ORIGINAL RESEARCH article

Front. Oncol., 12 January 2026

Sec. Gastrointestinal Cancers: Colorectal Cancer

Volume 15 - 2025 | https://doi.org/10.3389/fonc.2025.1739534

Integrative subtyping by bile acid metabolism identifies CLCA1/UGT2A3/ZG16 as markers of immune dysfunction and poor prognosis in colorectal cancer

  • LF

    Li Feng 1

  • MW

    Min Wang 1

  • XL

    Xin Li 1

  • LW

    Long Wu 1

  • DG

    DeXin Gu 1

  • BZ

    Bin Zhang 1

  • PZ

    Peng Zheng 1

  • QY

    Qifeng Yang 2

  • KW

    Ke Wang 3

  • GM

    Gang Mao 4*

  • 1. Department of General Surgery, Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu, China

  • 2. Department of Plastic and Aesthetic Surgery, Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu, China

  • 3. Department of Vascular Surgery, Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu, China

  • 4. Gastroenterology Department, Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu, China

Abstract

Background:

Colorectal cancer (CRC) is the primary driver of cancer-related death and illness across the world. Despite the full-scale shift of the treatment approach for some colorectal cancer patients due to the use of immune checkpoint inhibitors (ICIs), primary resistance still poses a huge challenge to clinicians. Bile acid metabolism is involved in the pathogenesis of CRC. However, its particular function in shaping the tumor immune microenvironment (TIME) and its effect on prognosis and immune treatment response remain unclear.

Methods:

Based on the transcriptome and clinical data from The Cancer Genome Atlas-Colon Adenocarcinoma (TCGA-COAD) cohort, we performed unsupervised consensus clustering and classified patients into different molecular subtypes according to bile acid metabolism. We subsequently compared overall survival (OS), immune cell infiltration levels, and differentially expressed genes among the subtypes. In addition, protein–protein interaction (PPI) network and Cox proportional hazards regression were used to identify key hub genes. Finally, the expression of these crucial hub genes was validated in the Gene Expression Omnibus (GEO) cohort and independent clinical patients.

Results:

The bile-low group showed a significant reduction in OS time (p = 0.0049). The infiltration levels of CD8+ T cells (p < 0.05) and M1 macrophages (p < 0.01) were significantly higher in the bile-low group than in the bile-high group. We identified three key genes—CLCA1, UGT2A3, and ZG16—and found that they all were downregulated in tumor tissues across the TCGA-COAD and GEO datasets, as well as in independent clinical samples. Survival analysis showed that high CLCA1 expression was significantly associated with favorable overall survival (p < 0.001), whereas UGT2A3 (p = 0.23) and ZG16 (p = 0.17) did not reach statistical significance. The three hub genes were negatively correlated with the (TIDE) score (CLCA1: R = − 0.24, p < 0.001; UGT2A3: R = − 0.15, p = 0.0022; ZG16: R = − 0.14, p = 0.0039).

Conclusion:

Our findings suggest that bile acid metabolism could shape the TIME via key genes CLCA1, UGT2A3, and ZG16, and subsequently modify CRC prognosis and immunotherapy responses. These genes may serve as potential prognostic indicators and mechanistic mediators linking bile acid metabolism to T-cell dysfunction, offering insights for future combination strategies targeting the metabolism–barrier–immunity axis.

1 Introduction

Colorectal cancer (CRC) is a common malignant tumor worldwide. Based on the 2023 global cancer statistics, there are more than two million new cases of colorectal cancer and nearly one million cancer-related deaths per year, imposing a substantial burden on the global healthcare system (13).

CRC exhibits genetic instability and marked heterogeneity. The advent of immune checkpoint inhibitors (ICIs) represents a significant advance in the treatment of patients with advanced CRC and high microsatellite instability (MSI-H) (4, 5). These drugs improve patient survival by mitigating the immunosuppressive state induced by tumors (68). Nevertheless, the issue of “primary resistance” persists in clinical practice, and only a small proportion of patients derive benefit from ICIs (9).

Bile acids are signal-conveying molecules within the gastrointestinal tract. Beyond their essential role in lipid metabolism, bile acids also substantially influence the development of CRC, particularly when bile acid metabolism is dysregulated (1012). Recent studies have reported that abnormal bile acid accumulation may foster tumor invasion and proliferation in CRC cells by regulating several mechanisms, including activation of nuclear receptors, induction of intestinal inflammation, and promotion of DNA damage (1315). Previous investigations have shown that, in CRC, deoxycholic acid (DCA) remodels the tumor immune microenvironment (TIME) through synergistic mechanisms: upregulating EGFR via the PI3K/AKT pathway to influence CD8+ T-cell activity; inhibiting tumor protein p53 through ERK1/2 activation, thereby reducing the antitumor immune effect; and upregulating β-linked proteins to promote the proinflammatory differentiation of regulatory T cells (16).

Currently, the TIME is recognized as the most critical factor in CRC prognosis and response to ICIs (1720). Bile acid metabolism may influence TIME by regulating immune cell infiltration and cytokine secretion (10, 11, 21), and it may also coordinate dynamic interactions among host metabolism, intestinal barrier integrity, and local immunity(metabolism–barrier–immunity axis) (22). Nevertheless, the precise mechanism linking bile acid metabolism to the tumor immune microenvironment in CRC remains unclear.

Furthermore, a systematic identification of key functional genes operating at the intersection of bile acid metabolism and tumor immune regulation is still lacking. Most prognostic models or biomarkers in CRC are not derived from dedicated analyses of this specific metabolic pathway. Therefore, it is essential to employ a pathway-centric bioinformatic strategy to unbiasedly screen for hub genes within the bile acid metabolism network, which may serve as novel prognostic indicators and reveal mechanisms of immunotherapy resistance.

