<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Pharmacol.</journal-id>
<journal-title>Frontiers in Pharmacology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Pharmacol.</abbrev-journal-title>
<issn pub-type="epub">1663-9812</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">647124</article-id>
<article-id pub-id-type="doi">10.3389/fphar.2021.647124</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Pharmacology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>LncRNA Nuclear-Enriched Abundant Transcript 1 Regulates Atrial Fibrosis via the miR-320/NPAS2 Axis in Atrial Fibrillation</article-title>
<alt-title alt-title-type="left-running-head">Dai et&#x20;al.</alt-title>
<alt-title alt-title-type="right-running-head">Effect of NEAT1in AF</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Dai</surname>
<given-names>Huangdong</given-names>
</name>
<xref ref-type="fn" rid="fn1">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhao</surname>
<given-names>Naishi</given-names>
</name>
<xref ref-type="fn" rid="fn1">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Hua</given-names>
</name>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zheng</surname>
<given-names>Yue</given-names>
</name>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1184291/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhao</surname>
<given-names>Liang</given-names>
</name>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
</contrib>
</contrib-group>
<aff>Department of Cardiovascular Surgery, Shanghai Chest Hospital, Shanghai Jiao Tong University, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/574665/overview">Hua Zhu</ext-link>, The Ohio State University, United&#x20;States</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/729122/overview">Zhenwei Pan</ext-link>, Harbin Medical University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/618573/overview">Sebastian Clauss</ext-link>, Ludwig Maximilian University of Munich, Germany</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Yue Zheng, <email>kelvinzh31@163.com</email>; Liang Zhao, <email>zhaoliang80112@126.com</email>
</corresp>
<fn fn-type="other">
<p>This article was submitted to Cardiovascular and Smooth Muscle&#x20;Pharmacology, a section of the journal Frontiers in Pharmacology</p>
</fn>
<fn fn-type="equal" id="fn1">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this&#x20;work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>15</day>
<month>04</month>
<year>2021</year>
</pub-date>
<pub-date pub-type="collection">
<year>2021</year>
</pub-date>
<volume>12</volume>
<elocation-id>647124</elocation-id>
<history>
<date date-type="received">
<day>29</day>
<month>12</month>
<year>2020</year>
</date>
<date date-type="accepted">
<day>10</day>
<month>03</month>
<year>2021</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2021 Dai, Zhao, Liu, Zheng and Zhao.</copyright-statement>
<copyright-year>2021</copyright-year>
<copyright-holder>Dai, Zhao, Liu, Zheng and Zhao</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these&#x20;terms.</p>
</license>
</permissions>
<abstract>
<p>Atrial fibrosis is a key contributor to atrial fibrillation (AF). Long non-coding ribonucleic acids (lncRNAs) were demonstrated to exhibit a key role in fibrotic remodeling; however, the function of nuclear-enriched abundant transcript 1 (NEAT1) in atrial fibrosis remains unclear. In the present study, we showed that NEAT1 was upregulated in atrial tissues of AF patients and was positively related to collagen I (coll I) and collagen III (coll III) expressions. Furthermore, the deletion of NEAT1 attenuated angiotensin II (Ang II)-caused atrial fibroblast proliferation, migration, and collagen production. We further observed that NEAT1 knockdown improved Ang II caused mouse atrial fibrosis in <italic>in vivo</italic> experiments. Moreover, we demonstrated that NEAT1 could negatively regulate miR-320 expression by acting as a competitive endogenous RNA (ceRNA). miR-320 directly targeted neuronal per arnt sim domain protein 2 (NPAS2) and suppressed its expression. We observed that NEAT1 exerted its function via the miR-320&#x2013;NPAS2 axis in cardiac fibroblasts. These findings indicate that NEAT1 exerts a significant effect on atrial fibrosis and that this lncRNA is a new potential molecular target for AF treatment.</p>
</abstract>
<kwd-group>
<kwd>atrial fibrillation</kwd>
<kwd>atrial fibrosis</kwd>
<kwd>NEAT1</kwd>
<kwd>miR-320</kwd>
<kwd>NPAS2</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>Atrial fibrillation (AF) is the most common arrhythmia encountered in clinical practice and a main cause of stroke (<xref ref-type="bibr" rid="B3">Chiang et&#x20;al., 2014</xref>). Accumulating evidence has demonstrated that atrial fibrosis serves as a key contributor to AF (<xref ref-type="bibr" rid="B26">Xu et&#x20;al., 2018</xref>). Atrial fibrosis is a marker of structural reconstruction and is seen as a substrate for AF progression (<xref ref-type="bibr" rid="B6">Dzeshka et&#x20;al., 2015</xref>). Advanced atrial fibrosis is related to frequent episodes of AF, conversion of arrhythmias to permanent types, and antiarrhythmic drug therapy is less effective (<xref ref-type="bibr" rid="B5">Corradi, 2014</xref>; <xref ref-type="bibr" rid="B6">Dzeshka et&#x20;al., 2015</xref>). AF is a major public health tissue; but no effective means for AF prevention exist so far. Therefore, it is important to further elucidate the pathogenesis of&#x20;AF.</p>
<p>Long non-coding RNAs (lncRNAs) are a class of RNAs (&#x3e;200 nucleotides) that are vital for regulating gene function and various cellular processes (<xref ref-type="bibr" rid="B19">Qin et&#x20;al., 2019</xref>). Abundant evidence has confirmed that lncRNAs participate in the progression of cancer, chronic obstructive pulmonary disease, cardiovascular disease, and systemic lupus erythematosus (<xref ref-type="bibr" rid="B12">Jiang et&#x20;al., 2020</xref>; <xref ref-type="bibr" rid="B22">Shen et&#x20;al., 2020</xref>; <xref ref-type="bibr" rid="B25">Wu et&#x20;al., 2020</xref>; <xref ref-type="bibr" rid="B32">Zhang et&#x20;al., 2020</xref>). However, so far, only few lncRNAs have been identified to be associated with cardiac fibrosis. For example, PVT1 facilitates atrial fibrosis through regulating miR-128-3p&#x2013;SP1 in patients with AF (<xref ref-type="bibr" rid="B1">Cao et&#x20;al., 2019</xref>); knockdown of KCNQ1OT1 attenuates Ang II caused AF (<xref ref-type="bibr" rid="B21">Shen et&#x20;al., 2018</xref>); NRON <ext-link ext-link-type="uri" xlink:href="http://dict.youdao.com/w/relieve/">relieve</ext-link>s atrial fibrosis via enhancing the NFATc3 phosphorylation (<xref ref-type="bibr" rid="B24">Wang et&#x20;al., 2019</xref>). Reportedly, lncRNA NEAT1 affects fibrosis of organs, such as liver fibrosis (<xref ref-type="bibr" rid="B13">Jin et&#x20;al., 2019</xref>) and renal fibrosis (<xref ref-type="bibr" rid="B10">Huang et&#x20;al., 2019</xref>); however, the functional role and specific mechanism of NEAT1 in atrial fibrosis still completely unclear.</p>
