Abstract
Background:
Mechanical ventilation (MV) is used to improve gas exchange but can exacerbate lung inflammation by increasing alveolar cell stretch, leading to ventilator-induced lung injury (VILI). Alveolar epithelial stretching promotes cytokine release, but its effects on glucose uptake remain unclear. In vitro studies suggest that high tidal volume ventilation corresponds to cyclic stretch levels of approximately 18%, whereas larger deformations represent supraphysiological and injurious conditions. Therefore, 30% cyclic stretch was used to reproduce severe alveolar deformation associated with volutrauma. We investigated the modulation of inflammation and glucose uptake in alveolar epithelial type II cells exposed to excessive cyclic stretch. We hypothesized that cells exposed to an overstretch of 30% at 1 and 4 hours would increase glucose uptake and pro-inflammatory responses.
Methods:
Rat alveolar epithelial type II cells (L2 AECs) treated and untreated with lipopolysaccharide (LPS) were exposed to 1 or 4 hours of 30% cyclic stretch. Non-stretched cells, stimulated or not with LPS, served as a control. Glucose oxidase activity was measured using a colorimetric/fluorometric assay, while glucose uptake was assessed by immunofluorescence using the fluorescent glucose analog 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxyglucose (2-NBDG). Gene expression and secretion were measured by real-time polymerase chain reaction (RT-qPCR) and enzyme-linked immunosorbent assay (ELISA), respectively. Statistical analyses were performed using one-way ANOVA followed by Šidák’s multiple comparisons test, with significance set at p < 0.05.
Results:
30% cyclic stretch significantly increased glucose uptake and glucose oxidase activity in both LPS-treated and untreated cells. Inflammatory gene expression and mediator secretion were predominantly increased in LPS-primed cells, although the effects varied according to the marker and time point.
Conclusions:
Overall, excessive cyclic stretch increased the glucose-related readouts assessed in AECs L2 cells, whereas inflammatory responses were more strongly influenced by LPS stimulation and varied among mediators and time points.
1 Introduction
Mechanical ventilation (MV) is a life-saving therapy that aims to maintain adequate gas exchange and to reduce the work of breathing in intensive care patients. However, MV can damage the lungs or initiate lung injury, known as ventilator-induced lung injury (VILI) (; ; ; ). In vivo and in vitro studies have shown that excessive stretching of alveolar epithelial cells (AECs) can promote the expression and release of cytokines and other pro-inflammatory mediators, contributing to biotrauma (; ; ; ; ). These processes contribute to the cascade of cellular and biochemical events involved in the pathogenesis of acute respiratory distress syndrome (ARDS) ().
Alveolar epithelial type II cells, located on the alveolar wall, are essential for maintaining alveolar integrity and contribute to inflammatory responses within the alveolar epithelium (; ; ). Mechanical stretch can increase the expression of pro-inflammatory mediators in these cells in vitro (). However, considerably less is known about how excessive mechanical stretch affects glucose-related cellular responses and whether these responses are associated with inflammatory activation. Increased cellular glucose uptake may reflect the energetic requirements of cytoskeletal remodeling, maintenance of epithelial barrier function, transcriptional activation, protein synthesis, and inflammatory mediator production during mechanical stress. In addition, pulmonary uptake of the glucose analogue, 18F-FDG has been used to assess metabolically active inflammatory lung tissue. However, 18F-FDG uptake reflects the combined metabolic activity of multiple cell populations, including neutrophils, macrophages, endothelial cells, and epithelial cells. Therefore, it remains unclear whether increased glucose uptake by mechanically stretched alveolar epithelial cells directly reflects inflammatory activation or represents an independent metabolic response. A cyclic stretch magnitude of 30% was selected as an experimental model of severe alveolar overdistension. Physiological breathing produces relatively small changes in alveolar epithelial surface area, whereas high tidal volumes during mechanical ventilation are associated with excessive alveolar deformation, volutrauma, inflammatory signaling, and VILI. In vitro studies further suggest that high tidal volume ventilation corresponds to cyclic stretch levels of approximately 18%, whereas larger deformations above this range represent supraphysiological and injurious conditions. Thus, 30% cyclic stretch was used to model severe mechanical deformation above the range associated with injurious ventilation (; ; ; ). (; ; ) and (; ) While our previous study investigated the contribution of static pre-stretch combined with dynamic stretch to inflammatory responses in L2 alveolar epithelial cells, the present study addresses a distinct question by assessing two glucose-related readouts, 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxyglucose (2-NBDG) uptake and glucose oxidase activity, in parallel with inflammatory gene expression and mediator secretion under 30% cyclic stretch. These glucose-related measurements represent distinct experimental readouts and were not considered interchangeable. We hypothesized that exposure to 30% cyclic stretch for 1 and 4 hours would increase 2-NBDG uptake and alter inflammatory responses in alveolar epithelial type II cells, and we examined the patterns of these glucose-related and inflammatory responses across experimental conditions and time points.
