Abstract
Lowland acidic soils with water-logged regions are often affected by ferrous iron (Fe2+) toxicity, a major yield-limiting factor of rice production. Under severe Fe2+ toxicity, reactive oxygen species (ROS) are crucial, although molecular mechanisms and associated ROS homeostasis genes are still unknown. In this study, a comparative RNA-Seq based transcriptome analysis was conducted to understand the Fe2+ toxicity tolerance mechanism in aromatic Keteki Joha. About 69 Fe homeostasis related genes and their homologs were identified, where most of the genes were downregulated. Under severe Fe2+ toxicity, the biosynthesis of amino acids, RNA degradation, and glutathione metabolism were induced, whereas phenylpropanoid biosynthesis, photosynthesis, and fatty acid elongation were inhibited. The mitochondrial iron transporter (OsMIT), vacuolar iron transporter 2 (OsVIT2), ferritin (OsFER), vacuolar mugineic acid transporter (OsVMT), phenolic efflux zero1 (OsPEZ1), root meander curling (OsRMC), and nicotianamine synthase (OsNAS3) were upregulated in different tissues, suggesting the importance of Fe retention and sequestration for detoxification. However, several antioxidants, ROS scavenging genes and abiotic stress-responsive transcription factors indicate ROS homeostasis as one of the most important defense mechanisms under severe Fe2+ toxicity. Catalase (CAT), glutathione (GSH), ascorbate peroxidase (APX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), and glutathione reductase (GR) were upregulated. Moreover, abiotic stress-responsive transcription factors, no apical meristem (NAC), myeloblastosis (MYB), auxin response factor (ARF), basic helix-loop-helix (bZIP), WRKY, and C2H2-zinc finger protein (C2H2-ZFP) were also upregulated. Accordingly, ROS homeostasis has been proposed as an essential defense mechanism under such conditions. Thus, the current study may enrich the understanding of Fe-homeostasis in rice.
1. Introduction
Iron (Fe) is an essential micronutrient, participating in various vital processes in cell metabolism due to its redox status between ferrous (Fe2+) and ferric (Fe3+) forms. Fe functions as an electron acceptor or donor actively participating in photosynthesis and respiration (Kobayashi and Nishizawa, 2012; Zhai et al., 2014). Lowland and flooded soil are poor in oxygen concentration and become acidic. The flooding of rice fields leads to the reduction of Fe3+ to Fe2+, which becomes highly toxic to paddy crops. Fe2+ toxicity is a major cause of abiotic stress affecting large rice-growing areas, especially in Asian countries (Becker and Asch, ). Depending on stress intensities, a loss of 12% to 100% has been reported on rice yields (Sahrawat, 2005; Audebert and Fofana, ). Fe2+ toxicity is a severe agricultural constrain that generally occurs in acidic soils. Thus, understanding the underlying molecular mechanisms associated with their adaptation may help to build strategies for future rice breeding programs for Fe2+ toxicity tolerance.
Angiosperms plants have evolved two acquisition strategies to overcome the limited Fe availability viz., strategy I and II. The strategy I is based on the acidification of rhizospheres by releasing protons from the roots, which reduces Fe3+ to Fe2+ and its transportation through iron-regulated transporter (IRT) across the root plasma membrane. Strategy II is based on the uptake of Fe3+ phytosiderophore complexes. Although being a Strategy II plant, rice (Oryza sativa L.) possesses Fe2+ transporter genes (OsIRT1 and OsIRT2) that can directly uptake Fe2+ from the soil (Bughio, ; Ishimaru et al., ). The mechanism of Fe2+ toxicity tolerance in rice plants has been highlighted in several studies (Asch et al., ; Deng et al., ; Wu et al., 2017; Aung et al., ; Aung and Masuda, ). Rice plants possess several defense mechanisms to cope with Fe2+ toxicity. The defense mechanism of rice plants for Fe2+ tolerance can be divided into four mechanisms (Aung and Masuda, ). Defense 1 (Fe exclusion from roots) is a root-based tolerance mechanism where Fe plaques (Fe3+ precipitation) on the root surface acts as a barrier to the uptake of Fe2+ into root tissues. Fe plaque is formed due to the rhizospheric oxidation of Fe2+ to Fe3+ by oxygen transport from shoots to roots (Asch et