This study aims to systematically explore the role of bile acid metabolism in shaping the CRC TIME and to identify key functional genes involved in this process using bioinformatic methods (Figure 1). We anticipate that the results will reveal factors linking metabolism to immune phenotypes and provide insights for developing refined combination immunotherapy strategies.

Figure 1

2 Materials and methods

2.1 Data source

We obtained Transcripts Per Million (TPM)-normalized RNA sequencing (RNA-seq) data for Colon Adenocarcinoma (COAD) via The Cancer Genome Atlas (TCGA) data portal (https://portal.gdc.cancer.gov/). A total of 524 samples were downloaded, comprising 455 tumor samples and 69 normal samples (23). Corresponding clinical data were retrieved from the UCSC Xena database (https://xenabrowser.net/), which initially included 530 samples. Duplicate samples were removed, and only those overlapping with the RNA-seq dataset were retained. Samples lacking clinical information were excluded, resulting in a final cohort of 480 patients, including 431 tumor samples and 49 normal samples. For validation, we obtained the GSE39582 dataset from the Gene Expression Omnibus (GEO) database (www.ncbi.nlm.nih.gov/geo/). After removing duplicates and samples with missing values, the dataset comprised 566 tumor cases and 19 normal cases. All data processing was performed using R software (v4.5.1), without applying batch correction. TCGA data were extracted and processed using the R package tidyverse (2.0.0); gene expression levels were in TPM format and were finally processed by taking the log2 + 1 value. The GSE39582 dataset was extracted and processed using the R package GEOquery (v2.76.0), and probe identifiers were converted using the corresponding GPL570–55999 platform annotation files obtained from the official GEO website.

2.2 Molecular subtyping based upon the bile acid metabolism pathway

We secured the gene set “HALLMARK BILE ACID METABOLISM” from the Molecular Signatures Database (MSigDB; https://www.gsea-msigdb.org/gsea/msigdb) (24), which is a curated compilation of genes specifically associated with bile acid metabolic mechanisms. Using this gene set, we calculated the bile acid metabolism gene-set score for each specimen. To identify molecular subtypes of COAD associated with bile acid metabolism, we performed unsupervised consensus clustering on filtered COAD samples via the ConsensusClusterPlus (k = 6, 1,000 resampling iterations) package (v 1.72.0) in R (25). Taking into account the above analyses and the statistical power required for subsequent survival analyses, immune infiltration comparison, and other statistical tests for each subgroup, we ultimately classified COAD patients into distinct molecular subtypes.

To assess the robustness of the molecular typing results, we used two independent Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway gene sets for validation: the bile secretion pathway and the primary bile acid biosynthesis pathway (data obtained using the R package KEGGREST v1.48.1). Pathway activity scores were calculated as the average expression levels of genes within each pathway, after which correlations with the original Hallmark pathway scores were evaluated. Survival analysis was then conducted based on stratification using these gene sets. All three enrichment scores were calculated using GSVA implemented in the R package GSVA (v2.2.0).

2.3 Survival analysis across subgroups and Cox analyses of bile acid metabolism score

Survival and immune infiltration analyses of molecular subtypes based on bile acid metabolism were performed. Overall survival (OS) was defined as the study endpoint, and Kaplan–Meier survival curves were generated for each molecular subtype.

The log-rank (Mantel–Cox) test was used to compare survival differences among subtypes, and a two-sided p < 0.05 was considered statistically significant. Moreover, the connection between the continuous bile acid metabolism score and patient survival was evaluated using multivariate Cox proportional hazards regression, with results reported as hazard ratios. All statistical analyses and visualizations were conducted in R using the packages ggplot2 (v3.5.2), survminer (v0.5.0), and survival (v3.8-3).

2.4 Analysis of immune infiltration landscape via CIBERSORT and xCell

We employed the Cell-type Identification By Estimating Relative Subsets Of RNA Transcripts (CIBERSORT) algorithm to estimate the relative percentages of 22 immune cell types (using the LM22 signature matrix; downloaded from https://cibersort.stanford.edu/). Only samples with a deconvolution p-value < 0.05 from the CIBERSORT output were retained (perm = 100). The main differences in immune cell proportions among subgroups were compared using a two-sided Wilcoxon test, with p < 0.05 indicating statistical significance. All computations were implemented in R using the packages e1071 (v1.7-16), preprocessCore (v1.70.0), ggplot2 (v3.5.2), pheatmap (v1.0.13), and parallel (base package). To verify the stability of the above results, we further applied the xCell algorithm to 431 samples using the xCell package (v1.1.0) and then extracted the immune cell-related data for downstream analysis.

2.5 Sorting of differentially expressed genes and functional enrichment analysis

We identified differential expression genes (DEGs) by comparing gene expression differences across subgroups using the limma package (v3.64.3) in R. The selection criteria were |log2(fold change)| > 1 and an adjusted FDR < 0.05. KEGG enrichment analysis and Gene Ontology (GO) pathway enrichment analysis of DEGs were performed using the clusterProfiler (v4.16.0) and enrichplot (v1.28.4) R packages (26, 27).

2.6 Spotting and selection of hub genes

To prioritize biologically relevant and prognostically significant genes, we employed a stringent two-step filtering strategy. First, 70 DEGs were submitted to the STRING online database (28) (https://string-db.org), and a PPI network was constructed using Cytoscape software (v3.9.1). The top 20 genes with the highest degree values were selected using the “Degree” algorithm within the PPI network. Moreover, Cox analysis (R package survival, v3.8-3) was performed on the 70 identified DEGs to screen for genes significantly associated with OS, using a two-sided Wald test with p < 0.05 as the significance threshold (without adjustment for multiple testing). The final hub genes for validation were defined as the intersection of two gene sets.