2 Materials and methods
2.1 Cell culture preparation
L2 AECs (ATCC L2 cell line, CCL-149™) from rats, were grown until confluent on BioFlex six-well Collagen I coated plates (Flexcell International Corporation, Burlington, NC, United States) at a density of 1,3 x 105 cells/well, in Dulbecco’s modified Eagle medium (DMEM, with High Glucose, L-glutamine, Phenol Red and Sodium Pyruvate, Gibco, # 11995073) supplemented with 10% fetal bovine serum (FBS, Gibco) and 50 μg/mL gentamycin sulfate (Gibco, # 15710049). Cells were incubated at 37 °C, at 6.5% CO2 for 24 hours. Cells were washed twice with sterile phosphate buffered saline (PBS) and incubated with DMEM (without Phenol Red, Merck Sigma-Aldrich, #D1145) containing 1% FBS, 50 µg gentamycin sulfate/mL, 4 mM L-alanyl-L-glutamine (Merck Sigma-Aldrich, # G8541), and 1mM Sodium Pyruvate (Gibco, # 11360070. Moreover, before the stretch experiments, cells were preincubated for 1 h with 2 µg/ml LPS (Escherichia coli O111:B4, SIGMA-Aldrich, St. Louis, USA).
2.2 Customized stretching device
The customized stretching device was used as described in previous studies (; ; ). Briefly, three cylindrical indenters applied homogeneous stretch to three membranes of a six-well BioFlex Culture Plate (Flexcell International Corporation, Hillsborough, USA), while the remaining three wells served as non-stretched controls. Vertical movement of the indenters was generated by a stepper motor (Maxon Motor AG, Sachseln, Switzerland). A custom LabVIEW program (National Instruments, Austin, TX, USA) was used to control the stepper motor and adjust the stretch duration, frequency, and amplitude (; ). The stretch group was exposed to 30% strain at a frequency of 0.5 Hz with a stretch/relaxation ratio of 1:1 (sinusoidal pattern) for 1 and 4 hours, Supplementary Figure 1.
2.3 Cell viability assay
Cell viability was assessed by measuring lactate dehydrogenase (LDH) activity in the culture supernatant using the Cytotoxicity Detection Kit Plus (Roche, Mannheim, Germany), according to the manufacturer’s instructions and as previously described (; ).
2.4 Glucose oxidase activity colorimetric/fluorometric assay kit
Glucose oxidase activity was measured using a BioVision assay kit (K788–100 CA, USA). Cells were homogenized by 100 - 200 μl of the glucose oxidase (GOx) Assay Buffer and centrifuged at 13,000g for 10 min to remove the insoluble material. Through 96 well plate, 1μl sample per well was added, and adjusted with a final volume of 50 μl of GOx Assay Buffer. A positive control was prepared in parallel, with 2μl of the GOx positive control sample (1 vial) and 50 μl of the GOx Assay Buffer. The reaction mix (GOx Assay Buffer 36 μl, GOx Developer 2 μl, OxiRed™ Probe 2 μl, GOx Substrate 10 μl) was prepared and added to each well. Plate was incubated for 5 min at 37 °C and measured the fluorescence (OD 570 nm) with a fluorescence reader (BioTeK, Bad Friedrichshall, Germany) at different period times (5 min, 17 min, 47 min, 1 h, and 2 hours).
2.5 RNA extraction
Total RNA was extracted with a peqGOLD Total RNA Kit (VWR, Dresden, Germany) and reverse transcribed with the qScript cDNA SuperMix (Beverly, USA). In both cases, according to the manufacturer’s instructions (; ). RNA concentrations were evaluated using a spectrophotometer, and the purity was assessed based on the ratio of absorbance at 260 nm and 280 nm (A260–A280).
2.6 Gene expression
Gene expression of amphiregulin (AREG), interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), and macrophage inflammatory protein-2 (MIP-2) was analyzed by quantitative real-time polymerase chain reaction (qRT-PCR), as previously described in previous publications (; ). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hypoxanthine-guanine phosphoribosyltransferase (HPRT) were used as housekeeping genes.
qRT-PCR was performed using, PerfeCTa SYBR Green FastMix (Quantabio, Beverly, MA, United States, # 95071) (). The primers (Eurofins Genomics, Ebersberg, Germany) used are listed in Table 1 below. qRT-PCRs was performed on the PCR MyIQ™ 2 Cycler (Biorad, Kabelsketal, Germany), with the IQ 5 software (version: 2.1.97.1001) with triplicate cDNA samples under the following conditions: 95 °C for 30 sec, followed by 45 cycles at 95 °C for 5 seconds, 58 °C for 15 seconds, and extension at 68 °C for 10 min ().
Table 1
| Primers | Sequence (5’-3’) | Length of cDNA product | Transcript number in Ensembl |
|---|---|---|---|
| GAPDHs GAPDHas | AACTTTGGCATCGTGGAAGGGCT ACCAGTGGATGCAGGGATGATGT | 138 bp | ENSRNOT00000050443 |
| HPRTs HPRTas | TTTCCTTGGTCAAGCAGTACAGCCC TGGCCTGTATCCAACACTTCGAGA | 89 bp | ENSRNOT00000045153 |
| IL-6s IL-6as | GACAAAGCCAG GTCATTCAGAG TTGGATGGTCTTGGTCCTTAGCC | 165 bp | ENSRNOG00000010278 |
| AREGs AREGas | AAGAATCCGTGGCCGCCAAGTTT TTTCTCCACACCGTTCGCCAAAGT | 124 bp | ENSRNOG0000002754 |
| MIP-2s MIP-2as | AGAACATCCAGAGCTTGACGGTG GGGCTTCAGGGTTGAGACAAACT | 108 bp | ENSRNOG00000002792 |
| MCP-1s MCP-1as | ATGATCCCAATGAGTCGGCTGGAG GCACAGATCTCTCTCTTGAGCTTG | 104 bp | NSRNOT00000007159 |
Primers used for the quantitative polymerase chain reaction (qPCR) method.
