Full length SbNHXLP coding sequence was retrieved from S. bicolor genome sequence using GENSCAN software (Burge and Karlin, 1998, http://genes.mit.edu/GENSCAN.html). From the BLAST (Altschul et al., 1990) output, end to end primers were designed to amplify the full length gene. PCR reaction was performed using gene specific primers (forward primer 5′ATGGGGCTCGATTTGGGAGCT3′ and reverse primer 5′TCAACTATGCTCAGCCTCTGTCA3′) with S. bicolor variety BTX623 cDNA. The amplified product was cloned into pTZ57R/T vector and sequenced. The vector pCAMBIA1302 harboring SbNHXLP gene driven by CaMV35S promoter and NOS PolyA terminator was mobilized into Agrobacterium tumefaciens strain LBA4404 using freeze-thaw method. SbNHXLP gene was characterized for the number of exons, introns, and their length by Gene Structure Display Server (GSDS) tool (http://gsds.cbi.pku.edu.cn/). Motif search database was used to identify the sodium proton exchanger motifs (http://www.genome.jp/tools/motif/). Prediction of transmembrane helices in protein was carried out using TMHMM (Krogh et al., 2001). Motifs were identified using the MEME software (Bailey et al., 2009). Homology model of SbNHXLP protein was created and amiloride was docked to it using SYBYL FlexX software (Rarey et al., 1996).

Twelve-day-old cotyledonary and hypocotyl explants of tomato variety Pusa Early Dwarf (PED) were used for transformation studies. Cotyledonary and hypocotyl explants were cultured on Murashige and Skoog's (MS) medium (1962) fortified with 2 mg/L of thidiazuron (TDZ) (Murashige and Skoog, 1962). To test antibiotic sensitivity, explants were cultured on regeneration medium with different concentrations of hygromycin (0–10 mg/L) and cefotaxime (0–300 mg/L) separately. Agrobacterium infected explants were co-cultivated in dark for 2-days, after incubation, explants were sub-cultured onto selection medium (MS medium with 2 mg/L TDZ, 3 mg/L hygromycin, and 300 mg/L cefotaxime). Well-rooted transformants were acclimatized and grown in green house. Genomic DNA was isolated from leaf tissues of WT and transgenic plants (Doyle and Doyle, 1990). Putative transgenics were confirmed by PCR amplification using SbNHXLP and hptII gene specific primers. For gene copy number, genomic DNA (20 μg each) was digested with HindIII and probed with hptII gene (Sambrook and Russell, 2001). Total RNA (200 ng) isolated from transgenics and WT was used for first strand cDNA synthesis. Transcript levels were confirmed by reverse transcriptase PCR (RT-PCR) using SbNHXLP gene specific primers.

T₁ seeds were germinated on MS basal medium supplemented with 8 mg/L hygromycin. After 10-days of germination, Mendelian inheritance was observed by calculating hygromycin resistant and sensitive seedlings. Similarly, T₂ seedlings obtained from selfed T₁ generation were cultured on MS basal medium supplemented with 8 mg/L hygromycin. Homozygous lines were used for subsequent studies. Eight micron sized cryotome sections of transgenic stem were taken from 10-day-old seedlings and fixed in 4% paraformaldehyde. Immunolocalization method was performed with the following steps: blocking, incubation with primary antibodies, washing, incubation with secondary antibody conjugate, washing and putative visualization step, washing, putative counterstaining, and mounting. They were incubated with polyclonal Na⁺/H⁺ antiporter antibodies (Agrisera, AS09 484) and conjugated with Alexafluor (Invitrogen, USA) secondary antibodies. Sections were analyzed under inverted confocal microscope (Leica Microsystems) at 578 nm.

To assess salt tolerance, 45-day-old homozygous T₂ transgenic lines (T_2−1−3,T₄₋₁₋₆, T₅₋₁₋₁, T₇₋₁₋₁₅) along with WT were treated with 200 mM NaCl for 15 alternate days. After treatment, stress was relieved by rewatering to see the extent of recovery.