2.7 Survival analysis along with immune environment analysis

Based on the screened key genes, all patients were stratified into high- and low-expression groups. Survival analysis was performed between the two subgroups. The extent of immune cell infiltration in each subgroup was analyzed using a two-sided Wilcoxon test (p < 0.05 was considered statistically significant). In addition, the bile-acid metabolism score (single-sample Gene Set Enrichment Analysis (ssGSEA); same method as described in Section 2.1) was compared between the two groups. Spearman correlation analysis (implemented using the stats package in R) was employed to examine correlations between gene expression levels and key T-cell chemotactic factors (C-X-C motif chemokine ligand 9 (CXCL9), C-X-C motif chemokine ligand 9 (CXCL10)). The R packages used for survival analysis and the Wilcoxon test were the same as those described previously.

2.8 Prediction regarding immunotherapy response

All samples’ standardized expression matrices (gene expression z-scores) were uploaded to the online Tumor Immune Dysfunction and Exclusion (TIDE) platform (link: http://tide.dfci.harvard.edu/), and relevant metrics, including the TIDE score, dysfunction score, and exclusion score, were obtained for each sample. According to the developer’s recommendations, a TIDE score > 0 indicated a predicted nonresponder, whereas a score ≤ 0 indicated a predicted responder. Differences in TIDE scores between expression-defined groups were assessed using the Wilcoxon rank-sum test, and correlations between TIDE scores and gene expression levels were evaluated using Spearman correlation analysis (29). In addition, the associations between the expression levels of CLCA1, UGT2A3, and ZG16 and bile acid metabolism pathway activity (ssGSEA score) were examined using a two-sided Wilcoxon rank-sum test and a two-sided Spearman correlation analysis.

2.9 Validation of crucial gene expression patterns

2.9.1 Validation of hub gene expression patterns in TCGA-COAD and GEO cohorts

To validate the differential expression of the identified hub genes, we evaluated the expression of three hub genes between tumor and normal samples in TCGA-COAD and GSE39582 datasets. A two-sided Wilcoxon rank-sum test was applied, and p < 0.05 was considered statistically significant.

2.9.2 Testing the expression of the hub gene in clinical specimens via quantitative real-time PCR

2.9.2.1 Clinical specimens

Twenty clinical samples (tumor tissues and their paired adjacent normal tissues) were collected from colon adenocarcinoma patients who underwent curative surgical resection at the Hospital of Chengdu University of Traditional Chinese Medicine. Adjacent normal tissues were obtained from tissue parts ≥ 5 cm away from the tumor margin. All specimens were stored at − 80°C for subsequent experimental analyses.

Applied Biosystems’ real-time PCR system (Foster City, CA, USA) was used to carry out qRT-PCR on all specimens. A melt-curve analysis followed the amplification profile to verify the specificity of the amplification. The 2^(−ΔΔCt) method was used to calculate the relative expression level of target genes (endogenous: glyceraldehyde-3-phosphate dehydrogenase (GAPDH)). The statistical significance of expression between tumor and normal samples was evaluated via the Wilcoxon test.

2.9.2.2 Related reagents as well as consumables

The related reagents and consumables used in this study included RNA extraction solution (Cat. No. 15596-026CN, Invitrogen (Thermo Fisher Scientific, Waltham, MA, USA)); HyperScript™ III RT SuperMix for qPCR, which includes a gDNA wiper (Cat. No. K1585, APExBIO (Houston, TX, USA)); and HotStart™ 2X Green qPCR Master Mix (Cat. No. K1070, APExBIO). The primer sequences are listed as follows:

CLCA1: TGGTTGCTGAGTCTACTCCTC (Forward Primer); TCGTCAAATACTCCCCATCGT (Reverse Primer); UGT2A3: GCCTTCGTTAATTGACTACAGGA (Forward Primer); GTTGATAAGCCTGGCAAGACAT (Reverse Primer); ZG16: GGGTCCGAGTCAACACATACT (Forward Primer); CACCCACATAGTCGCTCCAC (Reverse Primer); GAPDH: ACAACTTTGGTATCGTGGAAGG (Forward Primer); GCCATCACGCCACAGTTTC (Reverse Primer).

The primer efficiency values ranged from 90% to 110%, with correlation coefficients (R2) ≥ 0.99, indicating high amplification specificity and reliability.

2.10 Statistical analysis

Continuous variables were analyzed according to the number of groups. For comparisons between two groups, the Wilcoxon rank-sum test was used; for comparisons involving more than two groups, the Kruskal–Wallis test was applied. Categorical variables were compared using the Chi-square test (χ2 test). Correlations between variables were assessed using Spearman’s rank correlation analysis. All statistical tests run were two-sided, and a p-value < 0.05 was considered statistically significant.