2.7 Cytokine and chemokine determination
Cell culture supernatants were centrifuged at 1000 g for 5 min to remove the cell debris. Concentration of IL-6, IL-10, TNF-alpha, MCP-1, and MIP-2 protein levels from the cell culture supernatants was quantified by available commercial enzyme-linked immunosorbent assay (ELISA) kits (Thermo Scientific; Invitrogen, Darmstadt, Germany) according to the manufacturer´s instructions.
2.8 Glucose uptake 2-NBDG assay
Glucose uptake assay was carried out using the 2-NBDG glucose uptake assay kit (K682–50 BioVision, CA, USA). A negative control was prepared with cells treated with a test compound or a control vehicle (Phloretin 1x) with 400 μl cell culture medium with 0.5% FBS at a period of 8-12h. Then, cells were incubated at 37 °C with 6.5% CO2 for 1 h. Glucose uptake mix was prepared with 376 μl of cell culture medium (0.5% FBS), 4 μl of 2-NBDG reagent, and 20 μl of glucose uptake enhancer and, was later added to the cells. Cells were incubated for 30 min at 37°C with 6.5% CO2 and later kept on ice.
2.9 Immunostaining and microscopy
To examine the effects of glucose uptake in AECs L2 subjected to 30% cyclic stretching, cells were washed with PBS (2 x 3 min). Cells were washed twice with ice-cold PBS and fixed with 4% paraformaldehyde (PFA) on ice for 5 min. PFA was washed away twice with PBS (2 x 3 min), and cells were permeabilized with ice-cold 0.1% (v/v) Triton X-100 at room temperature for 5 min. Then, cells were blocked with 3% (w/v) bovine serum albumin source in PBS (20–30 min, RT). Afterward, cells were washed with PBS (2 x 3 min), and incubated at room temperature with 4’,6-diamidino-2-phenylindole (DAPI, 1:200, Merck Sigma-Aldrich, # D-9542) at room temperature for 30 min. The stained cells attached to the silicone membranes were cut off the plates and mounted inverted on slides using the anti-fade mounting reagent (MOWIOL, Calbiochem, # 475904).
Cells were imaged using an Olympus SD-OSR Spinning Disc Confocal Microscope equipped with a 60x numerical aperture N.A. = 1.4 oil DIC objective (Carl Zeiss Microimaging, Jena, Germany) at the Imaging Facility Medical Theoretical Center (MTZ), at University Technical Dresden. Z-stacks were acquired with 1 µm or 3µm intervals between consecutive focal planes. Images were analyzed, processed, and quantified with ImageJ (National Institutes of Health, USA) and Adobe Acrobat Photoshop® 2022 (Adobe, USA. The 3D renditions were obtained from 1µm Z-sections using the ImageJ 3D Viewer plugin (volume view) (; ; ).
2.10 Statistical analysis
Data are presented as mean ± standard deviation (SD) from at least three or four independent experiments. Comparisons among the groups were conducted with a one-way ANOVA for the factors condition (non-Stretch, LPS, Stretch, and LPS+Stretch) followed by a Šidák post-test. Analyses were conducted using GraphPad Prism version 10.4.1 (GraphPad Software Inc., USA). Statistical significance was defined as p < 0.05.
Correlation between glucose uptake and inflammatory markers was assessed using condition medians for Control, Stretch, LPS, and LPS+Stretch groups at 1 h and 4 hrs. Analyses were organized into predefined blocks including No LPS (Control + Stretch), +LPS (LPS + LPS+Stretch), Stretch vs Control, Stretch only, and all conditions pooled. Correlations were calculated between glucose uptake and inflammatory markers measured by RT-qPCR (AREG, IL-6, MCP-1, and MIP-2) and ELISA (IL-6, IL-10, TNF-α, MCP-1, and MIP-2). Both Pearson and Spearman correlation coefficients were computed. Because several block comparisons contained small sample sizes, exact two-sided permutation tests were used to calculate p values. Correlations were considered statistically significant at p < 0.05. Correlation analyses were performed using Python 3.11 with NumPy 1.26, Pandas 2.x, SciPy 1.11, Matplotlib 3.8, and OpenPyXL 3.1.
3 Results
3.1 Cell viability under 30% stretch cells
Exposure of L2 alveolar epithelial cells to 30% cyclic stretch for 1 or 4 hours did not affect cell viability, as assessed by lactate dehydrogenase (LDH) release. (Figure 1).
Figure 1
3.2 Effect of glucose oxidase activity under stretched cells
As shown in Figure 2, exposure to 30% cyclic stretch for 1 and 4 hours significantly increased glucose oxidase activity in L2 AECs, both in the presence and absence of lipopolysaccharide, compared with non-stretched controls. Data are presented as n = 4 per group.
Figure 2
In cells under an excessive 30% stretch without LPS, glucose oxidase levels increased at 1 h (p = 0.0356) and 4 h (p = 0.0019) compared with non-stretched, non-LPS controls. In addition, LPS-treated cells under 30% stretch for 4 h showed higher levels (p = 0.0007) than LPS-treated, non-stretched cells.
3.3 Gene expression in L2 cells under stretch 30% and pro-inflammatory cytokines
LPS-stimulated L2 AECs under stretch, AREG expression increased significantly (p = 0.0004) at 1 h and 4 hours (p = 0.0154) compared with cells treated with LPS and non-stretched, Figures 2A, E.