Forty five-day-old homozygous T₂ transgenic lines (T_2−1−3,T₄₋₁₋₆, T₅₋₁₋₁, T₇₋₁₋₁₅) along with WT were treated with 200 mM NaCl for 15 alternate days. After 15-days of salt treatment, proline was estimated (Bates et al., 1973), activities of superoxide dismutase (SOD) (Beauchamp and Fridovich, 1971), and catalase (Luck, 1974) were determined. Protein concentration was measured by the method of Bradford (1976). For chlorophyll fluorescence, same age-group plants were treated with 200 mM NaCl for 7 days. PSII activity was measured before and after salt treatment (Strasser et al., 1995), experiments were repeated thrice and each time two plants were taken.

To determine the action of amiloride on the activity of SbNHXLP protein, 45-day-old transgenic and WT plants were treated with 1 mM amiloride for 2 h. To find out the Na⁺ and Ca²⁺ accumulations, tomato seedlings were grown for 9-days and treated with 200 mM NaCl for 2 h. Root sections (8 μm) were cut from the mature zone, incubated in microfuge tubes in 500 μl of 10 mM Sodium Green (S6901, Invitrogen) and Calcium Green (C3012, Invitrogen) solutions separately. After 1 h incubation, samples were observed under confocal microscope.

For ion analysis, 45-day-old T₅₋₁₋₁ and T₇₋₁₋₁₅ transgenic lines and WT were treated with 200 mM NaCl for 3 consecutive days. Root, stem, leaf, and flower tissue samples from transgenics and WT were digested in 3 ml of 3:1 HNO₃: H₂O₂ for 24 h. Ions (Na⁺, K⁺, Ca²⁺, and Cl⁻) were measured using the inductively coupled plasma optical emission spectrometer (ICP-OES, Optima 2000DV, Perkin Elmer). The experiments were repeated thrice and each time two plants were taken.

One-month-old T₅₋₁₋₁ transgenic and WT were treated with 200 mM NaCl stress for 3-days. Thereafter, stem and root samples were macerated to measure the length and width of fibers and vessel elements. Small matchstick size wood pieces were macerated in Jeffrey's fluid (Berlyn and Mikshe, 1976). Semi-thin sections (1–2 μm) were taken with a glass knife using Reichert OM U3 ultramicrotome. Stained sections were observed and photographed using a Leica DM 2000 microscope attached with a Cannon DC 150 digital camera. The length and width of vessel elements and fibers were measured with an ocular micrometer scale mounted in a research microscope. The number of cambial cell layers was counted from the transverse sections. The fiber wall thicknesses, radial extent of xylem, and vessel density were recorded from transverse sections using ocular micrometer scale. For each parameter, 100 readings were taken from randomly selected elements from six replicates.

Fruit yield (number and weight of fruits per plant) was measured in T₅₋₁₋₁ and T₇₋₁₋₁₅ transgenic lines along with WT. Sixty-day-old plants were treated with 200 mm NaCl stress for 15 alternate days. After treatment, stress was relieved by rewatering. The fruit yield was measured on 75th day.

Co-IP was performed following manufacturer's instructions (Pierce, Co-IP kit, 26149; Thermo Scientific). Ten microliters (1 μg/μl) of anti-NHX polyclonal antibodies (Agrisera, AS07 207) were immobilized onto A/G agarose beads. Total protein was isolated from transgenic and WT plants. Leaf tissue (50 mg) was ground with liquid nitrogen and washed with 1X Dulbecco's PBS, followed by addition of 500 μl of immunoprecipitation lysis buffer with gentle shaking for 5 min. Tubes were centrifuged at 13,000 × g for 10 min for pelleting. Agarose resin slurry (80 μl) was added to the spin column and allowed to settle. Storage buffer was removed by spinning. To this, 100 μl of 1X coupling buffer was added and centrifuged to discard the flow through. Cell lysate was added to the column having resin and incubated at 4°C for 1 h with gentle shaking and centrifuged at 1000 × g for 1 min. Flow through was added to immobilized antibody. Immobilized antibody beads and the protein mixture were incubated overnight at 4°C, 40 μl of protein A sepharose was added and incubated further for 2–3 h at 4°C. The beads were collected by centrifugation at 100 × g for 3 min at 4°C, and then washed 5 times with ice-cold IP buffer. The protein fractions were eluted from the beads and the immunoprecipitated samples were analyzed by SDS-PAGE and subjected to trypsin in-gel digestion and purification using trifluoroacetic acid, 5% formic acid, and acetonitrile. Agarose resin supplied along with the kit was taken as a negative control. Peptides were loaded on a matrix for mass spectrometric (MS-MS) analysis using 4700 plus MALDI TOF-TOF proteomics analyzer (Applied Biosystems, USA). MS-MS analyzed best peptide masses were taken for MASCOT analysis to know the plausible SbNHXLP interactant, which was further sequenced to obtain a full length sequence.