3 Results

3.1 Molecular subtyping based on bile acid metabolism highlights prognostic heterogeneity

To establish a molecular subtyping system based on bile acid metabolism, we applied unsupervised consensus clustering to evaluate clustering schemes with k ranging from 2 to 6. As k increased, the diagonal of the consensus matrix became progressively clearer (Figure 2a). The CDF curve exhibited a distinct separation and clear upward trend at k = 2 (Figure 2b), while both cluster-consensus and item-consensus analyses indicated that k = 2 and k = 4 had the highest stability (Figures 2c, d). Although k = 4 demonstrated comparable stability, k = 2 provided the advantage of more balanced subgroup sizes (> 100 patients per group), ensuring sufficient statistical power for downstream survival and immune analyses and avoiding potential overstratification. When k = 2, the patients were divided into two subgroups with balanced sample sizes (bile-high group, n = 215; bile-low group, n = 216), which enhanced the statistical power of subsequent analyses. The baseline characteristics of the two subgroups are presented in Table 1. No significant differences were observed in age (p = 0.774, Wilcoxon test), gender (p = 0.598, Chi-square test), and tumor stage (p = 0.292, Chi-square test) between the groups. However, tumor location differed significantly between the subgroups (p = 0.001, Chi-square test). Therefore, this grouping scheme was adopted for further analyses. Survival analysis indicated that overall survival was significantly shorter in the bile-low group compared with the bile-high group (p = 0.0049, Figure 3a). Multivariate Cox regression analysis, adjusting for key clinical confounding factors, confirmed that this subtyping model was an independent prognostic factor (HR = 0.13; 95% CI: 0.02–0.73; p = 0.020; Figure 3b). Independent validation analysis demonstrated that the activity scores of the KEGG bile secretion pathway and the primary bile acid biosynthesis pathway were significantly positively correlated with the original Hallmark bile acid metabolism score (Figures 3c, d; Spearman’s ρ = 0.337 and 0.411, respectively; p < 0.001 for both).

Figure 2

Table 1

GroupBile high (n = 215)Bile low (n = 216)p-value
Age (year, mean ± SD)66.2 ± 1366.7 ± 12.60.774
Gender (man)113 (52.6%)119 (55.1%)0.598
Pathological stage (cases)
 Stage I33 (19.4%)33 (18.5%)0.292
 Stage II77 (45.3%)65 (36.5%)
 Stage III41 (24.1%)56 (31.5%)
 Stage IV19 (11.2%)24 (13.5%)
 Unknown45 (20.9%)38 (17.5%)
Tumor location (cases)
 Left sided81 (37.6%)54 (20.5%)0.001
 Right sided83 (38.6%)120 (55.5%)
 Unknown51 (23.7%)42 (19.4%)

Baseline characteristics of patients in the bile-high and bile-low groups.

Figure 3

3.2 Two nonidentical subtypes possess different tumor immune microenvironment profiles

Based on the results of CIBERSORT, a total of 319 samples (74% for total samples) had p < 0.05 and were included in the subsequent immune infiltration analysis. We examined the immune cell infiltration landscape of these samples (Figure 4a). Correlation analysis revealed that cytotoxic lymphocytes (CD8+ T cells and NK cells) were significantly positively correlated (Figure 4b), which may play an important role in antitumor immunity. Interestingly, the abundance of CD8+ T cells was negatively correlated with the abundance of immunosuppressive cells, suggesting a potential antagonistic relationship between effector and suppressive immune components. Figure 4c depicts the detailed distribution of specific immune cell types between the two groups (CIBERSORT). Compared with the bile-high group, the bile-low group exhibited significantly higher levels of CD8+ T cells and M1 macrophages (p < 0.05, Figure 4c). In addition, the xCell analysis confirmed that, in addition to the consistent infiltration trends of CD8+ T cells (p < 0.001) and M1 macrophages (p < 0.01) observed in the CIBERSORT results, B cells (p < 0.05) and CD4+ naive T cells (p < 0.05) also showed increased infiltration in the bile-low group compared with the bile-high group (Figure 4d). These findings provide important information for further exploring the mechanisms by which bile acid metabolism regulates the function of specific immune cell types.

Figure 4

3.3 Sorting out differentially expressed genes and functional enrichment scan

Intergroup comparison identified 70 significantly DEGs, of which 59 were upregulated, and 11 were downregulated. The distribution of these genes is illustrated in a volcano plot (Figure 5a), while a heatmap in Figure 5b shows the top 50 genes. GO analysis indicated that the DEGs were primarily associated with the biological processes “killing of cells of other organisms,” “antimicrobial peptide-mediated humoral immune response,” and “response to nutrients” (Figure 5c). KEGG pathway analysis revealed that the DEGs were notably enriched in “retinol metabolism,” “drug metabolism–cytochrome P450,” and “fat digestion and absorption” (Figure 5d).

Figure 5

3.4 Singling out hub genes CLCA1, UGT2A3, and ZG16

Subsequently, the top 20 hub genes with the highest degree values were selected from the PPI network (Figures 6a, b). Univariate Cox regression analysis revealed 10 DEGs significantly associated with OS (p < 0.05; Figure 6c). Given that the Cox regression analysis was not adjusted for multiple testing, these genes were considered exploratory candidate prognostic genes. The intersection of hub genes from the PPI network and DEGs significantly correlated with OS yielded three genes: ZG16, CLCA1, and UGT2A3 (Figure 6d).

Figure 6

3.5 Prognostic value as well as immunomodulatory effects of hub genes

Regarding immunocyte infiltration, CLCA1 expression was associated with distinct infiltration patterns of various immune cell types compared with low expression (Figure 7a). Similarly, high expression of UGT2A3 and ZG16 showed significantly different infiltration scores across multiple immune cell types compared with low expression (Figures 7b, c). Survival analysis indicated that patients with high CLCA1 expression had notably better overall survival than those with low expression (p = 9e−04; Figure 7d). Although the survival curves for UGT2A3 (p = 0.23; Figure 7e) and ZG16 (p = 0.17; Figure 7f) appeared visually separated, the differences did not reach statistical significance; these genes should therefore be considered hypothesis-generating candidates requiring further validation. Notably, patients with high expression of CLCA1, UGT2A3, or ZG16 also exhibited significantly higher bile acid metabolism scores (all p < 0.001; Figures 7g–i), confirming that these hub genes are functionally linked to bile acid metabolic activity in CRC. Spearman correlation analysis revealed that the expression of these three genes was not significantly associated with CXCL9 or CXCL10 expression (all Spearman’s correlation coefficients |R| < 0.19; Figure 7j).

