AUTHOR=Elgendy Azza M. , Mohamed Amr A. , Duvic Bernard , Tufail Muhammad , Takeda Makio 

TITLE=Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana

JOURNAL=Frontiers in Physiology

VOLUME=Volume 12 - 2021

YEAR=2021

URL=https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2021.723072

DOI=10.3389/fphys.2021.723072

ISSN=1664-042X

ABSTRACT=<p>Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the <italic>Periplaneta americana Vitellogenin 2</italic> (<italic>Vg2</italic>) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp <italic>Vg2</italic> promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as <italic>Vg2</italic>RE (<sup>−168</sup>GAGTCACGGAGTCGCCGCTG<sup>−149</sup>). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in <italic>Vg2</italic>RE for binding the isolated fat body nuclear protein. In <italic>Sf</italic>9 cells, a luciferase reporter placed under the control of a minimal promoter containing <italic>Vg2</italic>RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to <italic>Vg2</italic>RE, and this binding was outcompeted by a 50-fold excess of cold <italic>Drosophila melanogaster</italic> DR4 and <italic>Galleria mellonella</italic> JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe <italic>Vg2</italic>RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.</p>