At 1 h, IL-6 and MIP-2 expression were also higher in stretched LPS-treated cells than in LPS-treated non-stretched controls (p = 0.00295 and p = 0.00453, respectively; Figures 3B–D) or in cells without LPS non-stretched controls (p = 0.0030 and p = 0.0083). At 4 h, IL-6, MCP-1, and MIP-2 were significantly increased in stretched LPS-treated cells compared with non-stretched, non-LPS cells (p = 0.0074, p = 0.0378, and p < 0.0001, respectively; Figures 3E–H).
Figure 3
3.4 Protein expression during the stretch
LPS-treated L2 AECs exposed to 30% stretch for 1 h showed significantly increased secretion of IL-6, MCP-1, and MIP-2 (p = 0.0103, p = 0.0057, and p = 0.0449, respectively) compared with LPS-treated non-stretched controls. In contrast, no significant changes in IL-10 or TNF-α were observed in cells with or without LPS under 30% stretch at 1 h (Figures 4A–E).
Figure 4
At 4 hours, secretion of IL-6, TNF-α, and MCP-1 did not differ significantly between stretched and non-stretched cells, with or without LPS (Figures 5A, C). In contrast, IL-10, MCP-1, and MIP-2 were significantly increased in LPS-stimulated cells exposed to cyclic stretch only compared with non-stretched, non-LPS controls (p = 0.0359, p = 0.0030, and p = 0.0014, respectively; Figures 5B, D, E).
Figure 5
3.5 Effects of 2-NBDG uptake in alveolar epithelial type II cells under stretch
Fluorescence microscopy revealed that uptake of the fluorescent glucose analog 2-NBDG was predominantly localized to the perinuclear region of alveolar epithelial type II cells. 2-NBDG uptake is increased in AECs type II cells with and without LPS under 30% stretch at 1 h (Figure 6) and 4 hours (Figure 7).
Figure 6
Figure 7
3.6 NBDG uptake fluorescence intensity
The fluorescence intensity of 2-NBDG uptake was significantly higher in L2 AECs, with or without LPS, under 30% stretch at both 1 and 4 hours. Stretched cells, treated or untreated with LPS, showed increased uptake at 1 h and 4 hours (both p < 0.0001) compared with non-stretched, non-stimulated cells or non-stretched LPS-treated cells. Moreover, LPS-stimulated stretched L2 AECs exhibited higher fluorescence at 1 h (p = 0.0014) and 4 hours (p < 0.0001) than non-stretched, non-LPS controls. These findings indicate that excessive mechanical stretch enhances glucose uptake in L2 AECs (Figure 8).
Figure 8
3.7 Correlation between glucose uptake and inflammatory markers
To explore the relationship between metabolic activation and inflammatory signaling, in our experimental model, exploratory correlation analyses were performed between glucose uptake and inflammatory markers measured by RT-qPCR and ELISA at 1 and 4 hours. Correlation analyses were not performed using individual biological replicates. Instead, for each experimental condition, the median value obtained from the independent biological experiments (n = 3–4 per condition) was calculated and used as a single representative observation. Correlation tables were generated using these condition-level median values for the Control, Stretch, LPS, and LPS+Stretch groups. Analyses were organized into predefined blocks, including No LPS, +LPS, Stretch vs Control, Stretch only, and all conditions pooled.
Consequently, the number of observations (N) reported in the correlation tables corresponds to the number of condition-level median values included in each correlation block and should not be interpreted as the number of independent biological experiments. Because some blocks contained fewer than three, correlations for these conditions were considered not estimable and were reported as N.E. Exact two-sided permutation tests were used to calculate p values. Both Pearson and Spearman correlation coefficients were computed Supplementary Figure 2.
4 Discussion
The main findings of this study demonstrate that exposure of rat alveolar epithelial type II cells to excessive cyclic stretch (30%) for 1 or 4 hours, with LPS stimulation, significantly increased both 2-NBDG uptake and glucose oxidase activity, compared with non-stretched control cells, with or without LPS treatment. These two measurements represent distinct glucose-related experimental readouts and should not be interpreted interchangeably. In contrast, the inflammatory response was predominantly observed in LPS-treated cells and varied according to the inflammatory mediator and exposure time. Thus, the effects of cyclic stretch on the glucose-related readouts assessed in this study were more consistent than its effects on inflammatory signaling.
To trigger the inflammatory response in L2 AECs we used LPS, which is widely employed to induce inflammation in vitro and in vivo (; ; ; ) or to model ARDS (; ). Stretch conditions were performed in L2 AECs because they can be easily grown under controlled conditions and are the main cell type involved in the immune response of the lung alveolar epithelium ().
It is well known that injured lungs are at risk of further deterioration due to overstretching during mechanical ventilation ().
In ARDS, tidal volumes >8 mL/kg are associated with alveolar overstretch (volutrauma), which causes significant lung injury and increased mortality (; ). Accordingly, our data show that 30% cyclic stretch increased both 2-NBDG uptake and glucose oxidase activity in LPS-treated and untreated cells. Importantly, these measurements provide complementary but distinct information. 2-NBDG is a fluorescent glucose analogue and its intracellular fluorescence primarily reflects cellular glucose analogue uptake, whereas the glucose oxidase assay represents a separate enzymatic readout measured in cell lysates. Therefore, the parallel increase in these parameters should not be interpreted as evidence that they represent the same biological process or that one directly causes the other.