Figure 7

3.6 A low-expression degree of hub genes is associated with immunotherapy resistance

TIDE analysis indicated that the low-expression groups of CLCA1, UGT2A3, and ZG16 had significantly higher TIDE scores compared with the high-expression groups (p < 0.0001, p = 0.0029, p = 0.029; Figures 8a–c). Remarkably, Spearman correlation analysis revealed a significant negative correlation between the expression of these three genes and the TIDE score (CLCA1: R = − 0.24, p < 0.001; UGT2A3: R = − 0.15, p = 0.0022; ZG16: R = − 0.14, p = 0.0039; Figures 8d–f).

Figure 8

3.7 Expression validation of crucial genes in TCGA database and clinical patients

3.7.1 Expression in TCGA-COAD and GEO patient cohorts

In TCGA-COAD cohort (41 normal, 431 tumor patients), all three hub genes were significantly downregulated in tumor specimens (All p < 0.001; Figures 9a–c). A similar pattern was observed in the GSE39582 dataset (19 normal and 566 tumor patients), where the expression of all three genes was also significantly downregulated in tumor tissues (All p < 0.001; Figures 9d–f).

Figure 9

3.7.2 Clinical independent patients’ expression

We examined a total of 20 pairs of clinical samples; the basic information of the patients is presented in Table 2. Normal tissues showed significantly higher relative expression of CLCA1, UGT2A3, and ZG16 compared with tumor tissues. All three genes were notably downregulated in tumor tissues relative to adjacent normal tissues (All p < 0.05; Figures 9g–i), consistent with results from TCGA and GEO databases.

Table 2

CharacteristicPatients (n = 20)
Age (year, mean ± SD)61.45 ± 12.39
Gender (man)16 (80%)
Pathological stage (patients)
 Stage I2 (10%)
 Stage II8 (40%)
 Stage III9 (45%)
 Stage IV1 (5%)
Tumor location (patients)
 Left sided13 (65%)
 Right sided7 (35%)

Clinical sample basic information.

4 Discussion

In this study, we investigated the bile acid metabolism in CRC through comprehensive bioinformatics analyses and clinical patient validation. Our findings indicate that bile acid metabolism can modulate the TIME in CRC. Furthermore, three genes (CLCA1, UGT2A3, and ZG16) were significantly downregulated in tumor tissues. Low expression of these three genes was potentially associated with poor prognosis and diminished response to immunotherapy. These findings further support the potential vital role of bile acid metabolism in immune regulation and highlight candidate biomarkers for the future development of personalized immunotherapy strategies.

4.1 Correlation and conceivable mechanisms: bile acid metabolism and immune microenvironment

Our study reveals a paradoxical immune landscape in the bile-low subgroup: despite elevated infiltration of CD8+ T cells and M1 macrophages, patients exhibit significantly worse survival. This suggests that immune cell quantity alone is insufficient for effective antitumor immunity, and functional impairment may predominate. Notably, we found no significant correlation between CLCA1/UGT2A3/ZG16 expression and key T-cell chemokines CXCL9/CXCL10, implying that the observed T-cell accumulation is unlikely to be driven by canonical chemotactic signaling. Instead, it may reflect T-cell exhaustion or spatial exclusion—a phenotype captured by the TIDE score but not by bulk infiltration metrics. The strong association of low bile acid metabolism with right-sided tumors further suggests site-specific metabolic-immune crosstalk, possibly mediated by microbiota or bile acid gradients (16, 3033).

4.2 CLCA1, UGT2A3, and ZG16 present a link between metabolism, mucosal immunity, and immunotherapy

A notable finding of this study is that CLCA1, UGT2A3, and ZG16—three genes highly expressed in normal colorectal tissues—are consistently downregulated in tumor tissues, suggesting that their loss may represent a coordinated event in CRC progression. Low expression of these genes is significantly associated with higher TIDE scores, indicative of immunotherapy resistance. Among the hub genes, only CLCA1 exhibited a robust association with favorable overall survival, whereas UGT2A3 and ZG16 serve as hypothesis-generating candidates that warrant further validation. Importantly, these hub genes also display strong positive correlations with bile acid metabolism pathway activity, highlighting their potential role as functional links between metabolic dysregulation and immune dysfunction in colorectal cancer.

CLCA1 is an accessory protein for chloride ion channels and plays a well-established role in mucus secretion and the maintenance of intestinal epithelial barrier integrity. Reduced expression of CLCA1 may cause “damage to the intestinal mucosal barrier,” increasing local inflammation and attracting immunosuppressive cells, which can facilitate tumor development (34). Based on our findings, we hypothesize that CLCA1 loss in CRC not only impairs the physical barrier but also generates proinflammatory milieu that attracts immunosuppressive cells. Consistent with this, lower CLCA1 expression was associated with higher TIDE scores, suggesting that CLCA1 deficiency contributes to a TIME characterized by T-cell dysfunction, potentially due to the failure to maintain a mucosal microenvironment supportive of effective immunity.