<p>Circadian rhythms occur around a 24&#xa0;h oscillation in behavior and physiology associated with the solar day, which exist in essentially all tissue and cell types of the organism (<xref ref-type="bibr" rid="B7">Eckel-Mahan and Sassone-Corsi, 2013</xref>; <xref ref-type="bibr" rid="B11">Hurley et&#x20;al., 2016</xref>). Previous research reports that dysregulation of some circadian genes, such as Bmal1 and Clock, contributes to atrial fibrogenesis (<xref ref-type="bibr" rid="B9">Goetze et&#x20;al., 2010</xref>; <xref ref-type="bibr" rid="B4">Choudhury et&#x20;al., 2015</xref>). Neuronal PAS domain protein 2 (NPAS2), one of the core circadian molecules that has been shown to promote hepatocarcinoma cell proliferation, contributed to liver fibrogenesis (<xref ref-type="bibr" rid="B29">Yang et&#x20;al., 2019</xref>). But its role in atrial fibrosis remains unclear. In the present study, we observed that NEAT1 was increased in right atrial tissues of AF patients and was positively related to coll I and coll III expressions. We revealed that NEAT1 knockdown reduced Ang II caused atrial fibroblast proliferation and migration. Moreover, we observed that NEAT1 exerted its function via the miR-320/NPAS2 axis in cardiac fibroblasts. The above findings suggest that NEAT1 exerts a significant effect on atrial fibrosis and that this lncRNA is a new potential molecular target for AF treatment.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and Methods</title>
<sec id="s2-1">
<title>Patients and Tissue Samples</title>
<p>Patients undergoing cardiac valve replacement (The cases of mitral valve replacement were excluded) at Shanghai Chest Hospital (Shanghai, China) were joined in our research and were split into the AF group (<italic>n</italic>&#x20;&#x3d; 15) and sinus rhythm (SR) group (<italic>n</italic>&#x20;&#x3d; 13), according to preoperative electrocardiogram examination and medical history. Patients with persistent atrial fibrillation were included in our study. Patients with previous coronary atherosclerotic heart disease, chronic pulmonary heart disease, infective endocarditis, hyperthyroidism, severe dysfunction of liver and kidney, and malignant tumors were excluded. All patients in the preoperative period of 6&#x20;months without applying any type of angiotensin II receptor blockers and angiotensin converting enzyme inhibitors. Superior vena cava intubation was placed in the right auricle, and the right auricle extracted during the procedure was collected for this study. The right atrium was carefully cleaned with normal saline to remove blood, and the adipose tissue was carefully pruned and removed for use in this study. This research protocol was permitted by the ethics committee of Shanghai Chest Hospital, and written informed consent was obtained from each patient.</p>
</sec>
<sec id="s2-2">
<title>Bioinformatics Analysis</title>
<p>Potential NEAT1 and miR-320 binding sites were predicted using starBase v2.0 (<ext-link ext-link-type="uri" xlink:href="http://starbase.sysu.edu.cn/starbase2/mirLncRNA.php">http://starbase.sysu.edu.cn/starbase2/mirLncRNA.php</ext-link>), and miR-320 and NPAS2 binding sites were predicted using Targetscan (<ext-link ext-link-type="uri" xlink:href="http://www.targetscan.org/vert_72/">http://www.targetscan.org/vert_72/</ext-link>).</p>
</sec>
<sec id="s2-3">
<title>qRT&#x2013;PCR Analysis</title>
<p>Total RNA was obtained from indicated cells or tissues with Trizol (Invitrogen, Carlsbad, CA, United&#x20;States). The ratio of the optical density of RNA at 280 and 260&#xa0;nm was measured by ultraviolet spectrophotometer, and the determination value was between 1.8 and2.0. RNAs were converted into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, United&#x20;States). qRT&#x2013;PCR was carried out tharough a LightCycler 480&#x20;real-time PCR system using SYBR&#xae; Premix Ex Taq&#x2122; (Takara Bio, Inc., Dalian, China). GAPDH or U6 was functioned as the internal control. The 2<sup>&#x2212;&#x394;&#x394;Ct</sup> method was performed to analyze the relative expression level of each gene. The sequence of primers is shown in <xref ref-type="table" rid="T1">Table&#x20;1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primers used for qRT&#x2013;PCR.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Gene or Primer name</th>
<th align="left">Primer sequence (5&#x2032;-3&#x2032;)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="2" align="left">
<italic>NEAT1-human</italic>
</td>
<td align="left">F: CCT&#x200b;GCC&#x200b;TTC&#x200b;TTG&#x200b;TGC&#x200b;GTT&#x200b;TC</td>
</tr>
<tr>
<td align="left">R:CTTGTACCCTCCCAGCGTTT</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>NEAT1-mouse</italic>
</td>
<td align="left">F: GGG&#x200b;AAG&#x200b;GGT&#x200b;GAC&#x200b;ATT&#x200b;GAA&#x200b;AA</td>
</tr>
<tr>
<td align="left">R: CTC&#x200b;CCC&#x200b;AGC&#x200b;TTC&#x200b;ACT&#x200b;TCT&#x200b;TG</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>Coll I-human</italic>
</td>
<td align="left">F: GAG&#x200b;AGC&#x200b;ATG&#x200b;ACC&#x200b;GAT&#x200b;GGA&#x200b;TT</td>
</tr>
<tr>
<td align="left">R: CCT&#x200b;TCT&#x200b;TGA&#x200b;GGT&#x200b;TGC&#x200b;CAG&#x200b;TC</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>Coll I-mouse</italic>
</td>
<td align="left">F: GCT&#x200b;CCT&#x200b;CTT&#x200b;AGG&#x200b;GGC&#x200b;CAC&#x200b;T</td>
</tr>
<tr>
<td align="left">R: CCA&#x200b;CGT&#x200b;CTC&#x200b;ACC&#x200b;ATT&#x200b;GGG&#x200b;G</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>Coll III-human</italic>
</td>
<td align="left">F: GGT&#x200b;CCT&#x200b;CCT&#x200b;GGA&#x200b;ACT&#x200b;GCC&#x200b;GGA</td>
</tr>
<tr>
<td align="left">R: GAG&#x200b;GAC&#x200b;CTT&#x200b;GAG&#x200b;CAC&#x200b;CAG&#x200b;CGT&#x200b;GT</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>Coll III-mouse</italic>
</td>
<td align="left">F: TGA&#x200b;ATG&#x200b;GTG&#x200b;GTT&#x200b;TTC&#x200b;AGT&#x200b;TCA&#x200b;G</td>
</tr>
<tr>
<td align="left">R: GGT&#x200b;CAC&#x200b;TTG&#x200b;CAC&#x200b;TGG&#x200b;TTG&#x200b;ATA&#x200b;A</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>miR-320-mouse</italic>
</td>
<td align="left">F: AAA&#x200b;AGC&#x200b;TGG&#x200b;GTT&#x200b;GAG&#x200b;AGG&#x200b;A</td>
</tr>
<tr>
<td align="left">R: TCC&#x200b;TCT&#x200b;CAA&#x200b;CCC&#x200b;AGC&#x200b;TTT&#x200b;T</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>NPAS2-mouse</italic>