al., ; Becker and Asch, ). Defense 2 (Fe retention in roots and suppression of Fe translocation to shoots) where discrimination center and ferritin (OsFER) plays an important role by retaining excess Fe in root and avoiding translocation into the shoot. Defense 3 (Fe compartmentalization in shoots) includes compartmentalization, disposal, or storage of Fe inside shoots by vacuolar iron transporter (OsVIT1/OsVIT2), and OsFER1/2. Defense 4 [reactive oxygen species (ROS) detoxification] includes enzymatic detoxification, scavenging of ROS by antioxidants. Defense 1–3 was highlighted to work on mild to moderate Fe excess conditions and do not seriously affect rice growth. In contrast, defense 4 was hypothesized to work at a molecular level under Fe severe conditions that causes bronzing and inhibit plant growth and development (Aung and Masuda, ). ROS antioxidants like glutathione S-transferase (GST) and ascorbate oxidase were reported to play an important role in shoot-based Fe tolerance in rice plants (Wu et al., 2017). Besides, under severe Fe excess conditions, cytochrome P450 family proteins, OsNAC4, OsNAC5, and OsNAC6, played an important role in alleviating ROS (Aung and Masuda, ). The elucidation of the genes involved in response to Fe-toxicity is fundamental to understanding the mechanism that confers tolerance to stress and the development of tolerant cultivars. With the advancement of next generation sequencing (NGS) technology, the RNA-seq technique has become a valuable tool for transcriptional profile analysis, providing a better understanding of gene responses to Fe2+ toxicity. To date, many studies on the transcriptional profile of rice under Fe-stress have been done. However, there is still a broad spectrum that needs better clarification to understand the Fe stress mechanism, which can help to understand the unsolved queries related to Fe toxicity in rice.
In this study, the transcriptome of aromatic rice was analyzed in both root and leaves using RNA-Seq. Along with the common Fe-homeostasis-related genes, the study identified several differentially expressed genes (DEGs) related to the ROS scavenging system. The results provided a comprehensive transcriptome resource that may enrich the understanding of Fe-homeostasis under Fe2+ toxicity conditions.
2. Materials and Methods
2.1. Plant Growth and Treatment
The Keteki Joha rice variety seeds were collected from Regional Agricultural Research Station, Assam Agricultural University, Titabor, Assam, India (26.575626, 94.183318 and 99 m). Seeds were surface sterilized with 0.01% sodium hypochlorite (NaOCI) and germinated in Petri dishes by incubation at 28°C for 3-5 days. Germinated seedlings were grown in a plastic pots, containing 400 ml of Hoagland nutrient solutions, prepared in distilled water (Hoagland and Snyder, ). Rice seedlings were grown under controlled growth chamber Jeiotech GC-300TLH with 14 h light (Temp 28°C, RH 70%, illumination 8000 lux) and 10 h dark (Temp 22°C, RH 60%), conducted at Assam University Silchar, India (24.686545, 92.751699 and 31 m). About 3 weeks old rice seedlings were treated with 2.5 mM of FeEDTA for 72 h at pH 4.5. The FeEDTA solution was prepared as described by Steiner and van Winden (1970) with few modifications. For the mature stage, rice plants were grown in a pot [20.5 (D) X 15 CM (Height)] containing approximately 3.5 kg (dry weight) of alluvial soil collected from Silcoorie Grant, Silchar, India (24.728505, 92.747980 and 21 m). About 60–70-day old plants were treated with 5 L of 2.5 mM FeEDTA at pH 4.5 (prepared with Hoagland) for 2 weeks, and leave samples were harvested for RNA isolation and sequencing (Supplementary Figure S1). The FeEDTA solution was changed every 96 h. Three utterly independent pot experiments were considered as biological replicates (Supplementary Figure S2).
2.2. RNA Sequencing
RNA was isolated from both roots and leaves with 3 biological replicates using the RNAqueous Phenol-free total RNA isolation kit of Invitrogen, Thermo Fisher Scientific. RNA Integrity Number (RIN) value of more than 6.5 was used to prepare the sequencing library prepared by Truseq Stranded RNA Library Prep Kit-Plant (Illumina, USA). Finally, 100–150 bp RNA Seq was performed by Illumina HiSeq 2000 platform (Illumina, USA).
