Surface sterilization of bread wheat seeds (cv. Chinese Spring) was done with the solution having 1.2% sodium hypochlorite in 10% ethanol. Thereafter, the seeds were washed carefully with the double autoclaved water. The sterilized seeds were kept overnight on moist Whatman filter papers at 4°C for stratification and were further kept at room temperature for germination. The seedlings were then transferred to fresh phytajars and were allowed to grow in plant growth chambers under 60% relative humidity, 22°C temperature, and a 16 and 8 hours (h) light and dark period, respectively (Lei et al., 2021). For the stress treatments, the 7-days-old seedlings were kept under heat (40°C), osmotic [20% Polyethylene glycol (PEG)], and combined heat and osmotic stress treatments (40°C and 20% PEG) for 6, 12, 24, and 48 h. Similarly, for salinity stress, 7-days-old seedlings were subjected to 150 mM NaCl treatment for 6, 12, 24, and 48 h. However, for the control plants, the seedlings grown in normal conditions were used. The plant samples including roots and shoots were collected at the interval of 6, 12, 24, and 48 h of stress treatments and stored at –80°C till further experiments. These stress conditions were selected based on the earlier reports. Further, the RNA seq data of T. aestivum used for the in silico expression analyses were generated under the same conditions (Liu et al., 2015; Zhang et al., 2016).

Extensive BLAST searches were used to identify the TLP proteins in five different cereals including B. distachyon, O. sativa, S. bicolor, T. aestivum, and Z. mays. Arabidopsis TLP sequences were used as a query against the protein model sequences of each crop downloaded from the Ensembl Plants (Petre et al., 2011; Sharma A. et al., 2020). The presence of the thaumatin (PF00314) domain was analyzed using the Hidden Markov Model (HMM) and Pfam BLAST searches at an e-value 10^––10. Identified TLP sequences were further subjected to the NCBI Conserved Domain Database (CDD) BLAST to further confirm the presence of the thaumatin domain. The TLP proteins, having a complete thaumatin family signature, were selected for further analysis. The identified TLPs were named as per their sequence of occurrence at various chromosomes in each crop, except T. aestivum. The international rules for gene symbolization of T. aestivum¹ were followed for the nomenclature of TaTLPs.

Ensembl Plant² was used for gathering the chromosomal and sub-genomic location of TLPs of all five crops. The homeologous TLP genes in T. aestivum were identified based on ≥ 90% sequence similarity and their occurrence at the related chromosomes. The MapInspect software was used for the graphical representation of TLP genes on their respective chromosomes.³ DEs were identified using a bidirectional blast hit approach with sequence similarity of ≥ 80%, while tandem and segmental DEs were segregated based on their distance and occurrence at respective chromosomes as per the previous studies (Shumayla et al., 2019).

The Muscle and Multalin tools were used for the multiple sequence alignments of all the TLPs with a known thaumatin protein (P02883.2| THM1_THADA) to find the conserved residues (Corpet, 1988; Edgar, 2004). The phylogenetic tree was constructed by the maximum likelihood method with 1,000 bootstraps using the MEGA X software (Kumar et al., 2018).

The alignment of the protein and nucleotide sequences of the paralogous gene pairs was done using the ClustalOmega server.⁴ The synonymous substitution per synonymous site (Ks), the non-synonymous substitution per non-synonymous site (Ka), and their ratio (Ka/Ks) were calculated using the PAL2NAL program (Suyama et al., 2006; Nagaraju et al., 2020). The calculation of the divergence time of each pair of duplicated genes was done using the formula T = Ks/2r, where T represents the divergence time and r represents the divergence rate. The divergence rate was assumed to be 6.5 × 10^–9 for cereals (Gaut et al., 1996). The Tajima’s relativity test was performed to find out the evolutionary rate between paralogous genes (Tajima, 1993).

The genomic and coding DNA sequence (CDS) of identified TLP genes were used for the analysis of gene structure in terms of exon-intron organization and intron phases using the GSDS 2.0 server as done in earlier studies (Hu et al., 2015; Sharma H. et al., 2020).