As described in the literature, positron emission tomography/computed tomography (PET/CT) imaging of 18F-FDG is a valuable method to determine the pulmonary inflammatory response in ARDS patients (; ; Braune et al., 2019). The radiolabeled 18F-FDG is transported into cells via the same GLUT family of transporter proteins as glucose (primarily GLUT-1). In the presence of hexokinase, it is phosphorylated to 18 F-FDG-6-phosphate. Unlike glucose-6-phosphate, this metabolite cannot undergo further metabolism via the Krebs cycle, leading to intracellular accumulation that is proportional to cellular glucose uptake and hexokinase activity (; ).
Importantly, pulmonary 18F-FDG uptake measured in vivo reflects the combined metabolic activity of multiple pulmonary cell populations, including neutrophils, macrophages, endothelial cells and epithelial cells (). Therefore, the present findings should be interpreted within the context of alveolar epithelial cells and should not be directly extrapolated to whole-lung inflammatory activity.
On the cellular level, our results show increased perinuclear localization and fluorescence intensity of 2-NBDG under cyclic stretch, consistent with increased uptake of the fluorescent glucose analog. However, because glucose transporter expression or activity was not directly measured, these findings cannot establish whether the increased 2-NBDG signal results from altered GLUT expression, transporter activity, or other mechanisms. Further studies assessing glucose transporters such as GLUT1 and GLUT3 together with downstream metabolic pathways will be required to distinguish between these possibilities.
LPS stimulation markedly enhanced inflammatory mediator expression and secretion, whereas the additional effect of cyclic stretch varied among cytokines and time points. The increased gene expression and release of IL-6, MCP-1, and MIP-2 by LPS-stimulated AECs L2 is consistent with previous studies reporting stretch-induced inflammatory signaling in alveolar epithelial cells (; ; ; ; ; ). Amphiregulin is involved in epithelial repair and inflammation, acting as a growth factor and receptor ligand. From our findings, an increase in AREG expression at 1 or 4 hours during mechanical ventilation is consistent with published studies reporting elevated AREG levels in ventilated adult mice (Hillman et al., 2014).
A key strength of this study is the use of a controlled in vitro stretching model that reproduces stretch magnitudes comparable to those experienced during injurious mechanical ventilation. Although 30% cyclic stretch exceeds physiological alveolar deformation, it has been widely used as an experimental surrogate of severe alveolar overdistension associated with ventilator-induced lung injury. Thus, a customized stretching device was used that mimics in vivo mechanical stress during MV, as mechanotransduction is critical in VILI (Chen et al., 2018). The selected stretch duration (1 and 4 hours) allowed detection of early metabolic and inflammatory responses. However, it cannot fully recapitulate the complexity of the in vivo alveolar environment. If the lung volume increases by 40–100% of the total lung capacity, the basal surface area of alveolar epithelial cells increases by 34–35% (Tschumperlin and Margulies, 1999; Tschumperlin et al., 2000; Wirtz and Dobbs, 2000).
Given the limitations of current rodent models of mechanical ventilation to short time frames and the rapid cellular responses of inflammation and glucose uptake, our experiments were conducted at 1 and 4 hours. Previous studies have demonstrated that the overdistension stretch model effectively induces cellular deformation (; ).
Our previous studies have shown that excessive 30% cyclic stretch induces cytoskeletal remodeling in L2 AECs, including F-actin stress fiber formation and increased paracellular permeability (; ). The increased glucose uptake observed in the present study may therefore reflect the energetic requirements associated with cytoskeletal remodeling, maintenance of epithelial integrity, transcriptional activation, and protein synthesis. However, the molecular pathways responsible for this metabolic response were not directly investigated. Importantly, the molecular mechanisms responsible for the increased 2-NBDG uptake and glucose oxidase activity were not investigated in the present study. Therefore, our data cannot determine whether cyclic stretch alters glucose transporter expression or activity, intracellular glucose metabolism, glucose oxidase-related enzymatic activity, or a combination of these processes. Based on mechanisms described in the literature, future studies could investigate whether glucose transporters, such as GLUT1/GLUT3, mechanotransduction pathways such as ERK1/2 and YAP, or metabolic regulators including AMPK, HIF-1α, and PI3K/Akt/mTOR signaling (Ouiddir et al., 1999; Correa-Meyer et al., 2002; Nam et al., 2026). Future studies are warranted to investigate these pathways and establish the molecular link between mechanical stress, glucose metabolism, and inflammatory activation.
Our findings show that, in rat L2 AECs, the glucose-related and inflammatory responses exhibited different patterns across the experimental conditions and time points. Importantly, within the limitations of the present in vitro epithelial model, increased 2-NBDG uptake was not consistently accompanied by increased inflammatory mediator expression or secretion. However, the present study was not designed or powered to establish whether glucose uptake can serve as a surrogate marker of inflammatory activation. Furthermore, these observations should not be extrapolated to the in vivo lung, where glucose uptake reflects the combined metabolic activity of multiple cell populations, including neutrophils, macrophages, endothelial cells, and epithelial cells.
Exploratory correlation analyses are provided in Supplementary Figure 2. Because these analyses were based on a limited number of condition-level median observations, they were not powered to detect meaningful associations and were not considered suitable for inferential conclusions. Accordingly, these analyses should be regarded as hypothesis-generating only and cannot establish or exclude an association between 2-NBDG uptake and inflammatory responses.