2.3. Data-processing, Assembly, and Differential Expression
Basic statistics of the sequencing raw reads were accessed by FastQC v 0.11.9 (FastQC, ). Raw reads were trimmed with Trimmomatic v 0.39 to remove sequencing adapters (Bolger et al., ). Reference-based assembly was performed by STAR v 2.7.1a, where Samtools v 1.7 was used to manipulate the bam files (Li et al., 2009; Dobin et al., ). Rice Genome Annotation Project was used as a reference sequence database for assembly (Kawahara et al., 2013). Transcript abundance was quantified using the featureCounts v 2.0.0 program of the Subread package (Liao et al., 2014). Differential gene expression was performed using the DESeq2 v 1.32.0 package of the R program (Love et al., 2014; R Core Team, 2021). Alternative shrinkage was estimated by apeglm method (Zhu et al., 2018). Adjusted p-value of ≤ 0.05 was considered as a significant difference in expression between groups. EnhancedVolcano v 1.10.0 and ComplexHeatmap v 2.8.0 package of R was used to represent the volcano and heatmap plots of the DEGs (Gu et al., ; Blighe et al., ).
2.4. Annotation
Transcripts were annotated using an in-house pipeline. Briefly, rice annotation data available in the UniProt database were downloaded, and local BLASTX was performed (Altschul et al., ; Apweiler et al., ). The best scoring results were merged with the transcript using the R program (R Core Team, 2021). Gene ontology (GO), sub-cellular localization, cross reference KEGG ID, and Pfam were considered during the UniProt annotation. Additional gene description was assigned using the gene annotation data available in the Rice Genome Annotation Project (Kawahara et al., 2013). Also, the corresponding RAPD gene id and gene symbol were assigned to the annotated transcript by using the R program (Sakai et al., 2013).
2.5. Gene Set Enrichment Analysis
Gene set enrichment analysis was done with the topGO of the R package (Alexa and Rahnenführer, ). The GO term of each locus was obtained from Rice Genome Annotation Project, and molecular function, biological process, and cellular component were studied for the selected top 1,000 DEGs (500 Up/500 down). GO terms were ranked by employing the Fishers' exact statistical test and classic algorithm of topGO. The ggplot2 package of the R program was used to represent the graphical representation (Wickham, 2016).
Metabolic pathways were studied using the KEGG database (Kanehisa and Goto, 2000). Briefly, all the protein sequences of the DEGs were downloaded from the Rice Genome Annotation Project database and re-annotated using GhostKOALA in the KEGG database (Kanehisa et al., 2016). Cross-reference KEGG gene ID of Oryza sativa, Japonica (osa), KEGG entry no T01015, and GHOSTX score ≥100 were considered for pathway mapping. Finally, the KEGG pathway was analyzed using the KEGG mapper. Expression value (log2FoldChange) of the DEGs were integrated into their corresponding KEGG gene of each sample, and multiple states pathway maps were rendered by the Pathview web tool (Luo et al., 2017).
2.6. Differential Exon-Usage of the DEGs
Differential exon usage of the DEGs was inferred by Bioconductor package DEXSeq (Anders et al., ). Briefly, the mapping was done with STAR, and transcript abundance was quantified with featureCounts as described above. The Subread to DEXSeq python script (https://github.com/vivekbhr/Subread_to_DEXSeq) was used to manipulate the featureCounts data to create the DEXSeq object.
2.7. Quantitative Real-Time PCR Analysis
Quantitative real-time PCR was performed to confirm the expression of RNA-Seq. Specific gene expression in both roots and leaves of treated (2.5 mM Fe) was compared with control (70 μM Fe). Briefly, about 100 mg of fresh tissues with 3 biological replicates were grounded to powder with Liquid Nitrogen (LN2). Total RNA was isolated using the RNAqueous Phenol-free total RNA isolation kit of Invitrogen, Thermo Fisher Scientific. The cDNA synthesis was performed using the iScript Reverse Transcription Supermix for RT-qPCR kit, Bio-Rad. Gene-specific primers were designed with Primer3web and a few more were also obtained from research articles (Aung et al., ; Che et al., ; Nozoye et al., 2019) (Table 1). Two individual actin gene was considered as reference genes for qRT-PCR analysis. The qRT-PCR was performed using the PowerUp SYBR Green Master Mix, Applied Biosystems and performed in QuantStudio 5 Real-Time PCR System, Applied Biosystems. Gene expression was calculated using the comparative CT method and normalized with two reference genes (Taylor et al., 2019).
