This study recruited 25 children with IgAN in the Department of Pediatric Nephrology, Shengjing Hospital of China Medical University from February 2017 to May 2019. Children with IgAN were diagnosed, based on clinical symptoms, laboratory examination, histological, and immunohistochemistric examination of renal biopsied tissues. Patients were diagnosed with IgAN if glomerular mesangial cell proliferation was present and IgA as the sole or predominant immunoglobulin deposition. The pathological grades of IgAN were evaluated by the Lee's classification. There were 3 in grade I, 16 in grade II, 4 in grade III, and 2 in grade IV. There were 13 cases with non-nephrotic syndrome level proteinuria (52%), and 12 cases with isolated hematuria type (48%, Table 1; Supplementary Table 1). Patients were excluded if she/he had another systemic disease, such as Schonlein–Henoch purpura, systemic lupus erythematosus, rheumatoid arthritis, diabetes mellitus, or received corticosteroids or other immunosuppressants before diagnosis. The control group included eight children, who underwent unilateral partial nephrectomy due to trauma or tumor in the same period and their surgical kidney tissue specimens were used for immunohistochemistry analysis. The serological control samples were obtained from 25 children, who underwent physical examination in our hospital (Table 1; Supplementary Tables 1, 2).

This study was approved by the Ethics Committee of Shengjing Hospital, China Medical University (2019PS441K). Written informed consent was signed by participants' parents.

Male Sprague Dawley (SD) rats weighing 180–220 g were obtained from Liaoning Changsheng Biotechnology (Benxi, China). The rats were housed in a specific pathogen-free room in the Experimental Center of Shengjing Hospital and allowed free access to food and water.

SD rats were randomly divided into three groups, the Control, IgAN, and CTSS inhibitor groups with 10 rats in each group. A rat model of IgAN was induced as described previously (9, 10). Briefly, SD rats were randomized and administrated with bovine serum albumin (BSA, 100 mg/ml in distilled water, 4 ml/kg, B2064, Sigma, St. Louis, USA) every other days by gavage for eight consecutive weeks and injected subcutaneously with 0.1 ml of CCl4 dissolved in 0.5 ml castor oil weekly for nine consecutive weeks as well as injected intravenously with 50 μg Lipopolysaccharide (LPS, L2880, Sigma) in saline at the 6th and 9th week post induction. Beginning on the 6th week post induction, the BSA-treated rats were randomized and injected intraperitoneally with 200 μl of saline (IgAN) or 200 μl saline containing 100 μg (0.5 μg/μl) LY3000328 (a specific inhibitor of CTSS, A3284, Apexbio, Houston, USA) daily for 3 weeks. The control rats received vehicles used in the experimental group. At 10 weeks post induction, peripheral blood samples were obtained from individual rats to prepare serum samples and stored at −80°C. All animals were euthanized. Their kidney tissues were dissected and fixed in 10% formalin overnight, followed by paraffin-embedded. The kidney tissues (4 μm) were subjected to Periodic acid–Schiff (PAS) staining.

This study was approved by the Ethics Committee of Shengjing Hospital, China Medical University (2019PS458K).

HMCs were purchased from the China Center for Type Culture Collection, Shanghai and characterized by STR. HMCs were cultured in high glucose MEM medium containing 10% of fetal bovine serum (FBS, Hyclone, USA). Monomeric human IgA1 (Sigma) at 25 μg/ml was heated and aggregated at 65°C for 150 min on a dry plate-heater to obtain the aggregated IgA1 as previously described (11). The cells were pre-treated with vehicle or 10 μg/mL LY3000328 overnight and treated with 25 μg/mL IgA1 aggregates for 24 h (12).

The levels of CTSS expression in the kidneys of individual rats were characterized by immunohistochemistry (13). Briefly, the kidney tissue sections (4 μm) were dewaxed, rehydrated, and subjected to the antigen retrieval process. The sections were incubated with rabbit anti-rat CTSS antibody (1:1,000, Novus Biologicals, USA) at 4°C overnight. After being washed, the bound antibodies were reacted with horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG and visualized with DAB (3,3′-Diaminobenzidine), followed by counterstained with hematoxylin. The sections were photoimaged under a light microscope.