To find out the expression levels of SbNHXLP and SlCHX2, 1-month-old T₅₋₁₋₁ transgenic and WT plants were treated with 200 mM NaCl and 200 mM mannitol to induce salt and drought stresses, respectively, for 72 h. Same age old plants were also treated with 10 mM KCl and 100 mM KNO₃ for 72 h. Root, stem, and leaves were taken for relative expression studies of SbNHXLP and SlCHX2 genes using POWER SYBR Green PCR Master Mix (Applied Biosystems). SbNHXLP, SlCHX2, and β-actin gene specific primers were used as shown in Table S1. The expression levels of SbNHXLP and SlCHX2 genes in various samples were normalized to β-actin. No template controls (NTC) were used in every experiment. Experiments were performed with three technical replicates for each biological duplicate. The comparative 2^−ΔΔCT method was used to calculate the relative quantities of each transcript in the samples (Schmittgen and Livak, 2008).

All experiments were carried out thrice with five plants in each treatment (unless otherwise mentioned). Mean, standard error mean, and t-test values were calculated with the help of excel sheet and the graphs were plotted using GraphPad softwareV6.01 Version (http://www.graphpad.com/scientific-software/prism).

SbNHXLP full length cDNA (1473 bp) was amplified (Figure 1A) and deposited in NCBI (Accession number EU482408). SbNHXLP gene cassette driven by CAMV35S promoter and NOS terminator (Figure 1B) was cloned into pCAMBIA1302 vector using HindIII enzyme (Figure 1C). In silico analysis of SbNHXLP exhibited 93, 87, and 74% homology with NHX2, 83, 84, and 71% homology with NHX3 protein of maize, rice, and Arabidopsis, respectively. It has 12 exons and 11 introns (Figure S1A) and is localized on the chromosome number 9. Two Na⁺-H⁺ exchanger motifs were detected in SbNHXLP (Figure S1B). Further, SbNHXLP revealed that it is a transmembrane protein (Figure S1C) which has eight motifs (Figure S1D) with varying number of amino acids as shown in Table S2. Though its molecular weight did not match with NHX7/NHX8 proteins, it is localized on the plasma membrane like that of NHX7 and NHX8 proteins which is later mirrored using immunolocalization. SbNHXLP was modeled and a drug inhibitor amiloride was docked to the conserved domain LLFIYLLPPI, indicating that amiloride inhibits its activity (Figure S1E).

The vector pCAMBIA1302-SbNHXLP was mobilized into the A. tumefaciens strain LBA4404 by freeze-thaw method and utilized for genetic transformation studies. Transformants from cotyledonary and hypocotyl explants were regenerated on MS medium fortified with 2 mg/L TDZ and 3 mg/L hygromycin (Figure 2A) with 44 and 32% frequencies, respectively. Transformants showed multiple shoot regeneration (Figure 2B) and rooting on 2 mg/L TDZ and 3 mg/L hygromycin (Figure 2C). After 15 days of acclimatization in coco-peat (Figure 2D), transgenics were transferred to garden soil (Figure 2E) and grown in the green house (Figure 2F). Genomic DNA was isolated from all the transgenics and plasmid DNA of pCAMBIA1302-SbNHXLP served as positive control. All the putative transformants showed PCR amplification (750 bp) of SbNHXLP (Figure 3A) and 776 bp of hptII (Figure S2A) genes but corresponding bands were not observed in WT. Gene copy number was confirmed by digesting the genomic DNA with HindIII and probed with hptII (Figure 3B). Four lines with single gene copies were used for further experiments. RT-PCR analysis displayed high transcript levels in the leaf tissues of transgenic lines, but not in WT (Figure S2B).