Table 1
| Gene name | Primer sequences (5'–3') | References |
|---|---|---|
| OsTom1 | Fw- GCCCAAGAACGCCAAAATGA | |
| Rv- GGCTTGAAGGTCAACGCAAG | ||
| OsNAS1 | Fw- GTCTAACAGCCGGACGATCGAAAGG | |
| Rv- TTTCTCACTGTCATACACAGATGGC | ||
| OsB12D | Fw- CCGCCATGACCTTCGTCAC | |
| Rv- TGGTACTTCTCACCCTCCTC | ||
| OsVMT | Fw- GGACGATGGGTACTGCATTGAG | Che et al., |
| Rv- GGGAACAATGATGATATTGGTAAA | ||
| OsGST44 | Fw- GGAGGGAGAGAAGAAGAGCG | |
| Rv- TTGGAGGAGAGGAGCAGGG | ||
| OsFER1 | Fw- GTGAAGGGCAGTAGTAGGTTTCG | Aung et al., |
| Rv- CGCGCGACATACACATGATTCTG | ||
| OsIRT1 | Fw- ACCAGATGTTCGAGGGGATG | |
| Rv- CTGTTGTCCCTGTACACCCT | ||
| OsYSL15 | Fw- AGACGGGACATCTCACCTTG | Che et al., |
| Rv- GCCATGTTGCGGTAGATCAG | ||
| OsActin1 | Fw- ACACCGGTGTCATGGTCGG | Nozoye et al., 2019 |
| Rv- ACACGGAGCTCGTTGTAGAA | ||
| OsActin2 | Fw- CTTCTAATTCTTCGGACCCAAG | Nozoye et al., 2019 |
| Rv- CTGGTACCCTCATCAGGCAT |
List of primers used for the qRT-PCR.
2.8. Statistical Analysis
The statistical analysis of gene expression by qRT-PCR was analyzed with a minimum of 3 biological replicates. The significant mean difference between the treated (2.5 mM Fe) and control (70 μM Fe) was estimated by the student's t-test performed in the R program (R Core Team, 2021). Significant differences were represented with asterisks symbol (*p < 0.05; **p < 0.01; ***p < 0.001) compared with control.
3. Results
3.1. RNA Sequencing and Reference-Based Transcriptome Assembly
Growth of the rice plant was significantly inhibited under severe Fe2+ toxicity (Supplementary Figure S1). RNA-Seq transcriptome was performed and approximately 9.36–37.40 million 100-150 bp sequence reads were obtained from each sequencing run from which 41.59 to 72.27% were uniquely mapped into the Japonica rice genome (Supplementary Tables S1, S2). About 44% of GC content was observed among the sequencing reads. About 7,708 DEGs in roots, 8,271 in leaves seedling, and 12,885 in leaves mature stage were identified (Figures 1A–C).
Figure 1
3.2. Differentially Expressed Genes in Roots
Among DEGs, a total of 69 Fe homeostasis-related genes and their homologs were identified (Figure 2A). Most of the genes associated with Fe homeostasis were downregulated under Fe2+ toxicity. However, 13 Fe homeostasis related genes were upregulated in the roots, of which the genes phenolic efflux zero1 (OsPEZ1), vacuolar mugineic acid transporter (OsVMT), and acireductone dioxygenase 1/submergence-induced protein 2 (OsARD1/OsSIP2) were highly upregulated. Other upregulated genes include nicotianamine synthase 3 (OsNAS3), transporter of mugineic acid 3 (OsTOM3), mitochondrial iron transporter (OsMIT), root meander curling (OsRMC), OsFER1/OsFER2, ABC transporter of mitochondrion 3 (OsATM3), yellow stripe-like 13 (OsYSL13), FRD3-Like Protein 1 (OsFRDL1), natural resistance-associated macrophage protein 2 (OsNRAMP2), and positive regulator of iron homeostasis 2 (OsbHLH58/OsPRI2). The Fe2+ transporter OsIRT1, OsIRT2, OsNRAMP1, and Fe/Mn/Cd transporter OsNRAMP5 were downregulated. In addition, Fe-phytosiderophore transporters like OsYSL15 and OsYSL2 were also downregulated. Other downregulated genes include OsTOM1, OsNAS1, OsNAS2, mitochondrial iron-regulated gene (OsMIR), iron man (OsIMA1), phosphoribosyl pyrophosphate synthetase (OsPRPPS), dehydratase-enolase-phosphatase (OsDEP), Fe-deficiency-induced protein 4 (OsIDI4), basic helix-loop-helix protein 133 (OsbHLH133), deoxymugineic acid synthase 1 (OsDMAS1), ribose 5-phosphate isomerase (OsRPI), oligopeptide transporter 7 (OsOPT7), formate dehydrogenase (OsFDH), efflux transporter of nicotianamine 1 (OsENA1), iron-related transcription factor 2 (OsIRO2), OsNRAMP1, OsIDI2, FER-like Fe deficiency-induced transcription factor (OsbHLH156/OsFIT) etc. (Figure 2A). Besides, few Fe homeostasis related genes like OsVIT2, OsYSL10, small GTP-binding protein (OsRab6a), OsYSL9, OsTOM2, IDE-binding factor 2 (OsIDEF2), OsYSL5, OsPEZ2, ferric reductase oxidase 1 (OsFRO1), and OsFRO2 were not expressed in roots (Figure 2A).