</td>
<td align="left">F: CGC&#x200b;AGA&#x200b;TGT&#x200b;TCG&#x200b;AGT&#x200b;GGA&#x200b;AAG</td>
</tr>
<tr>
<td align="left">R: GTG&#x200b;CAT&#x200b;TAA&#x200b;AGG&#x200b;GCT&#x200b;GTG&#x200b;GAG</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>GAPDH-human</italic>
</td>
<td align="left">F: AGC&#x200b;AAG&#x200b;AGC&#x200b;ACA&#x200b;AGA&#x200b;GGA&#x200b;AG</td>
</tr>
<tr>
<td align="left">R: GGT&#x200b;TGA&#x200b;GCA&#x200b;CAG&#x200b;GGT&#x200b;ACT&#x200b;TT</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>GAPDH-mouse</italic>
</td>
<td align="left">F: AGA&#x200b;ACA&#x200b;TCA&#x200b;TCC&#x200b;CTG&#x200b;CAT&#x200b;CC</td>
</tr>
<tr>
<td align="left">R: GGT&#x200b;CCT&#x200b;CAG&#x200b;TGT&#x200b;AGC&#x200b;CCA&#x200b;AG</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>U6-human</italic>
</td>
<td align="left">F: GCGCGTCGTGAAGCGTTC</td>
</tr>
<tr>
<td align="left">R: GTGCAGGGTCCGAGGT</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>U6-mouse</italic>
</td>
<td align="left">F: TGG&#x200b;AAC&#x200b;GCT&#x200b;TCA&#x200b;CGA&#x200b;ATT&#x200b;TGC&#x200b;G</td>
</tr>
<tr>
<td align="left">R: AGA&#x200b;CTG&#x200b;CCG&#x200b;CCT&#x200b;GGT&#x200b;AGT&#x200b;TGT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-4">
<title>Western Blotting</title>
<p>Atrial muscle tissues and cardiac fibroblasts were homogenized or lyzed in radioimmunoprecipitation assay buffer containing a cocktail of protease inhibitors (Santa Cruz, CA, United&#x20;States) in accordance with the manufacturer&#x2019;s instruction. Protein was quantified using the Bicinchoninic Acid (BCA) Protein Assay Kit and boiled for 10&#xa0;min at 95&#xb0;C. Total protein was obtained and loaded into 10% SDS-PAGE and transferred onto PVDF membranes. The primary antibodies used in our study are as follows: anti-coll I (Proteintech Group, Wuhan, China), anti-coll III (Proteintech Group, Wuhan, China), anti-NPAS2 (Thermo Fisher Scientific), and anti-GAPDH (Proteintech). Quantification was performed by measuring the signal intensity using ImageJ (National Institute of Health, Rockville, MD, United&#x20;States).</p>
</sec>
<sec id="s2-5">
<title>Cell Culture and Cell Treatments</title>
<p>Mouse cardiac fibroblasts were obtained from Ginio Biotechnology (Guangzhou, China), cultured in DMEM containing 10% FBS, and were transfected with the plasmids and stimulated with Ang II (1&#xa0;&#x3bc;M).</p>
</sec>
<sec id="s2-6">
<title>Plasmid Construction and Cell Transfection</title>
<p>The miR-320 mimic, miR-320 inhibitor, and their negative controls (NC mimic and NC inhibitor) were obtained from GenePharma (Shanghai, China). The sequences as follows: miR-320 mimic (sense: 5&#x2032;-AAA&#x200b;AGC&#x200b;UGG&#x200b;GUU&#x200b;GAG&#x200b;AGG&#x200b;A-3&#x2032;) or NC mimic (sense: 5&#x2032;-UUC&#x200b;UCC&#x200b;GAA&#x200b;CGU&#x200b;GUC&#x200b;ACG&#x200b;UTT-3&#x2032;); miR-320 inhibitor (sense: 5&#x2032;- UCC&#x200b;UCU&#x200b;CAA&#x200b;CCC&#x200b;AGC&#x200b;UUU&#x200b;U-3&#x2032;) or NC inhibitor (sense: 5&#x2032;-CAG&#x200b;UAC&#x200b;UUU&#x200b;UGU&#x200b;GUA&#x200b;GUA&#x200b;CAA-3&#x2032;). The coding region of the NPAS2 mRNA was cloned into the pcDNA3.1 (&#x2b;) vector. The lentiviral vector expressing shRNA targeting NEAT1 was obtained from HANBIO (Shanghai, China). Short-hairpin RNA directed against NEAT1 was constructed in pLKO.1-puro vector to generate NEAT1 shRNA expression constructs, the non-targeting sequence (negative control, shNC) were also synthesized. The sequences of shNEAT1 and shNC were as follows: shNEAT1-F: ccg&#x200b;gCA&#x200b;GGA&#x200b;CTA&#x200b;GGT&#x200b;GCG&#x200b;TAG&#x200b;TGc&#x200b;tcg&#x200b;agC&#x200b;ACT&#x200b;ACG&#x200b;CAC&#x200b;CTA&#x200b;GTC&#x200b;CTG&#x200b;ttt&#x200b;ttg and shNEAT1-R: aat&#x200b;tca&#x200b;aaa&#x200b;aCA&#x200b;GGA&#x200b;CTA&#x200b;GGT&#x200b;GCG&#x200b;TAG&#x200b;TGc tcg&#x200b;agC&#x200b;ACT&#x200b;ACG&#x200b;CAC&#x200b;CTA&#x200b;GTC&#x200b;CTG. Cell transfection was carried out with validated vector and lentivirus packaging vectors (pMD2G and pSAX2) using Lipofectamine 2000 (Invitrogen).</p>
</sec>
<sec id="s2-7">
<title>The CCK-8 Assay</title>
<p>For the CCK-8 assay, transfected cells were plated into 96-well plates, and the medium of each well was replaced with culture media containing 10% CCK-8 at 72&#xa0;h. The absorbance was measured using a microplate reader at an optical density of 450&#xa0;nm.</p>
</sec>
<sec id="s2-8">
<title>Cell Migration Assay</title>
<p>The transfected cells were stimulated with or without Ang II. After that, indicated cells were cultured in the upper chamber using serum-free DMEM. Twenty-four hours later, non-migratory cells on top of the membrane were taken out, and membranes containing cells on the bottom were fixed and stained. The migratory cells were counted under a microscope.</p>
</sec>
<sec id="s2-9">
<title>Luciferase Activity Assay</title>
<p>Human embryonic kidney 293 (HEK293) T-cells were co-transfected with reporter plasmids including either the wild-type NPAS2 3&#x2b9;UTR (NPAS2-WT) or wild-type NEAT1 containing miR-320 binding site (NEAT1-WT) or mutated NPAS2 3&#x2b9;UTR (NPAS2-MT) or mutated NEAT1 (NEAT1-MT) and with either the miR-320 mimic or NC mimic. After 48&#xa0;h inductions, the luciferase assay was conducted, and the relative luciferase activity was determined.</p>
</sec>
<sec id="s2-10">
<title>The Ang II-Induced Atrial Fibrosis Mouse Model</title>
<p>C57BL/6J mice (6&#x2013;7&#xa0;weeks old) were subdivided into the control, Ang II (Ang II, 1200&#xa0;ng/kg/min, was continuously perfused to mice through a micropump), Ang II/shNEAT1 (shNEAT1 was injected into the mice via the tail vein after 28&#xa0;days of Ang II stimulation), and Ang II/shNC (shNC was injected into the mice via the tail vein after 28&#xa0;days of Ang II treatment) groups. After 14&#xa0;days, right atrial muscle tissues were obtained for research.</p>
</sec>
<sec id="s2-11">
<title>Hematoxylin&#x2013;Eosin Staining and Masson&#x2019;s Trichrome Staining</title>
<p>Atrial muscle tissues obtained from different groups were fixed in 4% paraformaldehyde, embedded in paraffin and then sectioned into slices (4&#xa0;&#x3bc;m thick). The slices were conducted to HE and Masson&#x2019;s trichrome stainings. The photographs of the stained tissues were captured, and analyze the pathological changes using Image-Pro Plus (version 6.0; Media Cybernetics, Inc., Rockville, MD, United&#x20;States).</p>
</sec>
<sec id="s2-12">
<title>Statistical Analysis</title>