All the four T₁ transgenic lines showed Mendelian inheritance of 3:1 (3 resistant: 1 susceptible) monogenic ratio (Figure S3 and Table S3). All T₂ progenies segregated in 1:2:1 ratio (Figure S4 and Table S4), and the homozygous lines (T₂₋₁₋₃,T₄₋₁₋₆, T₅₋₁₋₁, T₇₋₁₋₁₅) were used for further analysis. At 578 nm, no fluorescence signals were noticed in WT stem, but red color fluorescence signals were emitted at the plasma membrane level in transgenic stem indicating SbNHXLP localization in the membrane (Figures 4A,B).

Upon exposure to salt stress, WT displayed rapid leaf yellowing (including apical leaves) and turned brown. On the other hand, transgenic plants exhibited delayed leaf yellowing or partial browning after treatment. While transgenics recovered after stress treatment, WT did not and died eventually (Figure 5).

Devoid of stress, no significant accumulation of proline was observed in transgenics and WT. Under stress, accumulation of proline was significant in transgenic lines. Transgenics displayed 4-folds higher proline content after 7-days of treatment but decreased slightly by 15th day (Figure 6A). No significant change in SOD activity was recorded in transgenics and WT without stress. But, SOD activity increased by 1.5-folds in the transgenics upon exposure to NaCl stress in comparison to WT (Figure 6B). Similarly, catalase activity in transgenics under stress conditions was 2.4-folds higher as compared to WT (Figure 6C). Before salt treatment, there was no considerable change in Fv/Fm ratio between transgenic lines and WT. After treatment with 200 mM NaCl for 72 h, photochemical activity of PSII decreased by 5 to 15% in transgenics but dramatically (by 48%) in WT. Transgenic lines recorded approximately 40% higher Fv/Fm than the WT (Figure 6D).

To find out whether SbNHXLP excludes Na⁺ like SOS1 protein, amiloride binding assay was performed. The drug amiloride binds to the SbNHXLP modeled protein motif LLFIYLLPPI, which is highly conserved among all the NHX members and inhibits the activity of these proteins. This is substantiated in transgenic plants treated with 1 mM amiloride which showed inhibition of SbNHXLP activity with a decrease in Na⁺ efflux compared to WT (Figure 7). To find out if the protein is able to exclude Na⁺ and accumulate Ca²⁺ at the membrane level, roots were treated with Sodium and Calcium Green indicators. Transgenic roots showed less fluorescence indicating reduced accumulation of Na⁺ due to Na⁺ exclusion compared to WT (Figures 8A,B). Increased Calcium Green fluorescence was recorded in transgenics relative to WT (Figures 8C,D).

Na⁺ and K⁺ homeostasis is a crucial step in plants for salt tolerance. Overexpression of SbNHXLP resulted in reduced Na⁺ accumulation with a concomitant increase in K⁺ under salt stress in transgenics compared to WT. At 200 mM NaCl, root, stem, leaf, and flower tissues exhibited significant reductions in Na⁺ content in T₅₋₁₋₁ transgenic line compared to WT (Figure 9A). Transgenic leaf contained the least amount of 8.99 mg/g dry tissue, followed by root and flower. Accumulation of Na⁺ was 3-folds lower in leaf tissues in transgenics in comparison with stem. Transgenic line showed higher K⁺ content in roots (6-folds) and flowers (Figure 9B). On the other hand, Ca²⁺ content in transgenic did not differ much from that of WT (Figure 9C), while chloride content was slightly less in transgenics (Figure 9D).

Transgenics growing under stress showed better vascular conductivity compared to WT. Transgenic root (Figure 10B) displayed multiple cambial cell layers, xylem, fiber length, width, and higher thickness. Vessel element length and width was more in transgenics compared to WT (Figure 10A). Similarly in salt treated transgenic stems, multiple cambial cell layers with increased fiber length and width, vessel length and width were noticed (Figure 10D) in comparison with WT (Figure 10C). Further, cell lysis was noticed in the outer cortex region of WT root (Figure 10A) and stem (Figure 10C). Xylogenesis was noticed in transgenic plants, as evident from the significantly higher number of cambial cell layers in the stem, amount of secondary xylem in both stem and root compared to that of salt treated WT. Dimensional changes in vascular tissues of WT and transgenics treated with salt stress are shown in Tables S5, S6, respectively.