UGT2A3 functions as an essential second-stage enzyme in bile acid metabolism, catalyzing the glucuronidation of bile acids to facilitate their excretion. Reduced expression of UGT2A3 may lead to the “accumulation of toxic bile acids within cells, activation of oncogenic signaling pathways, and induction of endoplasmic reticulum stress. This, in turn, could recruit immunosuppressive cell populations through the release of specific chemokines, further remodeling the TIME (35). In this study, UGT2A3 expression was significantly downregulated in tumors. We hypothesize that decreased UGT2A3 expression may result in the accumulation of specific bile acid species, triggering stress-response or protumorigenic signaling pathways. The precise mechanisms underlying these effects require further investigation in future studies.

ZG16 is a lectin, and its reduced expression may impair host–microbiota interactions, increase the risk of pathogenic bacteria translocation, trigger chronic inflammation, and create an immunosuppressive environment conducive to tumor growth (36). We speculate that decreased ZG16 expression in CRC could destabilize the selective interface with the gut microbiota, facilitating the translocation of pathogenic bacteria or altering microbially derived signals, thereby promoting a state of chronic, low-grade inflammation.

All three genes illustrate how the interruption of the “metabolism–barrier–immunity” axis contributes to colorectal cancer progression and T-cell dysfunction, offering a new perspective for exploring the mechanisms of immune escape in CRC. Naturally, this hypothesis requires further validation.

4.3 Clinical translation viability: from biomarkers to combination therapy targets

The observed association between low CLCA1, UGT2A3, and ZG16 expression and elevated TIDE scores highlights a potential link between bile acid metabolism and T-cell dysfunction in CRC. The consistency with TIDE (a tool specifically focused on T-cell exhaustion and exclusion) suggests that these genes may play a role in functional immune impairment. From another perspective, the TIDE score is designed to model T-cell dysfunction and immune rejection and is particularly effective for predicting responses to ICIs. This indicates that these genes may influence the functional state of T cells rather than overall immune infiltration or cytotoxic potential. This interpretation aligns with the phenotype observed in our study, characterized by “high CD8+ T-cell infiltration but poor prognosis”. Thus, rather than functioning as standalone predictive biomarkers, CLCA1, UGT2A3, and ZG16 are more likely mechanistic mediators linking bile acid metabolism to T-cell dysfunction in CRC. Animal experiments have confirmed that a circular single-stranded DNA (CSSD) can upregulate CLCA1 expression (37). Similarly, the UGT2A3 expression can be modulated using specific antibodies (38). Additionally, interventions targeting the intestinal microbiota can indirectly upregulate the expression of genes like ZG16, thereby reshaping the TIME (39). However, studies investigating the regulation of these three key genes remain at the preclinical stage or have been conducted in other tumor types.

4.4 The limitations of our study

  • The design of this study was primarily retrospective. Although we verified our results using an independent clinical cohort, the relatively small sample size may pose certain limitations. To further assess the prognostic and predictive clinical relevance of these genes, large prospective cohort studies will be required.

  • We initially observed associations between the expression levels of these three genes and TIME. However, the definite molecular mechanisms through which these genes influence the TIME remain largely unknown. In future work, we plan to perform functional studies (using gene-edited cell lines, patient-derived organoids, and in vivo mouse models) to elucidate how these genes modulate T-cell activation and macrophage polarization.

  • Given the well-established crosstalk between the gut microbiota and bile acid metabolism, the absence of microbiome data represents a limitation of this research. Future investigations assessing microbial composition could provide crucial insights into the mechanism by which the microbiota–bile acid axis regulates the TIME.

  • Although the TIDE score can provide insights into T-cell function, it cannot yet serve as a direct evaluation tool for immunotherapy in CRC. The study also lacks clinical data related to immunotherapy. The mechanisms by which the three hub genes influence T-cell function are inferred solely from correlation between their expression levels and the TIDE score, as well as their known biological roles; experimental validation is required to confirm these effects. Additionally, the absence of MSI and microbial data limits our ability to dissect these interactions, representing an important study limitation.

  • Although k = 4 demonstrated comparable stability in consensus clustering, we selected k = 2 to prioritize clinical translatability by creating clearly dichotomized subgroups—a trade-off between granularity and practical utility.

5 Conclusion

In conclusion, our study demonstrates that bile acid metabolism contributes to the modulation of the immunosuppressive microenvironment in CRC and highlights CLCA1, UGT2A3, and ZG16 as candidate molecules mediating this process. These genes may serve as potential prognostic biomarkers and mechanistic links between bile acid metabolism and T-cell dysfunction, providing insights for future combination strategies targeting the metabolism–barrier–immunity axis.

Statements

Data availability statement

The Cancer Genome Atlas (TCGA)-COAD dataset used in this study is available from TCGA data portal (https://portal.gdc.cancer.gov/) and the Gene Expression Omnibus (GEO) database (www.ncbi.nlm.nih.gov/geo/).

Ethics statement

The studies involving humans were approved by Ethics Committee of the Affiliated Hospital of Chengdu University of Traditional Chinese Medicine. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.

Author contributions

LF: Writing – review & editing, Formal analysis, Funding acquisition, Supervision, Writing – original draft, Visualization, Project administration, Software, Methodology, Conceptualization, Resources, Validation, Data curation, Investigation. MW: Writing – review & editing, Investigation, Conceptualization. XL: Writing – review & editing, Project administration, Formal analysis. LW: Investigation, Writing – review & editing, Data curation, Conceptualization, Software. DG: Visualization, Resources, Writing – original draft. BZ: Funding acquisition, Data curation, Writing – original draft, Formal analysis. PZ: Visualization, Supervision, Writing – original draft, Validation. QY: Writing – original draft, Investigation, Software. KW: Writing – original draft. GM: Data curation, Methodology, Investigation, Funding acquisition, Writing – original draft, Writing – review & editing.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This research was funded by the General Project of Sichuan Provincial Science and Technology Department, with the project number: 24SFSC0180.