Thus, Figure 9 provides a schematic summary of the principal experimental findings obtained in the present study: excessive 30% cyclic stretch increased 2-NBDG uptake and glucose oxidase activity in rat L2 alveolar epithelial cells, whereas inflammatory responses were more pronounced in LPS-treated cells and varied according to the inflammatory mediator and experimental time point.
Figure 9
Overall, our findings demonstrate that excessive cyclic stretch increases two distinct glucose-related readouts, 2-NBDG uptake and glucose oxidase activity, in rat L2 alveolar epithelial cells, whereas inflammatory responses were more strongly influenced by LPS stimulation and varied among mediators and time points. The present study does not establish the molecular mechanisms underlying the observed glucose-related changes or a causal relationship between the two readouts. These observations provide a basis for future mechanistic studies investigating how mechanical deformation influences glucose transport, cellular metabolism, and inflammatory signaling in alveolar epithelial cells.
4.1 Possible implications of the findings
The present findings provide insight into the cellular responses of alveolar epithelial cells to excessive mechanical deformation. Excessive ventilation is able to cause lung injury, which can be seen as volutrauma; it can also be explained by biotrauma.
In L2 AECs, 30% cyclic stretch increased two distinct glucose-related readouts, 2-NBDG uptake and glucose oxidase activity, whereas inflammatory responses were more strongly influenced by LPS stimulation and varied among inflammatory mediators and time points. These findings indicate that glucose-related and inflammatory responses may exhibit different patterns following mechanical stress.
Importantly, increased 2-NBDG uptake was not consistently accompanied by increased expression or secretion of inflammatory mediators. Therefore, these observations should be restricted to the present in vitro epithelial model and should not be extrapolated to whole-lung inflammatory activity or clinical responses to mechanical ventilation. Further studies using more complex experimental models are required to determine the mechanisms underlying these glucose-related responses and their relationship with inflammatory signaling.
4.2 Limitation
Our study holds several limitations. First, in vitro conditions cannot fully replicate the complex multicellular and mechanical environment of the lung parenchyma in vivo. Second, LPS is a complex inflammatory stimulus that may contain additional bacterial components and exhibits cytotoxic effects; however, it remains a widely accepted and reproducible model for inducing inflammation in vitro. Third, the mechanical forces transmitted through a collagen-coated membrane differ from those experienced by epithelial cells in vivo, where stretch is applied through interactions with the extracellular matrix and neighboring cells.
4.3 Conclusion
In summary, rat alveolar epithelial L2 cells exposed to 30% cyclic overstretch exhibited increased glucose-related responses, whereas inflammatory responses were more strongly influenced by LPS stimulation and varied among mediators and time points. These findings indicate that glucose-related and inflammatory responses exhibit different patterns under excessive mechanical stretch and provide a basis for future mechanistic studies of epithelial responses to mechanical deformation.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Ethics statement
Ethical approval was not required for the studies on animals in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.
Author contributions
JC: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Software, Validation, Writing – original draft, Writing – review & editing. RH: Data curation, Formal analysis, Software, Validation, Writing – original draft, Writing – review & editing. SM: Investigation, Methodology, Writing – original draft, Writing – review & editing. TK: Formal analysis, Funding acquisition, Resources, Supervision, Validation, Writing – original draft, Writing – review & editing. MG: Conceptualization, Data curation, Formal analysis, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This work was supported by a grant of Deutsche Forschungsgemeinschaft GA 1256/8. This funding body supported the collection, analysis, and interpretation of data.
Acknowledgments
The authors thank the support of all members of the Pulmonary Engineering Group (PEG) from the Department of Anesthesiology and Intensive Care Medicine at the University Hospital Carl Gustav Carus, TUD Dresden University of Technology, Dresden, Germany, for their assistance in conducting experiments.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphys.2026.1909536/full#supplementary-material
References
1
BatesJ. H. T.SmithB. J. (2018). Ventilator-induced lung injury and lung mechanics. Ann. Transl. Med.6, 378. doi: 10.21037/atm.2018.06.29
2
BeitlerJ. R.MalhotraA.ThompsonB. T. (2016). Ventilator-induced lung injury. Clin. Chest Med.37, 633–646. doi: 10.1016/j.ccm.2016.07.004
3
BigatelloL. M.PesentiA. (2009). Ventilator-induced lung injury. Anesthesiology111, 699–700. doi: 10.1097/aln.0b013e3181b76545
4
BirukovaA. A.WuT.TianY.MelitonA.SarichN.TianX.et al. (2012). Iloprost improves endothelial barrier function in lipopolysaccharide-induced lung injury. Eur. Respir. J.41, 165–176. doi: 10.1183/09031936.00148311
5