Figure 2
3.3. Differentially Expressed Genes in Leaves
Variation was observed among the DEGs in the leaves of seedlings with that of the mature stage. The OsVIT2 and OsFER1/OsFER2 were highly upregulated in the seedling stage, whereas they were not differentially expressed in the mature stage (Figure 2A). Other upregulated Fe homeostasis related genes in seedlings include the OsRMC, OsYSL10, OsIDI1L/OsARD1, OsYSL6, OsRab6a, OsTOM3, OsMIT, OsbHLH58/OsPRI2, OsNRAMP2, OsYSL9, and OsFDH. In contrast, downregulated genes include OsFRO2, OsIRO2, OsbHLH133, OsNRAMP1, OsNAS1, OsMIR, OsIMA1, OsNAS2, OsYSL2, OsIRT2 etc. (Figure 2A). Among the 69 identified Fe homeostasis-related genes, 27 genes were not expressed in leaves' seedlings (Figure 2A).
In the mature stage, genes like nicotianamine aminotransferase 1 (OsNAAT1), OsENA1 were highly upregulated, followed by OsYSL13, OsMIT, OsRab6a, OsYSL10, OsTOM3, OsIDI1L/OsARD1, OsVMT, OsbHLH58/OsPRI2, etc. (Figure 2A). Most downregulated genes include OsNAS3, OsIMA1, OsNRAMP5, OsFRDL1, haemerythrin domain containing protein without RING- and Zn-finger 1 (OsHORZ1), etc. (Figure 2A). A total of 25 identified Fe homeostasis-related genes were differentially expressed in leaves during the mature stage (Figure 2A).
Comparative analysis of the top 500 up/down regulated genes indicates that genes are distinctly expressed in both roots and leaves. Only one gene was found to be commonly upregulated in the roots and leaves of both seedlings as well as of the mature stage. Similarly, only 21 genes were found to be downregulated in all of the tissue samples (Figure 1D). On comparing the genes associated with Fe homeostasis, it was observed that only 5 genes were commonly upregulated in roots and leaves of seedling and the mature stage. Similarly, 9 genes were expressed as downregulated genes (Figure 1E).
3.4. DEGs Involved in ROS and Scavenging
Reactive oxygen species homeostasis greatly depends on the balance of ROS production and their scavenging. Under Fe2+ toxicity, stress-responsive, and source of H2O2 generation genes such as respiratory burst oxidase homolog (Rboh) were differentially expressed in both roots and leaves (Figure 3A). Only OsRbohH was upregulated in roots, whereas OsRbohF in leaves of both growth stages (Figure 2B and Supplementary Table S3). Simultaneously, ROS scavenging enzymes such as superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), guaiacol peroxidase (GPX), glutathione reductase (GR), peroxiredoxins (PRXs), glutaredoxin (GRX), and peroxidase (POX) were differentially expressed (Figure 3A). The expression of CAT was tissue and growth-specific (Figure 2B and Supplementary Table S3). Only OsCATA was upregulated in roots, whereas OsCatB and OsCATC were upregulated in the leaves seedling and mature stage. Similarly, OsSOD2 was upregulated in roots, whereas OsSOD3 was upregulated in leaves of both growth stages (Figure 2B and Supplementary Table S3). Interestingly, OsGR2 and OsGR3 were commonly upregulated in all tissue conditions (Figure 2B and Supplementary Table S3). Among various APX, OsAPX1 and OsAPX7 were upregulated in all tissue types. In roots, GPX were downregulated, whereas OsGPX1, OsGPX2, and OsGPX3 were upregulated in leaves of both stages. OsPRXB was highly upregulated in all tissue samples, whereas OsPRXA was specific in the leaves of seedlings. POX and non-enzymatic antioxidant GSTs are comprised of a large gene family and are one of the highest DEGs in this study. Approximately 104 POX and 72 GST genes were differentially expressed across all tissue types (Figure 2B and Supplementary Table S3). OsPRX15 and OsPRX93 were highly upregulated in roots, whereas OsPRX24 and OsPRX30 in leaves, seedling, and OsPRX113, OsPRX109, OsPRX110, OsPRX111, etc., were highly upregulated in the mature stage (Figure 2B and Supplementary Table S3). In roots, OsGSTU44, OsGSTU43, OsGSTU47, OsGSTU8, etc., were highly upregulated. Similarly, OsGSTU30, OsGSTU19, OsGSTU36, OsGSTU12, etc., were upregulated in leaves seedlings, whereas OsGSTU8, OsGSTU6, OsGSTU17, OsGSTU24, etc. were upregulated in the mature stage (Figure 2B and Supplementary Table S3). These results suggested that the enzymatic pathways GST, POX genes play a crucial role in protecting aromatic Keteki Joha rice against oxidative damage caused due to Fe2+ toxicity.