<p>All data analyses were carried out using Prism 5.0 (GraphPad Software, San Diego, CA, United&#x20;States), and all data are presented as mean&#x20;&#xb1; SD. The significance of the differences was determined using Student&#x2019;s <italic>t</italic>-test. Correlation between factors was analyzed using spearman&#x2019;s correlation coefficient rank test. <italic>p</italic> values &#x3c; 0.05 were recognized to be significant. Each <italic>in&#x20;vitro</italic> experiment was performed a minimum of three times, and samples were measured in biological triplicates for each experiment.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>NEAT1 is Upregulated in Patients With Atrial Fibrillation and is Positively Correlated With coll I and coll III</title>
<p>To explore whether NEAT1 was involved in AF progression, we first determined NEAT1 expression in right atrial tissues of AF patients and SR patients. The results of qRT&#x2013;PCR observed that NEAT1 expression in right atrial tissues was higher in patients with AF than in those with SR (<xref ref-type="fig" rid="F1">Figure&#x20;1A</xref>). Additionaly, we confirmed that coll I and coll III levels were upregulated in the AF group compared to those in the SR group (<xref ref-type="fig" rid="F1">Figures 1B,C</xref>). Additionally, coll I and coll III levels were positively related to NEAT1 expression in right atrial tissues of AF patients (<xref ref-type="fig" rid="F1">Figure&#x20;1D</xref>). These observations suggest that NEAT1 participates in atrial fibrosis regulation.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>NEAT1 expression is increased in patients with AF and is positively associated with collagen I (coll I) and collagen III (coll III). <bold>(A)</bold> NEAT1 expression in right atrial tissues of patients with AF (n &#x3d; 15) and those with SR (n &#x3d; 13) was detected using qRT&#x2013;PCR analysis. <bold>(B)</bold> The mRNA expression of coll I and coll III in human right atrial tissues was determined using qRT&#x2013;PCR. <bold>(C)</bold> The protein expression of coll I and coll III in human atrial tissues was determined using western blotting. <bold>(D)</bold> Correlations of NEAT1 with coll I and coll III were analyzed. &#x2a;<italic>p</italic>&#x20;&#x3c; 0.05. Data represent mean&#x20;&#xb1; SD from three independent experiments.</p>
</caption>
<graphic xlink:href="fphar-12-647124-g001.tif"/>
</fig>
</sec>
<sec id="s3-2">
<title>NEAT1 Deletion Reduces Ang II Caused Murine Cardiac Fibroblast Proliferation, Migration, and Collagen Production</title>
<p>To explore the effect of NEAT1 on atrial fibrosis, a specific shRNA against NEAT1 gene transcript was designed to knock down NEAT1 in cardiac fibroblasts, and qRT&#x2013;PCR analysis showed that the expression of NEAT1 in cardiac fibroblasts was reduced by this shRNA (<xref ref-type="fig" rid="F2">Figure&#x20;2A</xref>). We found that Ang II increased NEAT1 expression, but this effect was attenuated by NEAT1 shRNA (<xref ref-type="fig" rid="F2">Figure&#x20;2B</xref>). The CCK-8 assay showed that NEAT1 downregulation significantly repressed Ang II-induced cell proliferation compared with the shNC-transfected group (<xref ref-type="fig" rid="F2">Figure&#x20;2C</xref>). The Transwell migration assay results showed that Ang II treatment promoted the migration ability of cardiac fibroblasts, and this promotion effect was suppressed by shNEAT1 (<xref ref-type="fig" rid="F2">Figure&#x20;2D</xref>). Moreover, NEAT1 knockdown attenuated the promoted coll I and coll III expressions after Ang II treatment (<xref ref-type="fig" rid="F2">Figures 2E,F</xref>). These findings revealed that NEAT1 knockdown could inhibit Ang II caused cardiac fibroblast proliferation, migration, and collagen production.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>NEAT1 downregulation suppressed Ang II-induced cardiac fibroblast proliferation, migration, and collagen production. <bold>(A)</bold> NEAT1 expression in shNEAT1-or shNC-transfected cardiac fibroblasts was detected using qRT&#x2013;PCR. <bold>(B)</bold> NEAT1 expression was detected in Ang II-treated cardiac fibroblasts using qRT&#x2013;PCR. <bold>(C)</bold> Cell proliferation and <bold>(D)</bold> migration were determined using CCK-8 and Transwell assays <bold>(E,F)</bold> mRNA and protein expressions of coll I and coll III were measured using qRT&#x2013;PCR and western blotting. &#x2a;<italic>p</italic>&#x20;&#x3c; 0.05 vs. control group; <sup>&#x23;</sup>
<italic>p</italic>&#x20;&#x3c; 0.05 vs. Ang II/shNC group. Data represent mean&#x20;&#xb1; SD from three independent experiments.</p>
</caption>
<graphic xlink:href="fphar-12-647124-g002.tif"/>
</fig>
</sec>
<sec id="s3-3">
<title>NEAT1 Positively Regulates NPAS2 Expression Through Sponging miR-320</title>
<p>To determine the mechanisms through which NEAT1 exerts its effects on atrial fibrosis, we predicted miR-320 using relevant binding sites of NEAT1, and miR-320 interacted with NPAS2 mRNA 3&#x2b9;UTR using bioinformatics databases (<xref ref-type="fig" rid="F3">Figure&#x20;3A</xref>). Furthermore, bioinformatics analysis predicted that NEAT1 and NPAS2 mRNAs have the same binding site for miR-320 (<xref ref-type="fig" rid="F3">Figure&#x20;3A</xref>). The data of luciferase reporter assay revealed that luciferase activity was inhibited in NEAT1-WT- and miR-320 mimic-co-transfected cells but was unaffected in NEAT1-MT-transfected cells, indicating that miR-320 is a NEAT1-targeting miRNA (<xref ref-type="fig" rid="F3">Figure&#x20;3B</xref>). Co-transfection with NPAS2-WT and miR-320 mimic obviously suppressed luciferase activity, whereas the luciferase activity has no changed in co-transfection with NPAS2-MT and miR-320 mimic (<xref ref-type="fig" rid="F3">Figure&#x20;3C</xref>). Furthermore, we observed that miR-320 was downregulated in Ang II-treated cardiac fibroblasts, but both parameters were enhanced by NEAT1 deletion (<xref ref-type="fig" rid="F3">Figure&#x20;3D</xref>). Ang II-treated cardiac fibroblasts increased NPAS2 expression, but this increase was reduced by miR-320 (<xref ref-type="fig" rid="F3">Figures 3E,F</xref>). Furthermore, NEAT1 knockdown significantly suppressed NPAS2 expression in Ang II stimulated cardiac fibroblasts, and this effect was reversed by miR-320 inhibition (<xref ref-type="fig" rid="F3">Figures 3G,H</xref>). These findings revealed that NEAT1 positively regulates NPAS2 expression by sponging miR-320 in cardiac fibroblasts. NPAS2 overexpression reversed the effects of NEAT1 knockdown on Ang II-induced cardiac fibroblast proliferation, migration, and collagen production.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>NEAT1 regulated NPAS2 expression through miR-320. <bold>(A)</bold> The predicted miR-320 and NPAS2 binding sites in NEAT1 (NEAT1-WT) and the designed mutant sequence (NEAT1-MT and NPAS2-MT) were indicated. <bold>(B)</bold> The luciferase reporter assay in HEK293T&#x20;cells co-transfected with NEAT1-WT or NEAT1-MT and NC mimic or miR-320 mimic. <bold>(C)</bold> The luciferase reporter assay in HEK293T&#x20;cells co-transfected with NPAS2-WT or NPAS2-MT and NC mimic or miR-320 mimic. <bold>(D)</bold> miR-320 expression in Ang II-induced cardiac fibroblasts transfected with shNC or shNEAT1. <bold>(E,F)</bold> mRNA and protein expressions of NPAS2 in Ang II-induced cardiac fibroblasts transfected with NC mimic or miR-320 mimic. <bold>(G,H)</bold> mRNA and protein expressions of NPAS2 in Ang II-induced cardiac fibroblasts transfected with shNEAT1 or co-transfected with shNEAT1 and miR-320 inhibitor were determined. &#x2a;<italic>p</italic>&#x20;&#x3c; 0.05 vs. NC mimic group or control group; <sup>&#x23;</sup>