BottaM.TsonasA. M.PillayJ.BoersL. S.AlgeraA. G.BosL. D. J.et al. (2021). Ventilation management and clinical outcomes in invasively ventilated patients with COVID-19 (PRoVENT-COVID): A national, multicentre, observational cohort study. Lancet Respir. Med.9, 139–148. doi: 10.1016/s2213-2600(20)30459-8
6
BrauneA.HofheinzF.BluthT.KissT.WittensteinJ.ScharffenbergM.et al. (2019). Comparison of static and dynamic 18F-FDG PET/CT for quantification of pulmonary inflammation in acute lung injury. J. Nucl. Med.60, 1629–1634. doi: 10.2967/jnumed.119.226597
7
ChenL.XiaH. F.ShangY.YaoS. L. (2018). Molecular mechanisms of ventilator-induced lung injury. Chin. Med. J-peking131, 1225–1231. doi: 10.4103/0366-6999.226840
8
Correa-MeyerE.PesceL.GuerreroC.SznajderJ. I. (2002). Cyclic stretch activates ERK1/2 via G proteins and EGFR in alveolar epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol.282, L883–L891. doi: 10.1152/ajplung.00203.2001
9
CrosbyL. M.LuellenC.ZhangZ.TagueL. L.SinclairS. E.WatersC. M. (2011). Balance of life and death in alveolar epithelial type II cells: Proliferation, apoptosis, and the effects of cyclic stretch on wound healing. Am. J. Physiol. Lung Cell. Mol. Physiol.301, L536–L546. doi: 10.1152/ajplung.00371.2010
10
CruzF. F.BallL.RoccoP. R. M.PelosiP. (2018). Ventilator-induced lung injury during controlled ventilation in patients with acute respiratory distress syndrome: Less is probably better. Expert Rev. Resp. Med.12, 403–414. doi: 10.1080/17476348.2018.1457954
11
DingN.WangF.XiaoH.XuL.SheS. (2013). Mechanical ventilation enhances HMGB1 expression in an LPS-induced lung injury model. PloS One8, e74633. doi: 10.1371/journal.pone.0074633
12
DreyfussD.SaumonG. (1998). Ventilator-induced lung injury: Lessons from experimental studies. Am. J. Resp. Crit. Care157, 294–323. doi: 10.1164/ajrccm.157.1.9604014
13
DreyfussD.SolerP.BassetG.SaumonG. (1988). High inflation pressure pulmonary edema: Respective effects of high airway pressure, high tidal volume, and positive end-expiratory pressure. Am. Rev. Respir. Dis.137, 1159–1164. doi: 10.1164/ajrccm/137.5.1159
14
FerreiraJ. M. C.HuhleR.MüllerS.SchnabelC.MehnerM.KochT.et al. (2022). Static stretch increases the pro-inflammatory response of rat type 2 alveolar epithelial cells to dynamic stretch. Front. Physiol.13, 838834. doi: 10.3389/fphys.2022.838834
15
HillmanN. H.GisslenT.PolglaseG. R.KallapurS. G.JobeA. H. (2014). Ventilation-induced increases in EGFR ligand mRNA are not altered by intra-amniotic LPS or Ureaplasma in preterm lambs. PloS One9, e96087. doi: 10.1371/journal.pone.0096087
16
HuhleR.NetoA. S.SchultzM. J.AbreuM. G.de (2018). Is mechanical power the final word on ventilator-induced lung injury?-No. Ann. Transl. Med.6, 394. doi: 10.21037/atm.2018.09.65
17
KangE. K.KimH. S. (2017). The effects of hydrogen peroxide and lipopolysaccharide on rat alveolar L2 cells. Exp. Lung Res.43, 293–300. doi: 10.1080/01902148.2017.1368738
18
MariniJ. J.GattinoniL. (2020). Time course of evolving ventilator-induced lung injury: The “shrinking baby lung. Crit. Care Med.48, 1203–1209. doi: 10.1097/ccm.0000000000004416
19
McRitchieD. I.IsowaN.EdelsonJ. D.XavierA. M.CaiL.ManH. Y.et al. (2000). Production of tumour necrosis factor alpha by primary cultured rat alveolar epithelial cells. Cytokine12, 644–654. doi: 10.1006/cyto.1999.0656
20
NamH.YuG.AhnS. I.NamS. (2026). Mechanical regulation of metabolism, epigenetics, and their interplay. NPJ Biomed. Innov.3, 5. doi: 10.1038/s44385-025-00059-1
21
NetoA. S.BarbasC. S. V.SimonisF. D.Artigas-RaventósA.CanetJ.DetermannR. M.et al. (2016). Epidemiological characteristics, practice of ventilation, and clinical outcome in patients at risk of acute respiratory distress syndrome in intensive care units from 16 countries (PRoVENT): An international, multicentre, prospective study. Lancet Respir. Med.4, 882–893. doi: 10.1016/s2213-2600(16)30305-8
22
OuiddirA.PlanèsC.FernandesI.VanHesseA.ClericiC. (1999). Hypoxia upregulates activity and expression of the glucose transporter GLUT1 in alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol.21, 710–718. doi: 10.1165/ajrcmb.21.6.3751
23
PauwelsE. K. J.CoumouA. W.KostkiewiczM.KairemoK. (2013). 18F]Fluoro-2-deoxy-D-glucose positron emission tomography/computed tomography imaging in oncology: Initial staging and evaluation of cancer therapy. Med. Princ. Pr.22, 427–437. doi: 10.1159/000346303
24
PellegriniM.SorboL. D.RanieriV. M. (2024). Finding the optimal tidal volume in acute respiratory distress syndrome. Intensiv. Care Med.50, 1154–1156. doi: 10.1007/s00134-024-07440-5
25
PelosiP.RoccoP. R. M.AbreuM. G.de (2018). Close down the lungs and keep them resting to minimize ventilator-induced lung injury. Crit. Care22, 72. doi: 10.1186/s13054-018-1991-3
26
ProstN.deTucciM. R.MeloM. F. V. (2010). Assessment of lung inflammation with 18F-FDG PET during acute lung injury. AJR Am. J. Roentgenol.195, 292–300. doi: 10.2214/ajr.10.4499
27
PuginJ.DunnI.JollietP.TassauxD.MagnenatJ.-L.NicodL. P.et al. (1998). Activation of human macrophages by mechanical ventilation in vitro. Am. J. Physiol-lung C.275, L1040–L1050. doi: 10.1152/ajplung.1998.275.6.l1040
28
RanX.MüllerS.BrunssenC.HuhleR.ScharffenbergM.SchnabelC.et al. (2023). Modulation of the Hippo-YAP pathway by cyclic stretch in rat type 2 alveolar epithelial cells—a proof-of-concept study. Front. Physiol.14, 1253810. doi: 10.3389/fphys.2023.1253810
29
RasbandW. S. (2021). ImageJ (Bethesda, Maryland, USA: National Institutes of Health).