Upon NaCl stress, normal flowering was noticed in transgenics, but flower drop was severe in WT. Devoid of stress, transgenics displayed reduced fruit and seed sizes when compared with WT. Without stress, the number of fruits per plant was 17.8 ± 1.18 in WT and 21.46 ± 1.06 in T₅₋₁₋₁ transgenic line. Similarly, total fruit weight per plant was 770 ± 47.52 g in WT (without stress) and 831.8 ± 51.02 g in T₅₋₁₋₁ transgenic line. Transgenics recovered when salt stress was relieved, but not WT, which died eventually. The number of fruits produced per plant in T₅₋₁₋₁ transgenic line was 15.46 ± 1.23 and the total fruit weight was 582.26 ± 37.5 g after stress recovery (Table 1).

In silico protein-protein interaction studies of NHX using GeneMANIA software revealed hypothetical interactions with several members of NHX and CHX families (Figure S5). Co-immunoprecipitation followed by MS-MS analysis (Figure 11) showed that SbNHXLP protein interacts in vitro with Solanum lycopersicum cation proton antipoter2 (SlCHX2), a member of the CPA2 family. SbNHXLP-SlCHX2 complex was detected in the immunoprecipitate of root extracts captured by anti-NHX antibody when electrophoresed with SDS-PAGE (Figure 11, insert) which shows that it is in agreement with in silico predictions. The protein was sequenced and the amino acid sequence of SlCHX2 was confirmed by BLASTP analysis (Table S7).

After normalization with internal control gene β-actin, it has been observed that expression levels of SbNHXLP vary among the 3 tissues. SbNHXLP and SlCHX2 genes displayed a differential expression in response to the stress treatments (Figure 12). Both NaCl and KNO₃ treatments showed higher transcript abundance in root tissues of tomato for SbNHXLP (4.5 and 2.3-folds increase, respectively) and SlCHX2 (4.7 and 4-folds increase, respectively). Mannitol (drought) also enhanced the activities of SbNHXLP (3-folds) and SlCHX2 (1.75-folds). Contrarily, KCl treatment slightly induced the SbNHXLP activity (1.5-folds, in contrast to 4.5-folds under NaCl stress) but interestingly decreased the SlCHX2 expression (1.5-folds decrease).

NHX-type antiporters are pivotal players in salt tolerance and also in growth and cell expansion (Bassil et al., 2011a,b). In the present study, a member of the NHX gene family, named as SbNHXLP was isolated from a C₄ cereal crop species S. bicolor. SbNHXLP showed high homology like other NHX members (NHX2 and NHX3) at the amino acid level, but the molecular weight did not match.

Initially, tomato transformation was carried out and the results are in agreement with the earlier findings reported by Rao et al. (2009). Morphological variations in shoot or root lengths were not observed in the transgenics, but fruit and seed sizes varied when compared with WT devoid of salt stress. It has been shown that transgenics driven by constitutive promoters suffer from undesirable phenotypes, such as stunted growth and reduced yield (Wang et al., 2013). Proteins encoded by the DNA sequences of the NHX family members have been reported to be located on different cellular membranes (Zhang et al., 2015). For Na⁺ transport across the membranes, proteins encoded by members of the NHX family genes utilize H⁺ gradient as the driving force (Bassil et al., 2012). Our results with immunolocalization indicate that SbNHXLP is a transmembrane protein localized to the plasma membrane in transgenics similar to that of SOS1 and NHX8 proteins and helps in effluxing Na⁺ (Shi et al., 2002).