Various physicochemical characteristics such as peptide length, MW, and isoelectric point (pI) were analyzed using the ExPasy tool, which were further confirmed from the Ensembl plants and Sequence Manipulation Suite (Stothard, 2000; Gasteiger et al., 2005; Nussbaumer et al., 2013). Tools including CELLO v.2.5, ngLOC, ProtComp9, and WoLF PSORT were used for the prediction of subcellular localization of TLP proteins (Emanuelsson et al., 2000; Yu et al., 2006; Horton et al., 2007; King and Guda, 2007). Tools such as Phobius and DAS-TMfilter were used for the prediction of transmembrane regions (Cserzo et al., 2004; Käll et al., 2004). The signal peptides were detected using the tools Phobius and SignalP (Käll et al., 2004; Petersen et al., 2011). SMART server was used for the domain analysis, whereas, motifs were analyzed using MEME v.4.11.4 (Bailey et al., 2009; Letunic et al., 2015).

For cis-regulatory elements analysis, 1.5 kb upstream genomic sequences from the initiation codon were retrieved for each TLP gene. These promoter sequences were analyzed using the PLACE software (Higo et al., 1998). The identified cis-regulatory elements were categorized based on their functions.

Expression analysis in various tissues of each crop was done using the high throughput RNA-seq data retrieved from the Unité de Recherche Génomique Info (URGI) database⁵ and Expression ATLAS (Choulet et al., 2014; Pingault et al., 2015; Papatheodorou et al., 2018). In T. aestivum, the expression data generated in replicates for various tissue developmental stages, under biotic (fungal pathogen) and abiotic (heat, osmotic and salt) stress conditions in various studies, were used (Zhang et al., 2014, 2016; Liu et al., 2015). Data available for three developmental stages of root, stem, leaf, spike, and grain were used to analyze the tissue-specific expression in wheat. Further, the RNA-seq data (PRJNA243835) available in triplicates after the 24, 48, and 72 h of inoculation of Blumeria graminis f. sp. tritici (Bgt) and Puccinia striiformis f. sp. tritici (Pst) in 7-days-old seedlings were used for the TaTLP expression analysis under biotic stress (Zhang et al., 2014). Under abiotic stress conditions, duplicate RNA-seq data (SRP045409) for 1 and 6 h of treatments of heat (40°C), osmotic (20% PEG 6000), and a combination of both heat and osmotic stresses were used to study the TaTLP expression (Liu et al., 2015). Moreover, Liu et al. (2015) used the term drought stress for PEG treatment, but in the current study, the term osmotic stress has been used for PEG treatment because it actually causes osmotic stress that leads to water stress. Root RNA-seq data (SRP062745) available in triplicates for the treatment of 150 mM NaCl at 6, 12, 24, and 48 h were used to analyze the expression of TaTLPs under salt stress (Zhang et al., 2016). Trinity package was used to calculate the expression value in terms of fragments per kilobase of exon per million mapped fragments (FPKM) value (Haas et al., 2013). Hierarchical Clustering Explorer 3.5 was used to generate heat maps of differentially expressed genes, which were clustered using the Euclidean distance method (Seo et al., 2006).

The 7-days-old seedlings treated with various abiotic stresses were harvested after the 6, 12, 24, and 48 h of stress treatments. The root and shoot tissues of these seedlings were used for the total RNA isolation. The total RNA of each sample was isolated using the Spectrum™ Plant Total RNA kit (Sigma, United States). The seedlings (shoot and root) grown under normal conditions were used as a control. The TURBO DNA-free ™ Kit (Invitrogen, United States) was used to remove the genomic DNA contamination. The qualitative and quantitative analysis of RNA were done using agarose gel electrophoresis and NanoDrop quantification, respectively. The Superscript III First-Strand Synthesis Super-mix (Invitrogen, United States) was used to synthesize the cDNA from one microgram of total RNA. A real-time qRT-PCR was performed with the gene-specific primers of selected genes using SYBR Green at the 7900 HT Fast Real-Time PCR System (Applied Biosystems) following the method established in our laboratory (Shumayla et al., 2019). The fold expression change was calculated using the delta-delta CT method (2^–ΔΔCT) using the expression of ADP-ribosylation factor (TaARF) as an internal control as reported in earlier studies (Livak and Schmittgen, 2001; Shumayla et al., 2019; Tyagi et al., 2021). All the experiments were carried out in three biological replicates and expressed as mean ± SD. A significant difference between the control and treatments was examined by using the two-tailed student’s t-test.