Conflict of interest

The authors declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fonc.2025.1739534/full#supplementary-material

References

  • 1

    BrayFLaversanneMSungHFerlayJSiegelR. LSoerjomataramIet al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA-A Cancer J Clin. (2024) 74:229–63. doi: 10.3322/caac.21834

  • 2

    JokhadzeNDasADizonDS. Global cancer statistics: A healthy population relies on population health. CA-A Cancer J Clin. (2024) 74:224–6. doi: 10.3322/caac.21838

  • 3

    MármolISánchez-De-DiegoCDiesteAPCerradaEYoldiM. Colorectal carcinoma: A general overview and future perspectives in colorectal cancer. Int J Mol Sci. (2017) 18:197–1. doi: 10.3390/ijms18010197

  • 4

    MancaPCortiFIntiniRMazzoliGMiceliRGermaniMet al. Tumour mutational burden as a biomarker in patients with mismatch repair deficient/microsatellite instability- high metastatic colorectal cancer treated with immune checkpoint inhibitors. Eur J Cancer. (2023) 187:1524. doi: 10.1016/j.ejca.2023.03.029

  • 5

    FridmanWHPagesFSautes-FridmanCGalonJ. The immune contexture in human tumours: impact on clinical outcome. Nat Rev Cancer. (2012) 12:298306. doi: 10.1038/nrc3245

  • 6

    LiJYChenYPLiYQLiuNMaJ. Chemotherapeutic and targeted agents can modulate the tumor microenvironment and increase the efficacy of immune checkpoint blockades. Mol Cancer. (2021) 20:27–1. doi: 10.1186/s12943-021-01317-7

  • 7

    WeiJLiWKZhangPFGuoFKLiuM. Current trends in sensitizing immune checkpoint inhibitors for cancer treatment. Mol Cancer. (2024) 23:271–1. doi: 10.1186/s12943-024-02179-5

  • 8

    KimSICassellaCRByrneKT. Tumor burden and immunotherapy: impact on immune infiltration and therapeutic outcomes. Front Immunol. (2021) 11. doi: 10.3389/fimmu.2020.629722

  • 9

    SharmaPHu-LieskovanSWargoJARibasA. Primary, adaptive, and acquired resistance to cancer immunotherapy. Cell. (2017) 168:707–23. doi: 10.1016/j.cell.2017.01.017

  • 10

    MohantyIAllabandCMannochio-RussoHEl AbieadYHageyLRKnightRet al. The changing metabolic landscape of bile acids-keys to metabolism and immune regulation. Nat Rev Gastroenterol Hepatol. (2024) 21:493516. doi: 10.1038/s41575-024-00914-3

  • 11

    CalicetiCPunzoASillaASimoniPRodaG. New insights into bile acids related signaling pathways in the onset of colorectal cancer. Nutrients. (2022) 14:2964–14. doi: 10.3390/nu14142964

  • 12

    JoyceSAGahanC. Disease-associated changes in bile acid profiles and links to altered gut microbiota. Dig Dis. (2017) 35:169–77. doi: 10.1159/000450907

  • 13

    RezenTRozmanDKovácsTKovácsPSiposABaiPet al. The role of bile acids in carcinogenesis. Cell And Mol Life Sci. (2022) 79:359–69. doi: 10.1007/s00018-022-04278-2

  • 14

    LiuYJZhangS. AZhouW. JHuDXuH. C. Secondary bile acids and tumorigenesis in colorectal cancer. Front In Oncol. (2022) 12. doi: 10.3389/fonc.2022.813745

  • 15

    DermadiDValoSOllilaSSoliymaniRSipariNPussilaMet al. western diet deregulates bile acid homeostasis, cell proliferation, and tumorigenesis in colon. Cancer Res. (2017) 77:3352–63. doi: 10.1158/0008-5472.CAN-16-2860

  • 16

    ChenXZMaZ. YYiZ. QWuE. QShangZ. YTuoBet al. The effects of metabolism on the immune microenvironment in colorectal cancer. Cell Death Discov. (2024) 10:118–1. doi: 10.1038/s41420-024-01865-z

  • 17

    ShahinMPatraSPurkaitSKarMDas MajumdarSKMishraTSet al. PD-L1 expression in colorectal carcinoma correlates with the immune microenvironment. J GI Cancer. (2024) 55:940–9. doi: 10.1007/s12029-024-01049-z

  • 18

    WangHFLiZOuSWSongYNLuoKJGuanZLet al. Tumor microenvironment heterogeneity-based score system predicts clinical prognosis and response to immune checkpoint blockade in multiple colorectal cancer cohorts. Front In Mol Biosci. (2022) 9. doi: 10.3389/fmolb.2022.884839

  • 19

    LiuZQLiuZQGuoYXYangXXChenCFanDDWuXKet alet al. Immune landscape refines the classification of colorectal cancer with heterogeneous prognosis, tumor microenvironment and distinct sensitivity to frontline therapies. Front Cell Dev Biol. (2022) 9. doi: 10.3389/fcell.2021.784199

  • 20

    ChenYPZhengXWuCP. The role of the tumor microenvironment and treatment strategies in colorectal cancer. Front Immunol. (2021) 12. doi: 10.3389/fimmu.2021.792691

  • 21

    JiaWXieGXJiaWP. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat Rev Gastroenterol Hepatol. (2018) 15:111–28. doi: 10.1038/nrgastro.2017.119