Transgenics with single gene copy number were used in the present study for functional validation of the gene, since more than one copy may result in gene silencing (Tang et al., 2007). Salt stress generally causes inhibition of plant growth, reduction in photosynthesis, and protein synthesis (Hasegawa et al., 2000). Mohammad et al. (1998) and Meloni et al. (2001) observed reduction in plant height, shoot weight, and number of leaves per plant under salt stress in tomato and cotton, respectively. Contrarily, no reduction in plant height was noticed, but fruit and seed sizes decreased in the present study under salt stress. Transgenics developed with NHX family members conferred enhanced tolerance to salt (Shi et al., 2002; Liu et al., 2008; Rodriguez-Rosales et al., 2008; Pandey et al., 2016). In order to validate the function of SbNHXLP, transgenics were exposed to salt stress alongside the WT. Similar to previous reports, transgenic tomato also displayed enhanced tolerance to salt in comparison with WT. Na⁺ enters into epidermal and cortical cells through root hairs via non-selective cation channels. It may also enter into endodermis which does not have any casparian bands and suberin lamellae (White, 2001; Moore et al., 2002). But, plants display tolerance to NaCl stress either by excluding Na⁺ ions at the membrane level or by sequestering them into vacuoles (Shi et al., 2000; Garciadeblás et al., 2003; Apse and Blumwald, 2007), carried out by NHX family member proteins.

Three to four-fold increases in proline accumulation was noticed in tomato transgenics over that of WT. Cuin and Shabala (2005) demonstrated that exogenously supplied proline significantly reduces NaCl-induced K⁺ efflux from barley roots in a dose-dependent manner. Therefore, salt-stress-induced proline accumulation may prevent NaCl-induced K⁺ leakage from the cells under salt stress conditions and thus maintain ion homeostasis. Enhanced catalase and SOD activities were noticed in transgenics indicating that SbNHXLP and perhaps salt-induced proline may be protecting these enzyme activities. High proline accumulating lines of niger (Guizotia abyssinica) displayed significantly higher antioxidant enzyme activities compared to the lines that accumulate low levels (Sarvesh et al., 1996). Proline protected antioxidative enzyme activities in transgenic sorghum plants under NaCl stress (Reddy et al., 2015). Transgenics displayed reduced photochemical PSII activity compared to WT under salt stress, indicating less chlorophyll damage in transgenics. Our observations corroborate the results obtained by Singh and Dubey (1995) and Hasegawa et al. (2000). Redondo-Gómez et al. (2007) noticed a decline in stomatal conductance resulting in reduced photosynthetic rate. But, SbNHXLP transgenics displayed higher Fv/Fm ratio leading to better survival under salt stress like in transgenic sorghum (Reddy et al., 2015). Thus, SbNHXLP appears to be protecting photosynthetic as well as antioxidative enzyme activities.

Amiloride binds to specific signature sequence LLFIYLLPPI of NHX family members and inhibits their activity (Wu et al., 2011). Transgenic tomato overexpressing SbNHXLP showed reduced SbNHXLP activity due to amiloride binding in comparison with WT which are not exposed to amiloride inhibition indicating that SbNHXLP belongs to NHX family members. Our studies with Sodium Green dye demonstrated that transgenic root sections contained less Na⁺, compared to that of WT indicating SbNHXLP is associated with Na⁺ exclusion at the plasma membrane level like SOS1 protein. Consistent with this, decreased Na⁺ levels were noticed in tomato transgenics under NaCl stress compared to WT. This is due to the overexpression of SbNHXLP gene, which helps in Na⁺ exclusion at the plasma membrane level. Like SOS1, SbNHXLP is perhaps playing a pivotal role in Na⁺ efflux being a transmembrane protein. These results indicate that plants use alternate or multiple genes for Na⁺ exclusion with redundant functions. Ion accumulation patterns point out more accumulation of Na⁺ in stems in comparison to root, flower, and leaf. It has been found out earlier that SOS1-like Na⁺/H⁺ exchanger retrieves Na⁺ from the xylem, and thus limits the rates of Na⁺ transport from the root to the shoot/leaf (Zhu et al., 2015). It appears that by retaining Na⁺ in the stems, SbNHXLP prevents Na⁺ from reaching leaves which are sensitive to the toxic levels of Na⁺ ions. Less accumulation of Na⁺ was also observed in other SOS1 transgenic species like tomato (Olías et al., 2009) and tobacco (Yue et al., 2012). Concurrently, significant accumulation of K⁺ was noticed in transgenic tomato, thus balancing ion homeostasis as has also been noticed in SOS1 transgenics (Rodriguez-Rosales et al., 2008). Calcium Green indicator displayed slightly higher calcium levels in transgenics in the present study. This is again consistent with slightly increased levels of Ca²⁺ ions in stem, leaf, and flower tissues of transgenics compared to WT.