The full-length open reading frame (ORF) of the TaTLP2-B gene was amplified from cDNA using the TaTLP2-B forward (5′ GTAATGGCTCTTCTTCCTCCTCTGCTTCTG 3′) and TaTLP2-B reverse (5′ AATCTGGGCCACACGATCGCCCC 3′) primers. The amplified DNA was cloned into the pJET1.2 cloning vector and sequenced. TaTLP2-B gene was re-amplified from the confirmed clone using the same primers and ligated into the pYES2.1/V5-His-Topo vector (Invitrogen, United States). The recombinant plasmid (pYES2.1-TaTLP2-B) was transformed in S. cerevisiae (W303) (yeast) cells for further characterization. For control, lacz gene containing pYES2.1 vector (pYES2.1/V5-His/lacZ) was used during the studies. Spot assays using recombinant yeast cells were performed under various abiotic stress conditions. Recombinant yeast cells were grown overnight in SD/-ura (with 2% dextrose) medium at 30°C and 200 rpm as primary culture and further inoculated for secondary culture (1:100 dilutions). As soon as OD₆₀₀ reached 0.4, 2%, galactose was added to induce the expression of recombinant protein in yeast and kept at 30°C and 200 rpm for 6 h. The OD₆₀₀ was adjusted to 0.4 and an equal volume (500 μl) of each induced culture was further diluted in 10 ml medium. The diluted cultures were treated with heat (37 and 40°C), cold (4°C), osmotic (20 and 30% PEG), combined heat and osmotic (37°C, and 30% PEG), and salt (1 M NaCl) stresses for 24 h, separately. After the treatments, serial dilutions (10⁰, 10^–2, 10^–4, and 10^–6) were prepared, 5 μl of each dilution was spotted on SD/-ura agar plates, and incubated at 30°C for 2–3 days as reported in earlier studies (Shumayla et al., 2019). All the experiments were performed in triplicates and the results were compared visually.

Subcellular localization of TaTLP2-B protein was analyzed using CaMV35S-driven C-terminal yellow fluorescent protein (YFP) fusion construct generated by Gateway LR-recombination into binary vector PEG101. Plasmids were then transformed into Agrobacterium tumefaciens GV3101 strain. The cells were resuspended in a freshly prepared infiltration medium (10 mM MgCl₂, 10 mM MES/KOH, pH 5.7 and 150 μM acetosyringone). The resulting constructs were infiltrated onto the abaxial surface of Nicotiana benthamiana leaf and kept at 22°C for 48 h. The YFP fluorescence was observed using the Leica TCS SP8 (Leica Microsystems, Wetzlar, Germany) laser-scanning confocal microscope at 514–527 nm.

Numerous properties of TLPs ascribed to defense and development pathways and lack of such studies in numerous cereals lead us to perform a comprehensive analysis of the TLP family in five major cereals. An extensive BLAST search identified 26, 27, 39, 93, and 37 TLP genes in B. distachyon, O. sativa, S. bicolor, T. aestivum, and Z. mays, respectively. The genes lacking or having incomplete thaumatin signature motifs were excluded from the study. Four TLPs were identified as small TLPs (sTLPs) in each B. distachyon, O. sativa, and Z. mays, while 10 and 20 sTLPs were detected in S. bicolor and T. aestivum, respectively (Supplementary File 1). In the case of T. aestivum, the identified TLP genes from the A, B, and D sub-genomes formed 32 homeologous groups based on their sequence homology (≥90%). All of the identified proteins exhibited a complete thaumatin signature motif (Supplementary Figure 1).

The chromosomal localization suggested the scattered distribution of the TLP genes at the majority of chromosomes in each crop (Figure 1). In B. distachyon, chromosome 4 consisted of a maximum of 10 TLP (both long and small) genes, while in the case of O. sativa, S. bicolor, T. aestivum, and Z. mays, the majority of genes (6, 11, 18, and 11) were localized on chromosomes 12, 8, 5A, and 1, respectively.

Thaumatin-like proteins consist of various characteristic and conserved residues, which are important for their functional activities. Multiple sequence alignments of TLP proteins with a known thaumatin protein (P02883.2| THM1_THADA) revealed the identification of 16 and 10 conserved cysteine residues in the majority of long and small TLP proteins of the studied cereal crops, respectively. Moreover, 7–15 cysteine residues had also been observed in a few TLPs of O. sativa, S. bicolor, T. aestivum, and Z. mays. The REDDD motif was also found conserved in the majority of TLP proteins. However, in certain TLP proteins, a few amino acid residues (AAs) were replaced by other AAs having either similar or different properties. For instance, Arginine (R) was replaced by Lysine (K) or Asparagine (N). This could be responsible for the differential evolvement of various characteristic features of TLPs during evolution. The thaumatin signature motif, which is a characteristic feature of TLPs (Liu et al., 2010a), was found to be highly conserved in all the identified TLP proteins. Some other regions like FF hydrophobic motif and bottom of acidic cleft forming amino acids were also found to be well conserved (Figure 2 and Supplementary Figure 1).

The number of exons varied from one to three in O. sativa, while one to four in B. distachyon, S. bicolor, and T. aestivum. In the case of Z. mays, most of the TLPs consisted of one to three exons, while ZmTLP16, ZmTLP20, ZmTLP25, and ZmTLP33 exhibited eleven, seven, eight, and ten exons, respectively. Moreover, a total of 44% (98/222) identified TLPs were intronless. Intriguingly, all the sTLPs were intronless, except TaTLP6-A and TaTLP20-A1. The intron phase analysis revealed that the occurrence of a maximum number of introns in phase 1, followed by phase 2, while the least number of introns were in phase 0 (Supplementary Figure 2).

The functional nature of a protein depends upon the occurrence of domain composition. All of the identified cereals’ TLPs consisted of a thaumatin domain (PF00314), which confirmed that they are TLPs. The size of the thaumatin domain ranged from 202–217 AAs to 134–154 AAs in the long and small TLPs, respectively. In addition to the thaumatin domain, ZmTLP16, ZmTLP20, ZmTLP25, and ZmTLP33 also consisted of a nuclear protein 96 (NUP96) domain of ∼211 AAs at the C-terminus of these proteins (Supplementary File 3).

Motif investigation revealed the occurrence of 10 highly conserved motifs in the TLP proteins. Motifs 1–9 were parts of the thaumatin domain, while motif 10 was unknown. Motifs 5, 6, and 8 were the most conserved motifs in TLP proteins, in which the thaumatin signature sequence was present in motif 8 (Supplementary Figure 2). The occurrence of conserved motifs across the cereal species suggested the conserved nature of TLP proteins in related plant species.

To understand the various important features, several physicochemical properties of identified TLPs were studied. The TLPs were analyzed for MW, peptide length, isoelectric point (pI), subcellular localization, transmembrane (TM) helix, and signal peptide (Supplementary File 4). The average length of the long and small TLPs ranged from 284–334 AAs to 175–185 AAs in the studied cereal crops, respectively. Similarly, the average MWs ranged from ∼29–35 kDa to ∼17–19 kDa, respectively. However, the average pI ranged from 5.89 to 6.95 and from 4.90 to 6.82 for the long and small TLPs, respectively (Table 3 and Supplementary File 4).

The majority of TLP proteins lacked TM helices, which suggested their soluble/cytoplasmic nature. However, five TLPs of B. distachyon and O. sativa, seven of T. aestivum and Z. mays, and 10 TLPs of S. bicolor consisted of a single TM region, and OsTLP18, TaTLP4-D, and TaTLP5-D comprised of two TM helices, which suggested their membrane-bound nature (Supplementary File 4).

A total of 23, 21, 36, 86, and 33 TLPs of B. distachyon, O. sativa, S. bicolor, T. aestivum, and Z. mays consisted of the N-terminal signal peptide, respectively. Further, the majority of TLP proteins were predicted to be localized in the extracellular region, while three TLPs from O. sativa (OsTLP10, OsTLP15 and OsTLP16) showed nuclear, and BdTLP16, TaTLP21-A, ZmTLP20, ZmTLP25, and ZmTLP33 showed plasma membrane localization (Supplementary File 4). To validate the subcellular localization, a TLP gene (TaTLP2-B) was cloned and expressed with YFP as a translational fusion protein. Analysis of YFP fluorescence of fusion protein confirmed its extracellular localization (Figure 4). Moreover, we could also see some fluorescence in the cytoplasmic region. The results suggested that the majority of TaTLP2-B was localized in the extracellular region, where it could be involved in various defense-related functions (such as anti-fungal etc.). The cytoplasmic localization could be due to its translation in the cytoplasm, or it might also function inside the cytoplasm.

Promoter elements are necessary for the regulation of gene expression under different conditions. Therefore, we performed the cis-regulatory analyses of TLPs to foresee their regulatory mechanisms. Based on their putative functions, the identified cis-regulatory elements were segregated into four groups; growth and development, light, hormone, and stress-responsive elements (Supplementary Table 1). The promoter regions of TLP genes comprised of several growth-related elements including TE2F2NTPCNA, EBOX, RYREPEAT4, RAV1AAT, POLLEN1LEAAT52, and so on. In the case of light-responsive elements, GT1CONSENSUS, GATA box, GBOXLERBCS, BOXII, and IBOXCORE were some common cis-regulatory elements. However, under the hormonal responsive category, DPBFCOREDCD3, ARFAT, ARR1, ERELEE4, and GARE10OSREP1 were abscisic acid, auxin, cytokinin, ethylene, and gibberellic acid-responsive elements, respectively.

Expression analysis of genes is a significant way to understand their involvement in various developmental and physiological processes. Previously, TLPs are reported to be involved in plant growth and developmental processes (Munis et al., 2010; Li Z. et al., 2020). Therefore, we performed the expression analysis of TLPs under various tissues and their developmental stages using the high-throughput RNA-seq data retrieved from the URGI database and Expression ATLAS (Choulet et al., 2014; Pingault et al., 2015; Papatheodorou et al., 2018). A total of 23, 27, 37, 84, and 29 TLP genes showed expression in one or more tissue developmental stages in B. distachyon, O. sativa, S. bicolor, T. aestivum, and Z. mays, respectively (Figures 5A–E). Based on expression profile, these genes were clustered into 3–5 groups in various crop species. BdTLPs of group 1 were highly expressed in early and emerging inflorescence stages, while BdTLP9 and BdTLP12, and BdTLP20 and BdTLP23 were upregulated in endosperm and embryo, respectively. Group 2 genes were highly expressed in the leaf, pistil, embryo, and endosperm tissues. However, group 3 genes were highly expressed at 10 days after pollination (DAP) of seeds; moreover, BdTLP8 and BdTLP18 were upregulated in the pistil, as well (Figure 5A). In O. sativa, the majority of group 1 genes were highly expressed in seed, group 2 in callus, group 3 genes in the shoot, group 4 in inflorescence, and group 5 genes in emerging inflorescence and anther (Figure 5B). In S. bicolor, group 1 and group 4 genes showed higher expression in root and leaf tissues, respectively. However, groups 2 and 3 TLP genes were highly expressed in various reproductive tissues like anther, pistil, endosperm, embryo, and flower (Figure 5C).

In T. aestivum, the majority of group 1 genes exhibited higher expression in root tissue followed by the shoot. However, most of the groups 2, 3, and 4 TLP genes were highly expressed in various developmental stages of spike and grain tissues (Figure 5D).

In the case of Z. mays, group 1 genes showed significant expression in unpollinated silk, pericarp, and aleurone layer. While the majority of group 2 genes were specifically upregulated in the root tissues, and group 4 genes in the leaf and internode tissues. Group 3 genes were specifically upregulated in the embryo (Figure 5E). These results suggested the role of TLP genes in both vegetative and reproductive tissues development in all the studied cereal crops. However, the higher expression of a few genes in a specific tissue or developmental stages suggested their precise role in particular tissue development.

Since TLPs belong to the defense-related protein family and are well known for their stress-responsive behavior. Therefore, the expression analysis of TaTLP genes was also performed under various biotic and abiotic stress conditions to reveal their roles in stress resistance (Zhang et al., 2014, 2016; Liu et al., 2015). For biotic stress, the available RNA-seq data generated at 24, 48, and 72 h of infestation of two important fungal pathogens, namely, Bgt and Pst were used for expression analysis (Zhang et al., 2014). In T. aestivum, a total of 50 TaTLP genes exhibited differential expression (≥ 2 fold) in these stress conditions, which could be clustered into four groups (Figure 6A). The majority of group 1 TaTLP genes were upregulated at 24 and 48 h of Bgt infestation. However, all the group 3 and 4 TaTLP genes were significantly upregulated at the late (72 h) and early (24 h) periods of Pst infestations, respectively. TaTLP3-A2, TaTLP12-A, and TaTLP32-A were the most upregulated genes after Bgt infection with 37, 36, and 35 folds, respectively. However, in the case of Pst infestation, TaTLP10-A (51 fold up) and TaTLP27-D (17 fold up) were highly upregulated.

Abiotic stresses are another major threat to plants, which affect various physiological and biological processes. To understand the putative role of TaTLPs under abiotic stress conditions, expression analysis was carried out under osmotic (OS), heat (HS), and combined heat and osmotic (HO) stresses using online available RNA-seq data (Liu et al., 2015). A total of 52 TaTLPs exhibited significant differential expression in these stresses, which formed four clusters in the heat map (Figure 6B). Almost all the genes of group 1 were downregulated in the OS, HS, and HO stresses, except TaTLP12-A that was slightly upregulated in OS treatment. In the case of group 2, the majority of genes were upregulated at 6 h of OS, HS, and HO treatments, while either unaffected or downregulated at 1 h of treatment. These might be the late responsive TaTLP genes. Most of the group 3 and group 4 TaTLP genes were found to be OS and HS responsive, respectively.

Expression analysis of the TaTLP genes was also performed at 6, 12, 24, and 48 h of salt stress using available RNA-seq data (Zhang et al., 2016). Out of 93 genes, 63 TaTLP genes were found to be differentially expressed under salt stress, which were clustered into 4 groups, based on their expression patterns (Figure 6C). All the group 1 genes were downregulated at all the stages of salt stress treatment. In contrast, all the group 3 genes were found significantly upregulated at 48 h of treatment. However, group 2 genes were upregulated at the early stage (6 h) of treatment, while they get normalized at later stages. The results suggested that the group 2 and group 3 genes are early and late responsive TaTLP genes, respectively.

In addition to in silico analysis, qRT-PCR analyses of eight TaTLP genes were performed using the gene-specific primers at similar heat, osmotic, and salt stress treatments for the validation of expression profile (Figures 7A–P and Supplementary File 5). Overall, the result was in agreement with the expression observed using RNA-seq data, with a few exceptions. In the case of heat stress, TaTLP2-B, TaTLP7-D, TaTLP14-B1, and TaTLP25-B were more upregulated at 1 h, while other genes were highly upregulated at 6 h of treatment. In the case of osmotic stress, TaTLP-7D was exclusively more upregulated at 1 h, whereas other genes were upregulated at 6 h. However, TaTLP2-B and TaTLP10-D were downregulated at OS 1 h. The majority of genes were highly upregulated at 1 h HO treatment. In the case of salt stress, seven genes were highly upregulated at 12 h of salt stress, except TaTLP14-B1 that showed maximum expression at 48 h. The results further confirmed that a few TaTLP genes are early while others are late responsive.

To understand the function of duplicated genes, a comparative expression profiling of each paralogous pair was performed. Generally, based on expression pattern, duplicated genes could categorize into the retention of function, pseudo-functionalization, and neo-functionalization. Out of the six paralogous gene pairs, three pairs (TaTLP1-A-TaTLP24-D, TaTLP1-B-TaTLP24-B, and TaTLP15-A-TaTLP18-B) showed a similar trend of expression, which suggested retention of function in these duplicated genes (Figures 8A–C). Two duplicated pairs (TaTLP12-D-TaTLP13-D and TaTLP16-A-TaTLP17-A) showed insignificant expression of one of the gene suggested pseudo-functionalization (Figures 8D,E). Retention of function in the majority of duplicated genes and the absence of neo-functionalization suggested functional conservation in TLP genes during evolution.

In our study, since the TaTLP2-B exhibited significant differential expression under abiotic stress conditions, it was selected for functional characterization. TaTLP2-B ORF was amplified using end primers and cloned into the pYES2.1 yeast expression vector. The LacZ gene-containing vector was used as a control (Figures 9A–F). In the spot assay, we observed similar growth of both control (LacZ) and TaTLP2-B expressing yeast cells in the controlled conditions (Figure 9A). Since the yeast optimum growth temperature is 30°C, we used 37 and 40°C for heat stress treatment. However, we observed higher growth inhibition at 40°C treatment, therefore, 37°C treatment was used for further analysis. In the case of 20% PEG, we could not see significant difference at the lower dilutions, therefore 30% PEG was used for further analysis. Similarly, less than 1 M NaCl could not cause significant inhibition at lower dilutions. The results revealed that in the case of cold (4°C), osmotic (30% PEG), heat, combined heat and osmotic (37°C and 30% PEG), and salt (1M NaCl) stress conditions, TaTLP2-B recombinant cells exhibited higher growth than the control cells (Figures 9B–F). The results suggested that the overexpression of the TaTLP2-B provided abiotic stress tolerance to the recombinant yeast cells. This gene can be used for the development of abiotic stress-resistant transgenic crops in future studies.