  • 22

    ZhouXWQiaoKAWuHMZhangYY. The impact of food additives on the abundance and composition of gut microbiota. Molecules. (2023) 28:631–2. doi: 10.3390/molecules28020631

  • 23

    LiuJFLichtenbergTHoadleyKAPoissonLMLazarAJCherniackADet al. An integrated TCGA pan-cancer clinical data resource to drive high-quality survival outcome analytics. Cell. (2018) 173:400. doi: 10.1016/j.cell.2018.02.052

  • 24

    LiberzonASubramanianAPinchbackRThorvaldsdóttirHTamayoP. Molecular signatures database (MSigDB) 3. 0. Bioinformatics. (2011) 27:1739–40. doi: 10.1093/bioinformatics/btr260

  • 25

    WilkersonMDHayesDN. ConsensusClusterPlus: a class discovery tool with confidence assessments and item tracking. Bioinformatics. (2010) 26:1572–3. doi: 10.1093/bioinformatics/btq170

  • 26

    CarbonSDouglassEDunnNGoodBHarrisNLLewisSEet al. The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res. (2019) 47:D330–8. doi: 10.1093/nar/gky1055

  • 27

    KanehisaMFurumichiMTanabeMSatoYMorishimaK. KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res. (2017) 45:D353–61. doi: 10.1093/nar/gkw1092

  • 28

    SzklarczykDGableALLyonDJungeAWyderSHuerta-CepasJet al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. (2019) 47:D607–13. doi: 10.1093/nar/gky1131

  • 29

    JiangPGuSQPanDFuJXSahuAHuXHet al. Signatures of T cell dysfunction and exclusion predict cancer immunotherapy response. Nat Med. (2018) 24:1550. doi: 10.1038/s41591-018-0136-1

  • 30

    KaiserADSchusterKGadiotJBorknerLDaebritzHSchmittCet al. Reduced tumor-antigen density leads to PD-1/PD-L1-mediated impairment of partially exhausted CD8+T cells. Eur J Immunol. (2012) 42:662–71. doi: 10.1002/eji.201141931

  • 31

    ShenRFHuangYKongDYMaWHLiuJZhangHZet al. Spatial distribution pattern of immune cells is associated with patient prognosis in colorectal cancer. J Of Trans Med. (2024) 22:606–1. doi: 10.1186/s12967-024-05418-x

  • 32

    SunLCZhangHFGaoP. Metabolic reprogramming and epigenetic modifications on the path to cancer. Protein Cell. (2022) 13:877919. doi: 10.1007/s13238-021-00846-7

  • 33

    HeFFLiYM. Role of gut microbiota in the development of insulin resistance and the mechanism underlying polycystic ovary syndrome: a review. J Ovarian Res. (2020) 13:73–1. doi: 10.1186/s13048-020-00670-3

  • 34

    CourtMHHazarikaSKrishnaswamySFinelMWilliamsJAet al. Novel polymorphic human UDP-glucuronosyltransferase 2A3: Cloning, functional characterization of enzyme variants, comparative tissue expression, and gene induction. Mol Pharmacol. (2008) 74:744–54. doi: 10.1124/mol.108.045500

  • 35

    SneitzNCourtMHZhangXLLaajanenKYeeKKDaltonPet al. Human UDP-glucuronosyltransferase UGT2A2: cDNA construction, expression, and functional characterization in comparison with UGT2A1 and UGT2A3. Pharmcog Genomics. (2009) 19:923–34. doi: 10.1097/FPC.0b013e3283330767

  • 36

    ChenXBDuPSheJJCaoLLiYC. Loss of ZG16 is regulated by miR-196a and contributes to stemness and progression of colorectal cancer. Oncotarget. (2016) 7:86695–703. doi: 10.18632/oncotarget.13435

  • 37

    WuHDZhongWLZhangRHDingYPQuCHLaiKGet al. G-quadruplex-enhanced circular single-stranded DNA (G4-CSSD) adsorption of miRNA to inhibit colon cancer progression. Cancer Med. (2023) 12:9774–87. doi: 10.1002/cam4.5721

  • 38

    Gotoh-SaitoSAbeTFurukawaYOdaSYokoiTFinelMet al. Characterization of human UGT2A3 expression using a prepared specific antibody against UGT2A3. Drug Metab Pharmacokinet. (2019) 34:280–6. doi: 10.1016/j.dmpk.2019.05.001

  • 39

    WeiZTLiFPiGF. Association between gut microbiota and osteoarthritis: A review of evidence for potential mechanisms and therapeutics. Front Cell Infect Microbiol. (2022) 12. doi: 10.3389/fcimb.2022.812596

Summary

Keywords

bile acid metabolism, CLCA1, colorectal cancer, tumor immune microenvironment, UGT2A3, ZG16

Citation

Feng L, Wang M, Li X, Wu L, Gu D, Zhang B, Zheng P, Yang Q, Wang K and Mao G (2026) Integrative subtyping by bile acid metabolism identifies CLCA1/UGT2A3/ZG16 as markers of immune dysfunction and poor prognosis in colorectal cancer. Front. Oncol. 15:1739534. doi: 10.3389/fonc.2025.1739534

Received

04 November 2025

Revised

11 December 2025

Accepted

17 December 2025

Published

12 January 2026

Volume

15 - 2025

Edited by

Mohammad Ashfaq, Woxsen University, India

Reviewed by

Jia Liu, Nankai University, China

Aresh Sahu, University of Michigan, United States

Davood Sabour, Allameh Tabataba’i University, Iran

Updates

Copyright

*Correspondence: Gang Mao,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics