Arabidopsis (Arabidopsis thaliana) of the ecotype Columbia-0 (Col-0) were used for this study. yuc4-1 (SM_3_16128), yuc1 (SALK_106293) and pYUC::GUS transgenic plants were described in Cheng et al., 2006 and Xu et al., 2017. Seeds were treated with 70% (v/v) ethanol, followed by surface sterilization [6% (w/v) antiformin, 0.04% (v/v) Triton X-100] for 10 minutes and 3 washes with ddH₂O. Seeds were vernalized for 2 days and germinated on Murashige and Skoog (MS) media [1/4x MS salt (Sigma), 0.5% (w/v) sucrose, 0.6% (w/v) gellan gum, pH 6.4] in 23°C under constant light (70 µmol/sm²).

Auxin analogues and auxin synthesis inhibitors were dissolved in dimethyl sulfoxide (DMSO), then added to media at the following final concentrations: 2,4-D, IAA and NAA: 0.1 µM, L-kynurenine:10 µM, yucasin: 50 µM. Seedlings were transferred to media with hormones or auxin synthesis inhibitors 1 day after RKN inoculation for 24 hours, before returning to untreated MS media.

The maintenance, harvesting and sterilization of root-knot nematodes (Meloidogyne incognita) collected from Koshi city, Kumamoto prefecture, Japan were essentially performed as described in Nishiyama et al., 2015. Five day-old Arabidopsis seedlings were inoculated with RKN at 80 J2s per seedling, then incubated in 25°C under the short-day light cycle [8 hours light (70 µmol/sm²), 16 hours dark]. Galls were counted and diameters measured at 14 days post-inoculation (DPI), and egg masses were counted at 42 DPI. Diameter is defined as the longest distance across a gall perpendicular to the axis of the root.

Cyst nematodes (Heterodera schachtii; Austria) were kindly provided by J. Hofmann (BOKU University; Austria) and propagated in mustard roots (Sinapsis alba cv Albatros) grown in Gamborg medium (Gamborg et al., 1968) with 3% sucrose and 0.8% Daishin agar (pH 6.4) at 23°C in darkness as described by Bohlmann and Wieczorek (2015). Egg hatching was stimulated in 3 mM ZnCl₂ (Bohlmann and Wieczorek, 2015). CN infections of Arabidopsis were performed as described in Olmo et al. (2017). 7 day-old seedlings were inoculated with 20-30 J2 per plant, root segments containing syncytia were hand-dissected for GUS assays at the infection stages indicated in the figures legend. The numbers of females and males in the yuc4-1 plants were counted at 14 DPI under a stereomicroscope.

For RKN acid fuchsin staining, seedlings were harvested and washed with ddH₂O, then cleared with 1% (v/v) antiformin for 5 minutes. Seedlings were then washed with ddH₂O twice, and stained with 30 fold-diluted acid fuchsin [0.35% (w/v) acid fuchsin in 75% (v/v) acetic acid] at 100°C for 10 minutes. Cooled samples were washed twice with ddH₂O, then de-stained with acidified glycerol (1.2 mM HCl in glycerol).

Promoter-GUS staining were performed essentially as described in Cabrera et al., 2014. Tissue samples were fixed in 90% (v/v) acetone for at least a day. Samples were washed with ddH₂O then incubated in GUS staining solution {100 mM NaPO₄, 10 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0, K₃[Fe(CN)₆] and mM K₄[Fe(CN)] (0.5 mM for CN-infected plants, 3 mM for all other samples), 0.01% (w/v) Triton X-100, 0.5 mg/ml 5-bromo-4-chloro-3-indolyl-β-glucuronidase} in 37°C for 4 hours (uninfected and 1~7 DPI samples) or overnight (14~42 DPI samples). Reactions were stopped by incubating the samples 90% (v/v) ethanol and 10% (v/v) acetic acid. Samples were cleared and mounted using 80% chlorohydrate (w/v) in 33% (v/v) glycerol.

For toluidine blue-stained sections, tissues were vacuum-infiltrated with fixative [2% (v/v) glutaraldehyde, 0.02 M cacodylic acid] for 30 minutes, then incubated in 4°C overnight. Samples were washed for 10 minutes 5 times with 20 mM cacodylic acid, then dehydrated through an ethanol gradient (50%, 75%, 90%, 95% each 10 minutes, then 100% for 20 minutes). Samples were then transferred to a 1:1 ethanol:Technovit 7100 (Kulzer) mixture and shaken in room temperature for 2 hours, then transferred to a pre-embedding solution [1% (w/v) sulfurizing reagent I in Technovit 7100] and shaken overnight in room temperature. Samples were submerged in embedding solution [6.6% (v/v) sulfurizing reagent II in pre-embedding solution] then incubated in 40°C overnight. Sample blocks were sectioned to 3~5 µm thickness using a Leica RM2255 microtome, then mounted using ddH₂O and incubated in 60°C overnight. Samples were stained in 0.025% (w/v) toluidine blue (Waldeck) and 0.04% neutral red for several minutes, then mounted with EUKITT (O. Kindler).

CN-infected syncytia were imaged with Nikon SMZ1000, Olympus SZX16 stereomicroscope, or Nikon eclipse 90i microscope. All other microscopy works were performed using an Axio Imager M1 stereomicroscope (Zeiss) mounted with a DP71 digital camera (Olympus).

Extraction, purification and quantification of plant hormones were performed as described in Kanno et al. (2016).

RNA were extracted from plant tissue using the RNeasy Plant Mini Kit (Qiagen), then cDNA were synthesized using the PrimeScript RT Master Mix (Takara) according to the manufacturers’ instructions. 100 ng of cDNA per sample were used for transcript quantification using the FastStart Essential DNA Green Master and the Light Cycler 480 system (Roche) using the PCR program of 95°C 5 minutes, then 95°C 10 seconds, 60°C 10 seconds, 72°C for 10 seconds. GLYCEROLALDEHYDE 3-PHOSPHATE DEHYDROGENASE (GADPH) was used as internal control. Primers used for PCR include ARF5 (forward: ATCTCAACGGATCCAAATCG, reverse: GGGTCTCAGCTCTCAGTTGG), YUC4 (forward: ACGCATCTGGTCTATGGAATG, reverse: CGGACTTGTACGCACTGG), TAA1 (forward: CCCCACTACACTCCCATCACTC, reverse: TCACCAATGCCCACCCAATAC), GADPH (forward: TTAGTCGCAACCTGAAGCCATC, reverse: TTCCACTGCTACTTGACCTTCG). The expression levels of frequently used normalizer genes such as actin or ribosomal genes are altered in developing galls and GCs in Arabidopsis (Barcala et al, 2010), whereas GAPDH primers have been used for qPCR analyses to produce data consistent with reporter-GUS and microarray results (Barcala et al., 2010; Yamaguchi et al., 2017; Díaz-Manzano et al., 2019). Therefore, GAPDH used as a normalizer produce robust transcript data for developing galls in Arabidopsis.

In order to determine the role of auxin synthesis during RKN infection, Arabidopsis gall development was monitored in the presence of exogenous auxin or auxin synthesis inhibitors. L-kynurenine, the inhibitor of the enzyme TAA1 that converts Trp to IPA (He et al., 2011), and yucasin, the inhibitor of the enzyme YUC that converts IPA to IAA (Tsugafune et al., 2017), were used along with indole-3-acetic acid (IAA) and synthetic auxins 2, 4-dichlorophenoxy acetic acid (2,4-D) and naphthalene acetic acid (NAA) (Van Overbeek, 1959). To ensure these reagents exert their predicted effects, transgenic Arabidopsis plants with the pDR5::GUS and pARF5::GUS reporter constructs were used to monitor auxin accumulation and response patterns in RKN galls at 7 days post-inoculation (DPI). In the presence of auxin synthesis inhibitors, the pDR5::GUS signals were fully abolished in galls, and the pARF5::GUS signals were reduced to be found only in the vasculatures, even though the auxin maxima in the root tips remain unchanged ( Figure 1 ). On the other hand, both pDR5::GUS and pARF5::GUS signals were found to be prominent in lateral roots when IAA and synthetic auxins were applied ( Figure 1 ). These results confirm that dynamic auxin synthesis activities occur in galls during RKN infection.

Knowing that auxin likely plays a role during RKN infection, the effect of auxin synthesis on the development of galls were evaluated next. L-kynurenine and yucasin treatments cause significant reductions in gall diameters, while 2,4-D treatment significantly increased gall diameters at 14 DPI ( Figure 2A ). Unexpectedly, IAA did not significantly affect gall size, while NAA actually significantly reduced gall diameter ( Figure 2B ). Different synthetic auxins with different structures are predicted to show variations in their physiological effects, and such has indeed been observed in above-ground organs (Abebie et al., 2008). It is conceivable that similar variations may occur in gall development as well. In addition, gall numbers in plants treated with auxin synthesis inhibitors and synthetic auxins were analyzed at 14 DPI. 2,4-D treatment was found to significantly increase gall numbers ( Figure 2C ), while L-kynurenine, yucasin, IAA and NAA did not significantly affect gall numbers ( Figure 2C, D ). Since both auxin synthesis inhibitors tested reduced gall size, local auxin synthesis may play a positive role during RKN infection. On the other hand, as neither of the auxin synthesis inhibitors tested affected gall numbers, locally synthesized auxin does not appear to affect the invasion of RKN into roots.

To further delineate the role of auxin during gall formation, the expression patterns of auxin synthesis genes were examined in developing galls. Using the transcriptome data from Yamaguchi et al., 2017, the expression patterns of auxin synthetic genes TAA1 and the YUC genes were investigated over the first 7 days of RKN infection during RKN invasion and giant cell initiation. The expression levels of TAA1 and most of the YUC genes remain relatively stable over the first 7 days of infection, except YUC4 which was induced upon infection ( Supplemental Figure 1 ). To more comprehensively determine the role of YUC4 throughout RKN infection, the expression levels of YUC4 and TAA1 were examined by qRT-PCR over the entire course of RKN infection for up to 42 DPI. In addition, AUXIN RESPONSE FACTOR 5 (ARF5), an auxin response signaling component known to be induced by and positively regulates Meloidogyne javanica infection was also analyzed (Olmo et al., 2020). ARF5 transcript levels were found to rise fairly early at around 14 DPI and remained stable afterward, consistent with its expression pattern during M. javanica infection ( Figure 3A , Olmo et al., 2020). On the other hand, YUC4 transcript level increased modestly during early gall development, then rose prominently after 14 DPI ( Figure 3B ). On the contrary, TAA1 transcript level decreased rapidly after RKN infection, and remained relatively low after 10 DPI ( Figure 3C ). To further confirm the expression pattern of YUC4, transgenic plant with the pYUC4::GUS reporter construct was established. In the absence of RKN infection, the YUC4 promoter is active in the root tip, lateral roots and the distal ends of leaves ( Figure 4A ). Consistent with the transcriptome and qRT-PCR results, the YUC4 promoter activity gradually increased during gall formation ( Figure 4B ). pYUC4::GUS signals became difficult to observe beyond 28 DPI, although this may be because the GUS signals were present only in the centers of galls and are not visible externally ( Figure 4B ). These lines of evidence confirm that YUC4 is clearly induced by RKN infection, though YUC4 transcripts appear to accumulate relatively slow compare to fast responders such as ARF5.

Considering YUC4 synthesizes auxin while ARF5 responds to auxin, and that ARF5 is also significantly up-regulated during parasitic nematode infections (Olmo et al., 2020), the possibility that YUC4 regulates ARF5 expression during RKN infection was investigated. ARF5 transcript levels were quantified before and after RKN infection in Col-0 and the yuc4-1loss-of-function mutant (Cheng et al., 2006; Xu et al., 2017). However, there were no significant differences in ARF5 transcript levels between Col-0 and yuc4-1 plants ( Supplemental Figure 2 ). Together with the finding that ARF5 gets up-regulated before YUC4 upon RKN infection ( Figure 3 ), this implies YUC4 is unlikely to mediate the up-regulation of ARF5 during RKN infection.

To further evaluate the function of YUC4 during gall formation, RKN infection assays were performed using yuc4-1. For comparison, the YUC4 homologue YUCCA1 (YUC1), which is known to not be strongly up-regulated during RKN infection, was also analyzed (Cheng et al., 2006). No significant differences were detected in the numbers of galls, emerged mature females and egg masses from yuc1 when compared to Col-0 ( Figures 5A–C ). Interestingly, the numbers of emerged mature females and egg masses reduced significantly in yuc4-1 ( Figures 5B, C ), even though gall numbers remain unchanged ( Figure 5A ). This suggests YUC4 likely regulates late-stage RKN development within galls, but not the initial gall formation during early infection, unlike ARF5 which is known to prominently regulate gall formation frequency (Olmo et al., 2020). Furthermore, although no significant difference in gall diameters could be detected in yuc4-1 at 7 DPI ( Figure 5D ), yuc4-1 gall diameters were significantly reduced compared to that of Col-0 at 42 DPI ( Figure 5E ). The timing of ARF5 and YUC4 up-regulation induced by RKN infection appear to reflect their respective functions, where ARF5 acts early to regulate gall initiation while YUC4 acts late to promote gall growth and RKN maturation. The fact that YUC4 does not transcriptionally regulate ARF5 suggests these two genes likely function independent of each other during RKN infection.

One other hormone known to function in concert with auxin to regulate cell division and differentiation is cytokinin (Schaller et al., 2014; Di Mambro et al., 2017). Despite primarily known as a plant hormone, cytokinin has been shown to be secreted by cyst nematodes to mediate infections (Siddique et al., 2015). Similarly, cytokinin is also known to be secreted by RKN, although its role in infection has yet to be validated (De Meutter et al., 2003). Other plant hormones such as salicyclic acid, jasmonic acid and ethylene are known to be involved in plant pathogen response signaling, suggesting they are likely also involved in the responses toward plant parasitic nematodes (Kammerhofer et al., 2015; Molinari, 2016).

To determine whether the yuc4-1 RKN infection phenotypes are associated with reduced auxin synthesis, and whether other phytohormones are also involved with the yuc4-1 gall development defects, phyotohormone levels were quantified in the Col-0 and yuc4-1 galls at 14, 28 and 42 DPI where YUC4 is highly expressed ( Figure 3B ). Auxin/indole-3-acetic acid (Aux/IAA), abscisic acid (ABA), jasmonic acid (JA), JA isoleucine (JA-lle), cytokinin/trans-zeatin (CK/tZ) and salicyclic acid (SA) levels were measured. yuc4-1 galls showed a modest but significant reduction in Aux/IAA at 14 DPI as compared to the Col-0 ( Figure 6A ). However, no significant differences were detected in the levels of ABA, JA, JA-Ile and CK/tZ between Col-0 and yuc4-1 galls at 14 to 42 DPI ( Figures 6B–F ). Also, no significant differences in these hormone levels were detected between Col-0 and yuc4-1 from 1~14 DPI, where YUC4 is not as strongly expressed ( Supplemental Figure 3 ). Therefore YUC4 does not appear to strongly affect phytohormone levels during gall formation, except auxin at around 14 DPI. Nevertheless, the fact that yuc4-1 galls show reduced auxin level in galls at 14 DPI suggests the RKN maturation defects observed in yuc4-1 may indeed be caused by reduced local auxin biosynthesis.

Considering the importance of YUC4 in RKN infections, we also checked its putative role after the infection of another main group of plant endoparasitic nematodes, the cyst nematodes (CN, Heterodera schachtii). In CN-infected pYUC4::GUS transgenic Arabidopsis plants, YUC4 promoter activity was clearly detected and localized within the syncytia with a high percentage of GUS-positive syncytia at 7DPI ( Figures 7A–D ). YUC4 promoter activities remained with a detectable signal in syncytia at 14 and 23 DPI, although the percentage of GUS-positive syncytia decreased significantly over time ( Figures 7B–D ; p<0.05). This confirms that CN infection also induces YUC4 expression in syncytia similar to the galls in the RKN infection, although YUC4 promoter activity appears to decrease over the course of CN infection, in contrast to the slow increase during RKN infection.

To determine whether YUC4 function was also crucial during CN infection similar to RKN, the numbers of males and females per plant were determined in yuc4-1 plants as compared to that of the Col-0 control. Both, the number of males or females per plant or the total number of males plus females did not show significant differences between Col-0 and yuc4-1 ( Supplemental Figure 4 ). Thus, YUC4 function does not strongly regulate CN establishment, sex determination or syncytia formation within the host plants. However, we cannot preclude a partial contribution of YUC4 together with other YUCCA family members