<italic>p</italic>&#x20;&#x3c; 0.05 vs. Ang II/shNC group; <sup>&#x26;</sup>
<italic>p</italic>&#x20;&#x3c; 0.05 vs. Ang II/shNEAT1/miR-320 inhibitor group. Data represent mean&#x20;&#xb1; SD from three independent experiments.</p>
</caption>
<graphic xlink:href="fphar-12-647124-g003.tif"/>
</fig>
<p>To determine whether NPAS2 contributes to the effect of NEAT1 on cardiac fibroblasts, Ang II treated cardiac fibroblasts were co-transfected with shNEAT1 and NPAS2. The cardiac fibroblasts viability, migratory ability, and collagen production ability in co-transfected shNEAT1 and NPAS2 cells were greater than those in cardiac fibroblasts transfected with shNEAT1 (<xref ref-type="fig" rid="F4">Figures 4A&#x2013;F</xref>). These findings indicated that NPAS2 is a functional target of NEAT1 and that NPAS2 eliminates the suppressive effect of NEAT1 inhibitors on cardiac fibroblasts.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>NPAS2 overexpression reversed the effect of NEAT1 knockdown on cardiac fibroblast proliferation, migration, and collagen production under Ang II condition. <bold>(A,B)</bold> mRNA and protein expressions of NPAS2 in cardiac fibroblasts transfected with shNEAT1 or NPAS2 or co-transfected with shNEAT1and NPAS2 under Ang II induction were detected. <bold>(C)</bold> Cell proliferation and <bold>(D)</bold> migration were determined in different groups. <bold>(E,F)</bold> mRNA and protein expressions of coll I and coll III in different groups were determined. &#x2a;<italic>p</italic>&#x20;&#x3c; 0.05 vs. Ang II group; <sup>&#x23;</sup>
<italic>p</italic>&#x20;&#x3c; 0.05 vs. Ang II/shNEAT1 group. Data represent mean&#x20;&#xb1; SD from three independent experiments.</p>
</caption>
<graphic xlink:href="fphar-12-647124-g004.tif"/>
</fig>
</sec>
<sec id="s3-4">
<title>NEAT1 Knockdown Attenuates Ang II Caused Atrial Fibrosis <italic>In Vivo</italic>
</title>
<p>We further affirmed the function of NEAT1 in atrial fibrosis through <italic>in vivo</italic> experiments. HE and Masson&#x2019;s trichrome stainings indicated a disarray of myocardial fibers, expanded nuclear spacing, and increased atrial fibrosis in the Ang II induced group, while NEAT1 deletion suppressed the Ang II caused inflammatory cell infiltration and atrial fibrosis (<xref ref-type="fig" rid="F5">Figure&#x20;5A</xref>). We found that NEAT1 and NPAS2 expressions were increased, whereas miR-320 expression was decreased in right atrial tissues from the Ang II group than those in the control group, and these expressions were reduced in the Ang II/shNEAT1 group (<xref ref-type="fig" rid="F5">Figures 5B&#x2013;E</xref>). Moreover, Ang II injection enhanced the protein expressions of coll I and coll III in right atrial tissues, whereas deletion of NEAT1 attenuated the Ang II caused collagen production (<xref ref-type="fig" rid="F5">Figure&#x20;5E</xref>).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>NEAT1 knockdown attenuates the Ang II-induced atrial fibrosis <italic>in vivo</italic>. <bold>(A)</bold> HE and Masson&#x2019;s trichrome stainings of murine right atrial tissues. <bold>(B,C)</bold> NEAT1 and miR-320 expressions in right atrial tissues from each group were detected using qRT&#x2013;PCR. <bold>(D)</bold> NPAS2 mRNA expression in right atrial tissues from each group was determined. <bold>(E)</bold> NPAS2, coll I, and coll III protein expressions in right atrial tissues from each group were detected. &#x2a;<italic>p</italic>&#x20;&#x3c; 0.05 vs. control group; <sup>&#x23;</sup>
<italic>p</italic>&#x20;&#x3c; 0.05 vs. Ang II/shNC group. Data represent mean&#x20;&#xb1; SD from three independent experiments.</p>
</caption>
<graphic xlink:href="fphar-12-647124-g005.tif"/>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>Despite a mass of evidence demonstrated the function of atrial fibrosis in AF (<xref ref-type="bibr" rid="B26">Xu et&#x20;al., 2018</xref>), data on fibrotic processes in AF are limited. Here, we showed that NEAT1 was increased and positively related to coll I and coll III levels in right atrial tissues of patients with AF. NEAT1 knockdown reduced Ang II caused cardiac fibroblast proliferation, migration, and collagen production <italic>in&#x20;vitro</italic> and attenuated Ang II caused murine atrial fibrosis <italic>in vivo</italic>. Moreover, we demonstrated that NEAT1 exerted its effects by functioning as a miR-320 ceRNA to modulate NPAS2&#x20;level.</p>
<p>Increasing evidence has revealed that atrial fibrosis contributes to the pathological process of AF and that atrial fibrosis suppression could be a reasonable approach for AF prevention and treatment (<xref ref-type="bibr" rid="B2">Chang et&#x20;al., 2017</xref>). Recent research has shown that lncRNA NEAT1 is participated in the pathogenesis of different diseases, including fibrosis. NEAT1 is upregulated in CCl4 caused liver fibrosis, and it accelerates liver fibrosis progression (<xref ref-type="bibr" rid="B31">Yu et&#x20;al., 2017</xref>; <xref ref-type="bibr" rid="B15">Kong et&#x20;al., 2019</xref>); NEAT1 knockdown in HK2 cells inhibited the renal fibrosis-related markers TGF-&#x3b2;1 and CTGF (<xref ref-type="bibr" rid="B30">Yang et&#x20;al., 2020</xref>). Furthermore, NEAT1 is indispensable for fibroblast and cardiomyocyte survival and affects fibroblast functions (<xref ref-type="bibr" rid="B14">Kenneweg et&#x20;al., 2019</xref>). We speculated that NEAT1 contributes to atrial fibrosis. Here we observed that NEAT1 expression was increased and was positively related to coll I and coll III levels in the right atrial tissues of patients with AF. Cardiac fibroblast proliferation, migration, and differentiation play key roles in the pathogenesis of atrial fibrosis and structural remodeling in AF patients (<xref ref-type="bibr" rid="B18">Porter and Turner, 2009</xref>; <xref ref-type="bibr" rid="B26">Xu et&#x20;al., 2018</xref>). Here a cell model of atrial fibrosis was achieved in Ang II-induced atrial fibroblasts. We found that Ang II enhanced NEAT1, coll I and coll III levels and promoted cardiac fibroblast proliferation and migration, whereas these effects were reduced by NEAT1 knockdown. We further confirmed this result in an Ang II induced atrial fibrosis mouse&#x20;model.</p>