In the present study, salt treated WT plants recorded significantly reduced secondary growth indicating that saline stress delays the process of xylogenesis in roots and stems of tomato plants. Salt treated transgenics displayed higher amount of xylem compared to that of treated WT. In soybean roots, NaCl retarded primary xylem differentiation due to delayed expression of alternate oxidase gene, but subsequently accelerated the secondary xylem differentiation (Hilal et al., 1998). In poplar, salt stress reduced the radial size of cambium and xylem differentiation has been curtailed due to diminished nutrients (Escalente-Perez et al., 2009). Enhanced xylem production in salt treated transgenic tomato plants suggests that there may not be any alternations in supply of nutrients to the cambium. Xylem in the salt exposed plants often contains vessels with small diameter than those that are grown devoid of it (Baum et al., 2000). Salt tolerant poplars showed less vessel diameter compared to salt sensitive ones (Junghans et al., 2006). We report here occurrence of multiple vessels with thicker walls in transgenics unlike that of WT. In poplar, salt stress negatively influenced the expansion of xylem vessels by decreasing biosynthesis and transport of auxin (Junghans et al., 2006). The change in vessel diameter may influence the rate of hydraulic conductivity. The large diameter vessels in the roots of SbNHXLP transgenics indicate a tendency for proper conductivity of water and hence better tolerance under saline conditions. A distinct change in the structure/dimensions of vessel elements and fibers to achieve more wall thickness is the salient feature found in the salt tolerant transgenics. This feature could be associated with relatively high conduit wall reinforcement that facilitates prevention of vessel collapse under osmotic stress as pointed out by Hacke and Sperry (2001).

Devoid of salt stress, reduced fruit and seed sizes and increased number of fruits were observed in transgenics in comparison with WT. Mohammad et al. (1998) and Meloni et al. (2001) observed reduction in plant height, shoot weight, and number of leaves per plant under salt stress in tomato and cotton, respectively. It has been shown that transgenics driven by constitutive promoters suffer from undesirable phenotypes, such as stunted growth and reduced yield (Wang et al., 2013). But, how the transgene SbNHXLP enhances the fruit yield per plant under stress is not clearly known.

Our in silico analysis for PPI suggested that NHX interacts with a host of proteins, viz. members of NHX, CHX and our experiments with co-immunoprecipitation corroborate the same in silico hypothesis. Furthermore, our results on higher K⁺ accumulation in transgenic tomato plants are consistent with the assumption that SbNHXLP also performs the function of K⁺ acquisition like SOS1. SbNHXLP interacts with SlCHX2, a member of the CPA2 family and a putative K⁺ transporter in flowering plants (Sze et al., 2004; Chanroj et al., 2012). Mottaleb et al. (2013) found that CHX2 is localized to tonoplasts and plasma membranes and revealed that it mediates the transfer of Rb⁺ either from the vacuole to the cytosol or from the cytosol to the external medium. Since acquisition of K⁺ is inhibited under high NaCl concentrations, plants might have evolved multiple mechanisms to acquire K⁺ and to maintain ion homeostasis or high K⁺/Na⁺ ratio under these conditions by interacting with AKT1 and CHX2, which are associated with K⁺ transport. These findings suggest that SbNHXLP is not only involved in excluding Na⁺ from cytoplasm, but also in acquiring K⁺ and maintaining high K⁺/Na⁺ ratio in transgenics through its interaction with SlCHX2. SbNHXLP expression was consistently higher in the root than shoot tissues and was upregulated by salt stress.

Quantitative real-time PCR analysis revealed that the expression of SbNHXLP and SlCHX2 genes under NaCl and KNO₃ treatments remained higher in root tissues than stem, and leaf tissues. Earlier, SOS1 transcript levels have been found to be higher in Arabidopsis and tomato roots in response to salt stress (Shi et al., 2000; Olías et al., 2009). Similarly, Kant et al. (2006) observed increased expression of ThSOS1 in roots compared to shoots. Activation of CHX2 under salt stress and KNO₃ treatments is consistent with our view that it may help to acquire more K⁺ under salt stress for maintaining proper ion homeostasis.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.