30
RentzschI.SantosC. L.HuhleR.FerreiraJ. M. C.KochT.SchnabelC.et al. (2017). Variable stretch reduces the pro-inflammatory response of alveolar epithelial cells. PloS One12, e0182369. doi: 10.1371/journal.pone.0182369
31
SamaryC. S.SilvaP. L.AbreuM. G.dePelosiP.RoccoP. R. M. (2016). Ventilator-induced lung injury. Anesthesiology125, 1070–1071. doi: 10.1097/aln.0000000000001297
32
SchindelinJ.RuedenC. T.HinerM. C.EliceiriK. W. (2015). The ImageJ ecosystem: An open platform for biomedical image analysis. Mol. Reprod. Dev.82, 518–529. doi: 10.1002/mrd.22489
33
SchneiderC. A.RasbandW. S.EliceiriK. W. (2012). NIH Image to ImageJ: 25 years of image analysis. Nat. Methods9, 671–675. doi: 10.1038/nmeth.2089
34
SipahiE. Y. (2014). Experimental models of acute respiratory distress syndrome. J. Transl. Intern. Med.2, 154–159. doi: 10.4103/2224-4018.147738
35
SukiB.HubmayrR. (2014). Epithelial and endothelial damage induced by mechanical ventilation modes. Curr. Opin. Crit. Care20, 17–24. doi: 10.1097/mcc.0000000000000043
36
TanakaT.SaitoY.MatsudaK.KamioK.AbeS.KubotaK.et al. (2017). Cyclic mechanical stretch-induced oxidative stress occurs via a NOX-dependent mechanism in type II alveolar epithelial cells. Respir. Physiol. Neurobiol.242, 108–116. doi: 10.1016/j.resp.2017.04.007
37
TerragniP. P.RosbochG. L.LisiA.VialeA. G.RanieriV. M. (2003). How respiratory system mechanics may help in minimising ventilator-induced lung injury in ARDS patients. Eur. Respir. J.22, 15s–21s. doi: 10.1183/09031936.03.00420303
38
TerragniP. P.RosbochG.TealdiA.CornoE.MenaldoE.DaviniO.et al. (2007). Tidal hyperinflation during low tidal volume ventilation in acute respiratory distress syndrome. Am. J. Resp. Crit. Care175, 160–166. doi: 10.1164/rccm.200607-915oc
39
TschumperlinD. J.MarguliesS. S. (1999). Alveolar epithelial surface area-volume relationship in isolated rat lungs. J. Appl. Physiol.86, 2026–2033. doi: 10.1152/jappl.1999.86.6.2026
40
TschumperlinD. J.OswariJ.MarguliesA. S. S. (2000). Deformation-induced injury of alveolar epithelial cells. Am. J. Resp. Crit. Care162, 357–362. doi: 10.1164/ajrccm.162.2.9807003
41
WangT.GrossC.DesaiA. A.ZemskovE.WuX.GarciaA. N.et al. (2017). Endothelial cell signaling and ventilator-induced lung injury: Molecular mechanisms, genomic analyses, and therapeutic targets. Am. J. Physiol-lung C.312, L452–L476. doi: 10.1152/ajplung.00231.2016
42
WirtzH. R.DobbsL. G. (2000). The effects of mechanical forces on lung functions. Resp. Physiol.119, 1–17. doi: 10.1016/s0034-5687(99)00092-4
43
WongM. H.JohnsonM. D. (2013). Differential response of primary alveolar type I and type II cells to LPS stimulation. PloS One8, e55545. doi: 10.1371/journal.pone.0055545
Summary
Keywords
glucose uptake, inflammation, type II alveolar epithelial cells, ventilator-induced lung injury, VILI
Citation
C. Ferreira JM, Huhle R, Müller S, Koch T and Gama de Abreu M (2026) Cyclic stretch increases glucose uptake and pro-inflammatory response in rat alveolar epithelial type II cells. Front. Physiol. 17:1909536. doi: 10.3389/fphys.2026.1909536
Received
15 June 2026
Revised
08 September 2026
Accepted
14 September 2026
Published
01 October 2026
Volume
17 - 2026
Edited by
Carmen Silvia Valente Barbas, University of São Paulo, Brazil
Updates
Copyright
© 2026 C. Ferreira, Huhle, Müller, Koch and Gama de Abreu.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Jorge M. C. Ferreira, jorge.carona_ferreira1@mailbox.tu-dresden.de
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.