The levels of serum CTSS in individual rats and human patients were quantified by ELISA using a commercially available ELISA kit (Abcam, USA), according to the manufacturer's instruction. The minimum detectable level was 4 pg/ml. Samples were tested in triplicate.

The levels of CTSS expression and IgA accumulation in the kidney tissues were characterized by immunofluorescence. Briefly, the kidney tissue sections (4 μm) were subjected to antigen retrieval process and probed with FITC-anti-IgAα (1:100, Abcam) or rabbit anti-CTSS (1:50, Santa Cruz, Biotech) overnight at 4°C. After being washed, the bound rabbit anti-CTSS antibodies were detected with Cy3-conjugated goat anti-rabbit IgG (1:200, Beyotime, China), followed by nuclearly stained with 4′,6-diamidino-2-phenylindole (DAPI, C1002, Beyotime). The immunofluorescent signals were observed under a fluorescent microscope (Nikon).

The relative levels of Ki67 expression in individual samples were measured by Western blotting. Briefly, the kidney tissues were homogenized and after centrifugation, the protein concentrations in the tissue lysates were determined using a commercial bicinchoninic acid (BCA) kit (ThermoScientific). Subsequently, the tissue lysates (20 μg/lane) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) on 12% gels and transferred to nitrocellulose membranes. The membranes were blocked with 5% fat-free dry milk in Tris-buffered saline, 0.1% Tween 20 (TBST) and probed with primary antibodies against Ki67 (1:100, ZSGH-Bio, Beijing, China) or β-actin overnight. The bound antibodies were detected with HRP-coupled goat anti-rabbit IgG (1:3,000 dilution, SE134, Solarbio, China), and visualizing with the enhanced chemiluminescent system (PE0010, Solarbio). The relative levels of Ki67 expression were quantified by densitometric scanning using ImageJ software.

Total RNA was isolated from renal tissues and cells using total RNA isolating kit (Tiangen, Beijing, China) according to the manufacturer's introductions. The RNA samples were reversely transcribed into cDNA using an RT Primer (Genscript, Nanjing, China) and RNase inhibitor (DP418, Tiangen). RT-PCR reactions were carried out with the SYBR green PCR kit (SY1020, Solarbio) and specific primers of forward 5′CTGACCCTGATGAGAGTGAGGGA3′ and reverse 5′ACTCTGTAGGGTCGAGCAGG3′ for Ki67; forward 5′GACCTGACCTGCCGTCTAG3′ and reverse 5′AGGAGTGGGTGTCGCTGT3′ for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative levels of KI67 to the control GAPDH mRNA transcripts were analyzed by the 2^−ΔΔCt method.

Cell proliferation was detected by cell counting kit-8 (CCK-8) (Apexbio). Briefly, HMCs (2,000 cells /well) were cultured in 96-well-plates in triplicate for 0, 6, 12, 24, 36, and 48 h. Individual wells of cells were added with 10 μL of CCK-8 solution and cultured at 37°C for 2 h. The absorbance of individual wells was read at 450 nm in a microplate reader.

The statistical analysis was performed using SPSS 21.0. All data were analyzed in a blinded manner and are expressed as mean ± standard deviation (SD). Pairwise comparisons were performed by the Student t-test and the difference among multiple groups was determined by one-way analysis of variance and post-hoc the least significant difference test. The correlation was statistically analyzed by Pearson correlation tests. A P-value of < 0.05 was considered statistically significant.

To determine the potential role of CTSS in the pathogenesis of IgAN, we recruited 25 children with IgAN and 25 age and gender-matched healthy children as well as eight patients with trauma or tumor (Table 1; Supplementary Tables 1, 2). Immunohistochemistry analysis indicated that anti-CTSS staining in the glomerular mesangium and tubular epithelial cells of biopsied renal tissues from 25 IgAN patients were remarkably stronger than that in those from non-IgAN patients with trauma or tumor (Figure 1A). ELISA revealed that the levels of serum CTSS in 25 IgAN patients, including 19 with Lee's classification (I + II), 6 with Lee's classification (III + IV), were significantly higher than that in healthy subjects in this population, and the serum CTSS levels in (III + IV) IgAN patients were significantly higher than that in (I + II) IgAN patients (P < 0.05, Figure 1B). Hence, increased levels of CTSS expression were detected in renal tissues and serum samples from IgAN patients.

