the frontal and motor cortex of HD-LRRK2^G2019S-injected monkeys (Figure 6). Finally, we found vector genomes in both hemispheres and, as expected, higher levels in the injected hemispheres (Table 5).

Together, these data suggest that following unilateral HD-LRRK2^G2019S injection into the SN, LRRK2^G2019S increased pTau^{Ser395/Ser404} levels, but did not induce changes in nigrostriatal terminal density or glucose metabolism in the striatum, or the number of VMAT2⁺ cells in the SN.