Figure 3
3.5. Differentially Expressed Transcription Factors and Heavy Metal Responsive Genes
Several transcription factors were differentially expressed under Fe2+ toxicity (Figure 3C). These include the auxin response factors (ARF), basic helix-loop-helix (bHLH), no apical meristem (NAC), myeloblastosis (MYB), basic leucine zipper (bZIP), WRKY, APETALA2/Ethylene-responsive factor (AP2/ERF), C2H2 zinc-finger domain (C2H2) were prevalent (Figure 3C). Briefly, 100 bHLH, 70 bZIP, 121 NAC, 56 C2H2, 75 MYB, 81 AP2/ERF, and 69 WRKY transcription factors were differentially expressed in roots and leaves (Supplementary Table S4). Similarly, several metal transporters were differentially expressed under Fe2+ toxicity (Figure 3B). About 34 heavy metal-associated domains containing heavy metal-associated protein (HMP), 12 multidrug resistance-associated protein (MRP), 7 metal tolerance protein (MTP), 7 NRAMP, and 11 Zrt and Irt-like protein (ZIP) were differentially expressed (Supplementary Table S5).
3.6. DEGs Related to Abiotic Stress and Nutrient Deficiency
Some well-known abiotic stress and nutrient deficiency-related genes were also observed among the DEGs. The auxin efflux carrier component genes were highly upregulated in roots, whereas they were either downregulated or unexpressed in leaves (Supplementary Figure S3). Abiotic stress-related genes 9-cis-epoxycarotenoid dioxygenase (OsNCED4/OsNCED3), receptor-like cytoplasmic kinase 253 (OsRLCK253), phosphate dikinase (OsPPDKA), and cyclin-like F-box domain-containing protein (OsMsr9) were differentially expressed. In addition, submergence tolerance genes pyruvate decarboxylase (OsPDC4), phosphoenolpyruvate carboxykinase (OsPEPCK), OsARD1/OsSIP2, and B12D protein were differentially expressed. Low nutrient responses genes haemoglobin 1 (OsHB1), OsHB2, and low phosphate root 2 (OsLPR2) were mostly upregulated (Supplementary Figure S3).
3.7. GO and KEGG Pathway Affected by Fe Toxicity
Gene ontology is helpful for describing the functions of gene products. GO terms of the DEGs in roots, leaves of seedling, and mature stage were very similar. From comparative GO term analysis, top and common biological process GO terms include response to stress (GO:0006950), response to stimulus (GO:0050896), secondary metabolic process (GO:0019748), response to abiotic stimulus (GO:0009628), lipid metabolic process (GO:0006629), etc. (Figure 4A). Similarly, the top and common molecular process GO terms included, catalytic activity (GO:0003824), drug binding (GO:0008144), oxygen binding (GO:0019825), transferase activity (GO:0016740), etc. (Figure 4B). Besides top and common cellular components, GO terms of DEGs also belonged to cell (GO:0005623), external encapsulating structure (GO:0030312), cell wall (GO:0005618), extracellular region (GO:0005576), etc. (Figure 4C).
Figure 4
The KEGG pathways of the DEGs were evaluated in the context of adaptation and responses to Fe2+ toxicity. Among the several pathways, significantly and differentially expressed pathways were evaluated by the pathview-web tool. Log2FoldChange value of each DEGs was integrated into their respective KEGG gene ID, and their active or passive state was evaluated, and accordingly, multiple states pathways were presented (Figure 4D and Supplementary Figure S4). Top upregulated pathways included biosynthesis of amino acids (osa01230), RNA degradation (osa03018), spliceosome (osa03040), glycolysis/ gluconeogenesis (osa00010), carbon metabolism (osa01200), glutathione metabolism (osa00480) etc (Figures 4D, 5). The most downregulated pathway includes phenylpropanoid biosynthesis (osa00940), photosynthesis (00195), fatty acid elongation (osa00062), ribosome (osa03010), DNA replication (osa03030), etc (Figure 5).