<p>Several existing studies have indicated that lncRNAs participate in the ceRNAs regulatory network to negatively regulate the miRNAs expression (<xref ref-type="bibr" rid="B27">Yan et&#x20;al., 2018</xref>), such as NEAT1. For instance, NEAT1 functions as a sponge for miR-365a-3p to facilitate gastric cancer progression through targeting ABCC4 (<xref ref-type="bibr" rid="B8">Gao et&#x20;al., 2020</xref>); furthermore, NEAT1 sponges miR-129 to regulate renal fibrosis via modulating coll I (<xref ref-type="bibr" rid="B16">Li et&#x20;al., 2020</xref>). To determine the mechanism of NEAT1 regulation in AF, we performed bioinformatics databases and discovered that NEAT1 shared miR-320 response element with NPAS2. Several studies have shown that miR-320 is associated with heart-related diseases. For example, miR-320 participates in the cardioprotective effect of insulin against myocardial ischemia via downregulating survivin (<xref ref-type="bibr" rid="B28">Yang et&#x20;al., 2018</xref>). The protective effect of miR-320 has also been shown in ventricular remodeling after myocardial ischemia&#x2013;reperfusion injury (<xref ref-type="bibr" rid="B23">Song et&#x20;al., 2014</xref>). Importantly, exosomal miR-320 derived from adipose tissue-derived mesenchymal stem cells suppresses apoptosis of cardiomyocytes in AF patients (<xref ref-type="bibr" rid="B17">Liu et&#x20;al., 2019</xref>). Our study demonstrated that Ang II decreased miR-320 expression, whereas NEAT1 knockdown increased it. NPAS2-deficient fibroblasts expedite skin wound healing and dermal collagen reconstruction (<xref ref-type="bibr" rid="B20">Sasaki et&#x20;al., 2020</xref>), and NPAS2 promotes liver fibrosis via direct transcriptional activation of Hes1 in hepatic stellate cells (<xref ref-type="bibr" rid="B29">Yang et&#x20;al., 2019</xref>). In our study, we demonstrated that miR-320 overexpression suppressed NPAS2 expression and miR-320 inhibition reversed the suppressive effect of shNEAT1 on NPAS2 expression. Moreover, we determined that NPAS2 overexpression reversed the effects of NEAT1 knockdown on Ang II caused murine cardiac fibroblast proliferation, migration, and collagen production.</p>
<p>In conclusion, our research provides evidence that NEAT1 knockdown inhibits cardiac fibroblast proliferation, migration, and collagen production as well as mice atrial fibrosis via regulating the miR-320&#x2013;NPAS2 axis, suggesting that NEAT1 is a novel molecular target for AF treatment.</p>
</sec>
</body>
<back>
<sec id="s5">
<title>Data Availability Statement</title>
<p>The raw data supporting the conclusion of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6">
<title>Ethics Statement</title>
<p>All patients signed an informed consent document for diagnosis and research on tissue specimens before being enrolled in the project. All subjects gave written informed consent in accordance with the Declaration of Helsinki principles. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by the Institutional Animal Care and Use Committee of Shanghai Chest Hospital, Shanghai Jiao Tong University.</p>
</sec>
<sec id="s7">
<title>Author Contributions</title>
<p>YZ and LZ contributed to the experiment design. HD, NZ and HL performed the experiments and analyzed the data. YZ contributed to manuscript draft, evised the manuscript and provided technical support. All authors read and approved the final manuscript.</p>
</sec>
<sec id="s8">
<title>Funding</title>
<p>This study was supported by &#x201c;Science and technology innovation action plan&#x201d; project of Shanghai Science and Technology Commission (No.18511107704).</p>
</sec>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>W.-m.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Q.-y.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>LncRNA PVT1 regulates atrial fibrosis via miR-128-3p-SP1-TGF-&#x3b2;1-Smad axis in atrial fibrillation</article-title>. <source>Mol. Med.</source> <volume>25</volume> (<issue>1</issue>), <fpage>7</fpage>. <pub-id pub-id-type="doi">10.1186/s10020-019-0074-5</pub-id> </citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>S.-H.</given-names>
</name>
<name>
<surname>Yeh</surname>
<given-names>Y.-H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>J.-L.</given-names>
</name>
<name>
<surname>Hsu</surname>
<given-names>Y.-J.</given-names>
</name>
<name>
<surname>Kuo</surname>
<given-names>C.-T.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.-J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Transforming growth factor-&#x3b2;-mediated CD44/STAT3 signaling contributes to the development of atrial fibrosis and fibrillation</article-title>. <source>Basic Res. Cardiol.</source> <volume>112</volume> (<issue>5</issue>), <fpage>58</fpage>. <pub-id pub-id-type="doi">10.1007/s00395-017-0647-9</pub-id> </citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chiang</surname>
<given-names>D. Y.</given-names>
</name>
<name>
<surname>Kongchan</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Beavers</surname>
<given-names>D. L.</given-names>
</name>
<name>
<surname>Alsina</surname>
<given-names>K. M.</given-names>
</name>
<name>
<surname>Voigt</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Neilson</surname>
<given-names>J.&#x20;R.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Loss of microRNA-106b-25 cluster promotes atrial fibrillation by enhancing ryanodine receptor type-2 expression and calcium release</article-title>. <source>Circ. Arrhythm Electrophysiol.</source> <volume>7</volume> (<issue>6</issue>), <fpage>1214</fpage>&#x2013;<lpage>1222</lpage>. <pub-id pub-id-type="doi">10.1161/CIRCEP.114.001973</pub-id> </citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Choudhury</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Boyett</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Morris</surname>
<given-names>G. M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Biology of the sinus node and its disease</article-title>. <source>Arrhythm Electrophysiol. Rev.</source> <volume>4</volume> (<issue>1</issue>), <fpage>28</fpage>&#x2013;<lpage>34</lpage>. <pub-id pub-id-type="doi">10.15420/aer.2015.4.1.28</pub-id> </citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corradi</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Atrial fibrillation from the pathologist&#x27;s perspective</article-title>. <source>Cardiovasc. Pathol.</source> <volume>23</volume> (<issue>2</issue>), <fpage>71</fpage>&#x2013;<lpage>84</lpage>. <pub-id pub-id-type="doi">10.1016/j.carpath.2013.12.001</pub-id> </citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dzeshka</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Lip</surname>