Next, we analyzed the potential association between serum CTSS levels and some clinical measures in 25 IgAN patients. We found the serum CTSS levels were not associated with serum Scr and BUN levels in IgAN patients (Figures 2A,B). However, the levels of serum CTSS were positively correlated with the levels of 24-h-urine proteins (R = 0.79, P < 0.01), urinary microalbumin (R = 0.5822, P < 0.01) and urine erythrocytes (R = 0.7628, P < 0.01) in IgAN patients (Figures 2C–E). The levels of serum CTSS were positively associated with the grades of IgAN Lee's classification (R = 0.77, P < 0.01; Figure 2F). The significant correlation between serum levels of CTSS and these clinical measures suggest that up-regulated CTSS expression may contribute to the pathogenesis of IgAN.

To explore the role of CTSS in the development of IgAN, SD rats were induced for development of IgAN. Immunofluorescence displayed that IgA deposited in the glomeruli of IgAN rats, but little in the renal tissues of control rats, and quantitative analysis indicated that the areas of anti-IgA staining in the IgAN rats were significantly larger than that in the control rats (P < 0.01; Figure 3A). Further immunofluorescence revealed that the levels of CTSS expression in the glomeruli of IgAN rats were significantly higher than that in the controls (P < 0.01; Figure 3B). Thus, induction of IgAN significantly promoted the accumulation of IgA and increased the levels of CTSS expression in renal tissues of rats.

Glomerular mesangial cell proliferation is a pathogenic hallmark of IgAN. Next, we measured whether inhibition of CTSS could modulate the levels of Ki76 expression in renal tissues of different groups of rats. As shown in Figure 4A, PAS staining exhibited that there was no abnormality in the glomerular basilar membrane and mesangium, or no glomerular sclerosis in the control rats. In contrast, there was a slight increase in glomerular surface area, basement membrane thickness, accompanied by the mesangial expansion and some degrees of inflammatory infiltrates in the IgAN group. After treatment with CTSS inhibitor, there was no clear proliferative glomerular mesangium and basilar membrane and only minimal inflammatory infiltrates in the kidney tissues. Immunohistochemistry revealed that the levels of anti-Ki67 staining in the rats with a CTSS inhibitor were obviously less than that in the IgAN rats, but remained higher than that in the controls (Figure 4B). Western blot analysis displayed that the relative levels of Ki67 expression in the kidneys from the IgAN + CTSS inhibitor group were significantly lower than that in the IgAN group (P < 0.01) but still higher than that in the controls (P < 0.05; Figure 4C). Such three lines of data suggest that treatment with a CTSS inhibitor may inhibit glomerular mesangial cell proliferation in IgAN rats.

Finally, we tested the impact of treatment with a CTSS inhibitor on the proliferation of HMCs in vitro. HMCs were pre-treated with, or without, the CTSS inhibitor overnight and treated in triplicate with, or without, IgA1 aggregates for varying time periods. The proliferation of HMCs was determined by CCK-8 assays. In comparison with the control cells without any treatment, treatment with IgA1 alone increased HMC clusters, while treatment with the CTSS inhibitor appeared slightly reduced the clusters of HMCs (Figure 5A). Longitudinal analyses indicated the numbers of HMCs following treatment with the CTSS inhibitor were only slightly greater than that in the controls, but significantly less than that in the IgA1-treated alone group, particularly after treatment with the CTSS inhibitor for 24–48 h (Figure 5B). Further analyses revealed that the relative levels of Ki67 mRNA transcripts to the control GAPDH in the CTSS inhibitor-treated cells were significantly lower than that in the cells treated with IgA1 alone, but remained higher than that of the controls (Figure 5C). Such data demonstrated that treatment with the CTSS inhibitor significantly inhibited the IgA1-stimulated HMC proliferation in vitro.