Figure 5
3.8. Differential Exon Usage of Genes
Differential exon usage of the DEGs was inferred in response to Fe2+ toxicity. About 173 in root seedling, 692 in leaves seedling, and 1,415 genes in leaves of the mature stage were identified to use different exons (Supplementary Figure S5). Among them, Fe homeostasis genes were also identified to use different exons. In roots, OsFRDL1, OsNRAMP1, OsVMT, and OsTOM3 used different exons between the control and treated groups. Similarly, the OsFRDL1, OsIRO2, and OsMIR were in leaves seedling, and OsFER1/2, S-adenosyl-L-methionine synthetase 2 (OsSAM2), OsPEZ2, OsSAM1, OsIDEF2, OsTOM3, and OsVMT used different exons between the control and treated groups (Figure 6).
Figure 6
3.9. Validation of Gene Expression
The expression of RNA-Seq data was validated by qRT-PCR analysis of representative genes (Figure 6). Under Fe2+ toxicity, expression of OsFER1/2 was upregulated in both root and leaves of the seedling stage. The expression of OsVMT, OsB12D, and OsGSTU44 was downregulated in the roots. In contrast, similar to the RNA-Seq results, the OsIRT1, OsYSL15, OsNAS1, and OsTOM1 were downregulated. Similarly, the OsYSL15 and OsTOM1 were also downregulated in leaves of the seedling stage (Figure 7).
Figure 7
A significant upregulation of ROS Scavenging genes and different abiotic stress-related TFs, genes serve to be the key mechanism involved against severe Fe2+ toxicity tolerance. Accordingly, a new defense mechanism is hypothesized that alleviates the excess Fe2+ in addition to the other mechanism of defense against Fe2+ toxicity (Figures 8, 9).
Figure 8
Figure 9

Hypothetical model of the cellular ROS detoxification mechanism under severe Fe2+ toxicity in rice. (A) ROS detoxification mechanism in root cells. (B) ROS detoxification mechanism in leaf cells. The diagram shows the sites of ROS production during the Fe2+ toxicity via Fenton reaction. The transcription factors trigger the cascade of antioxidant activity. The genes responsible for H2O2 removal were highlighted in red color. The solid lines represent the reactions whereas dashed lines represent the transport.
4. Discussion
Fe2+ toxicity significantly inhibits the growth and productivity of rice. Fe2+ toxicity interrupts the metabolism and functioning of plants, affecting root and shoot development (Aung et al.,
Four different types of tolerance mechanisms have been reported in rice (Aung and Masuda,
The discussion above suggests that the Fe exclusion and retention mechanisms in roots are likely to be insufficient under severe Fe2+ toxicity. ROS scavenging remains a key mechanism under severe Fe2+ toxicity which needs a better understanding (Aung and Masuda,
Most of the APX, ferredoxin, and thiol-based peroxidase such as PRX genes were upregulated in both roots and leaves, which are important for the removal of H2O2 in chloroplast using NADPH and photosynthetic electron transport via ferredoxin (2Fe-2S, iron-sulfur cluster binding domain-containing protein) as the ultimate reductant (Smirnoff and Arnaud, 2019). Several POX genes were upregulated, which are responsible for scavenging H2O2 by oxidizing various secondary metabolites. Removal of mitochondrial H2O2 requires a series of enzymatic detoxification processes. Mn-SOD scavenges superoxide radicals formed via mitochondrial electron transport chain (ETC). However, Mn-OsSOD1 was not found to be differentially expressed in roots, whereas it was fractionally upregulated in leaves of both stages. The remaining H2O2 is detoxified by the PRX-TRX system or by the enzymes of the ascorbate-glutathione cycle (Smirnoff and Arnaud, 2019). PRX-TRX plays an important role in detoxifying H2O2 in plants (Wang et al., 2016). The Os1-CysPrxB is highly expressed across all tissue types. In addition, upregulation of OsTRX24, OsTRX23, OsTRX2 etc. denotes the PRX-TRX regulation for detoxification of H2O2 in mitochondria under Fe2+ toxicity.