<given-names>G. Y. H.</given-names>
</name>
<name>
<surname>Snezhitskiy</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Shantsila</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Cardiac fibrosis in patients with atrial fibrillation</article-title>. <source>J.&#x20;Am. Coll. Cardiol.</source> <volume>66</volume> (<issue>8</issue>), <fpage>943</fpage>&#x2013;<lpage>959</lpage>. <pub-id pub-id-type="doi">10.1016/j.jacc.2015.06.1313</pub-id> </citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eckel-Mahan</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sassone-Corsi</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Metabolism and the circadian clock converge</article-title>. <source>Physiol. Rev.</source> <volume>93</volume> (<issue>1</issue>), <fpage>107</fpage>&#x2013;<lpage>135</lpage>. <pub-id pub-id-type="doi">10.1152/physrev.00016.2012</pub-id> </citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Long non-coding RNA NEAT1 serves as sponge for miR-365a-3p to promote gastric cancer progression via regulating ABCC4</article-title>. <source>Ott</source> <volume>13</volume>, <fpage>3977</fpage>&#x2013;<lpage>3985</lpage>. <pub-id pub-id-type="doi">10.2147/OTT.S245557</pub-id> </citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goetze</surname>
<given-names>J.&#x20;P.</given-names>
</name>
<name>
<surname>Georg</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>J&#xf8;rgensen</surname>
<given-names>H. L.</given-names>
</name>
<name>
<surname>Fahrenkrug</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Chamber-dependent circadian expression of cardiac natriuretic peptides</article-title>. <source>Regul. Peptides</source> <volume>160</volume> (<issue>1-3</issue>), <fpage>140</fpage>&#x2013;<lpage>145</lpage>. <pub-id pub-id-type="doi">10.1016/j.regpep.2009.12.010</pub-id> </citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ge</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Long noncoding RNA NEAT1 accelerates the proliferation and fibrosis in diabetic nephropathy through activating Akt/mTOR signaling pathway</article-title>. <source>J.&#x20;Cel Physiol</source> <volume>234</volume> (<issue>7</issue>), <fpage>11200</fpage>&#x2013;<lpage>11207</lpage>. <pub-id pub-id-type="doi">10.1002/jcp.27770</pub-id> </citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hurley</surname>
<given-names>J.&#x20;M.</given-names>
</name>
<name>
<surname>Loros</surname>
<given-names>J.&#x20;J.</given-names>
</name>
<name>
<surname>Dunlap</surname>
<given-names>J.&#x20;C.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Circadian oscillators: around the transcription-translation feedback loop and on to output</article-title>. <source>Trends Biochem. Sci.</source> <volume>41</volume> (<issue>10</issue>), <fpage>834</fpage>&#x2013;<lpage>846</lpage>. <pub-id pub-id-type="doi">10.1016/j.tibs.2016.07.009</pub-id> </citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>LINC01426 contributes to clear cell renal cell carcinoma progression by modulating CTBP1/miR&#x2010;423&#x2010;5p/FOXM1 axis via interacting with IGF2BP1</article-title>. <source>J.&#x20;Cel Physiol</source> <volume>236</volume>, <fpage>427</fpage>. <pub-id pub-id-type="doi">10.1002/jcp.29871</pub-id> </citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>X. F.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.&#x20;Z.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Guan</surname>
<given-names>H. Q.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>lncRNA NEAT1 regulates fibrosis and inflammatory response induced by nonalcoholic fatty liver by regulating miR-506/GLI3</article-title>. <source>Eur. Cytokine Netw.</source> <volume>30</volume> (<issue>3</issue>), <fpage>98</fpage>&#x2013;<lpage>106</lpage>. <pub-id pub-id-type="doi">10.1684/ecn.2019.0432</pub-id> </citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kenneweg</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Bang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Boulanger</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Loyer</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Mazlan</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Long noncoding RNA-enriched vesicles secreted by hypoxic cardiomyocytes drive cardiac fibrosis</article-title>. <source>Mol. Ther. - Nucleic Acids</source> <volume>18</volume>, <fpage>363</fpage>&#x2013;<lpage>374</lpage>. <pub-id pub-id-type="doi">10.1016/j.omtn.2019.09.003</pub-id> </citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kong</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>The lncRNA NEAT1/miR-29b/Atg9a axis regulates IGFBPrP1-induced autophagy and activation of mouse hepatic stellate cells</article-title>. <source>Life Sci.</source> <volume>237</volume>, <fpage>116902</fpage>. <pub-id pub-id-type="doi">10.1016/j.lfs.2019.116902</pub-id> </citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.-F.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.-X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>C.-Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Long noncoding RNA NEAT1 sponges miR-129 to modulate renal fibrosis by regulation of collagen type I</article-title>. <source>Am. J.&#x20;Physiology-Renal Physiol.</source> <volume>319</volume>, <fpage>F93</fpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00552.2019</pub-id> </citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Mao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Exosomal miR-320d derived from adipose tissue-derived MSCs inhibits apoptosis in cardiomyocytes with atrial fibrillation (AF)</article-title>. <source>Artif. Cell Nanomedicine, Biotechnol.</source> <volume>47</volume> (<issue>1</issue>), <fpage>3976</fpage>&#x2013;<lpage>3984</lpage>. <pub-id pub-id-type="doi">10.1080/21691401.2019.1671432</pub-id> </citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Porter</surname>
<given-names>K. E.</given-names>
</name>
<name>
<surname>Turner</surname>
<given-names>N. A.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Cardiac fibroblasts: at the heart of myocardial remodeling</article-title>. <source>Pharmacol. Ther.</source> <volume>123</volume> (<issue>2</issue>), <fpage>255</fpage>&#x2013;<lpage>278</lpage>. <pub-id pub-id-type="doi">10.1016/j.pharmthera.2009.05.002</pub-id> </citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qin</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>LncRNA FENDRR represses proliferation, migration and invasion through suppression of survivin in cholangiocarcinoma cells</article-title>. <source>Cell Cycle</source> <volume>18</volume> (<issue>8</issue>), <fpage>889</fpage>&#x2013;<lpage>897</lpage>. <pub-id pub-id-type="doi">10.1080/15384101.2019.1598726</pub-id> </citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sasaki</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Hokugo</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Morinaga</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ngo</surname>
<given-names>J.&#x20;T.</given-names>
</name>
<name>
<surname>Okawa</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Neuronal PAS domain 2 ( Npas2 )&#x2010;Deficient fibroblasts accelerate skin wound healing and dermal collagen reconstruction</article-title>. <source>Anat. Rec.</source> <volume>303</volume> (<issue>6</issue>), <fpage>1630</fpage>&#x2013;<lpage>1641</lpage>. <pub-id pub-id-type="doi">10.1002/ar.24109</pub-id> </citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shen</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Kong</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Shuai</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>YY1-induced upregulation of lncRNA KCNQ1OT1 regulates angiotensin II-induced atrial fibrillation by modulating miR-384b/CACNA1C axis</article-title>. <source>Biochem. Biophysical Res. Commun.</source> <volume>505</volume> (<issue>1</issue>), <fpage>134</fpage>&#x2013;<lpage>140</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2018.09.064</pub-id> </citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shen</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>LncRNA SNHG5 regulates cell apoptosis and inflammation by miR-132/PTEN axis in COPD</article-title>. <source>Biomed. Pharmacother.</source> <volume>126</volume>, <fpage>110016</fpage>. <pub-id pub-id-type="doi">10.1016/j.biopha.2020.110016</pub-id> </citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>C.-L.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Diao</surname>
<given-names>H.-Y.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Y.-F.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.-X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.-C.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>The protective effect of microRNA-320 on left ventricular remodeling after myocardial ischemia-reperfusion injury in the rat model</article-title>. <source>Ijms</source> <volume>15</volume> (<issue>10</issue>), <fpage>17442</fpage>&#x2013;<lpage>17456</lpage>. <pub-id pub-id-type="doi">10.3390/ijms151017442</pub-id> </citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Ge</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>LncRNA NRON alleviates atrial fibrosis via promoting NFATc3 phosphorylation</article-title>. <source>Mol. Cel Biochem</source> <volume>457</volume> (<issue>1-2</issue>), <fpage>169</fpage>&#x2013;<lpage>177</lpage>. <pub-id pub-id-type="doi">10.1007/s11010-019-03521-y</pub-id> </citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Jing</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Upregulated level of lncRNA HOXA-AS2 in peripheral blood of systemic lupus erythematosus patients aggravates disease progression via ERK pathway</article-title>. <source>Minerva Med.</source> <pub-id pub-id-type="doi">10.23736/S0026-4806.19.06361-4</pub-id> </citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Qi</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Micro RNA &#x2010;30c suppresses the pro&#x2010;fibrogenic effects of cardiac fibroblasts induced by TGF &#x2010;&#x3b2;1 and prevents atrial fibrosis by targeting TGF &#x3b2; RII</article-title>. <source>J.&#x20;Cel Mol Med</source> <volume>22</volume> (<issue>6</issue>), <fpage>3045</fpage>&#x2013;<lpage>3057</lpage>. <pub-id pub-id-type="doi">10.1111/jcmm.13548</pub-id> </citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Q.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Long noncoding RNA MIR31HG inhibits hepatocellular carcinoma proliferation and metastasis by sponging microRNA-575 to modulate ST7L expression</article-title>. <source>J.&#x20;Exp. Clin. Cancer Res.</source> <volume>37</volume> (<issue>1</issue>), <fpage>214</fpage>. <pub-id pub-id-type="doi">10.1186/s13046-018-0853-9</pub-id> </citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zou</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>MicroRNA-320 involves in the cardioprotective effect of insulin against myocardial ischemia by targeting survivin</article-title>. <source>Cell Biochem Funct</source> <volume>36</volume> (<issue>3</issue>), <fpage>166</fpage>&#x2013;<lpage>171</lpage>. <pub-id pub-id-type="doi">10.1002/cbf.3328</pub-id> </citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>NPAS2 contributes to liver fibrosis by direct transcriptional activation of Hes1 in hepatic stellate cells</article-title>. <source>Mol. Ther. - Nucleic Acids</source> <volume>18</volume>, <fpage>1009</fpage>&#x2013;<lpage>1022</lpage>. <pub-id pub-id-type="doi">10.1016/j.omtn.2019.10.025</pub-id> </citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>Y.-L.</given-names>
</name>
<name>
<surname>Xue</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Jia</surname>
<given-names>Y.-J.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>Z.-J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Long noncoding RNA NEAT1 is involved in the protective effect of Klotho on renal tubular epithelial cells in diabetic kidney disease through the ERK1/2 signaling pathway</article-title>. <source>Exp. Mol. Med.</source> <volume>52</volume> (<issue>2</issue>), <fpage>266</fpage>&#x2013;<lpage>280</lpage>. <pub-id pub-id-type="doi">10.1038/s12276-020-0381-5</pub-id> </citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>NEAT1 accelerates the progression of liver fibrosis via regulation of microRNA-122 and Kruppel-like factor 6</article-title>. <source>J.&#x20;Mol. Med.</source> <volume>95</volume> (<issue>11</issue>), <fpage>1191</fpage>&#x2013;<lpage>1202</lpage>. <pub-id pub-id-type="doi">10.1007/s00109-017-1586-5</pub-id> </citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ge</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>LncRNA ANRIL acts as a modular scaffold of WDR5 and HDAC3 complexes and promotes alteration of the vascular smooth muscle cell phenotype</article-title>. <source>Cell Death Dis</source> <volume>11</volume> (<issue>6</issue>), <fpage>435</fpage>. <pub-id pub-id-type="doi">10.1038/s41419-020-2645-3</pub-id> </citation>
</ref>
</ref-list>
</back>
</article>