Among the different antioxidants, GSTs were one of the most differentially expressed genes under Fe2+ toxicity. Most upregulated GSTs are of the tau class, which are well-known for heavy metal detoxification due to the high affinity of metals to its thiol(-SH) group and as a precursor of phytochelatins (PCs) (Jagodzik et al.,
Iron homeostasis is a complex network that is regulated by various transcription factors. The tale of transcription factors involved in the regulation of different Fe-acquisition was well characterized in Arabidopsis, whereas it is comparatively less explored in rice. In Arabidopsis, 16 bHLH transcription factors were described to be involved in Fe deficiency responses (Gao et al.,
Furthermore, TFs such as bHLH, bZIP, ERF, WRKY, NAC, and MYB were important for the protection of ROS mediated oxidative damage by triggering ROS scavenging related genes in plants (Mittler et al., 2004; Yu et al., 2017; He et al.,
Comparative KEGG analysis revealed that genes involved in the Mitogen-activated protein kinases (MAPK) signaling pathway are highly upregulated in leaves, under Fe2+ toxicity. MAPK signaling pathway is a common defense response of plants for various abiotic stresses (Zhang and Klessig, 2001; Liu and He, 2017). Along with several MPK genes, OsMPK3 was upregulated in leaves, which are known as a stress tolerance gene (Jagodzik et al.,
In addition, upregulation of low nutrient responsive genes indicates nutrient deficiency upon Fe2+ toxicity. Apart from the ROS homeostasis genes, differential expression of various abiotic stress-related genes might indicate the existence of multiple stress tolerance strategies in rice. Besides all the above, L-lactate dehydrogenase B (LDH-B) was the topmost upregulated gene in roots, which catalyzes the reversible NAD-dependent interconversion of pyruvate to L-lactate. KEGG pathway analysis revealed that it is involved in glycolysis/gluconeogenesis, cysteine and methionine metabolism, pyruvate metabolism, propanoate metabolism, and biosynthesis of secondary metabolites. Its stereoisomer D-2-hydroxyglutarate dehydrogenase/D-lactate dehydrogenase was recently characterized to be conferred multiple abiotic stresses by maintaining cellular homeostasis in rice (Mitsuhara et al., 2008). Thus, further study about LDH-B may be helpful to understand its function under Fe2+ toxicity in rice.
Conclusion
In this study, ROS homeostasis was identified as the key mechanism for Fe2+ detoxification under severe Fe2+ toxicity, regulated by transcription factors. Future molecular research work targeting the characterization of the strongly induced genes will be important to understand the overall Fe2+ detoxification mechanism in rice. In addition, the genes identified in this study may serve as a valuable insight for further research and development of rice genotypes for Fe2+ toxicity tolerance.
Funding
The RNA Sequencing was funded by the Department of Biotechnology, Government of India with a grant no. DBT-NER/AGRI/29/2015.
Publisher's Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Statements
Data availability statement
The original contributions presented in the study are publicly available. This data can be found here: Bioproject: PRJNA680441. BioSamples: SAMN16879912, SAMN16879913, SAMN16879914, SAMN16879915, SAMN16879916, and SAMN168799.
Author contributions
PR: conceptualization, methodology, writing–original draft preparation, data curation, and analysis. SD: manuscript writing and analysis. MR: methodology. AP: manuscript writing. UC: editing. BT: investigation, writing–reviewing, and editing. AT: reviewing and supervision. SP: reviewing, editing, and supervision. All authors contributed to the article and approved the submitted version.
Acknowledgments
The author highly acknowledges the Ministry of Tribal Affairs, Government of India for financial support under National Fellowship Scheme for Higher Education of ST Students, 2016-17. Award no: F1-17.1/2016-17/NFST-2015-17-STASS-2810.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2022.798580/full#supplementary-material
Supplementary Figure S1Representative figure showing the morphology of Keteki Joha grown under control and Fe Excess (2.5 mM) conditions.
Supplementary Figure S2Venn diagram showing the top 500 Up and downregulated common DEGs among the tissue samples. The venn diagram were created by using the venn diagram software of VIB/UGent Bioinformatics & Evolutionary Genomics.
Supplementary Figure S3Venn diagram showing the common Fe homeostasis DEGs among the tissue samples. The venn diagram were created by using the venn diagram software of VIB/UGent Bioinformatics & Evolutionary Genomics.
Supplementary Figure S4Gene ontology showing the Molecular function terms associated with top 1000 differentially expressed genes. The top 10 biological process terms were represented by applying Fishers exact statistical test and classic topGO package algorithm in R program. The ggplot2 package of R program was used to create the graphical representation.
Supplementary Figure S5Gene ontology showing the Cellular component terms associated with top 1000 differentially expressed genes. The top 10 biological process terms were represented by applying Fishers exact statistical test and classic topGO package algorithm in R program. The ggplot2 package of R program was used to create the graphical representation.
Supplementary Figure S6Most significant KEGG pathways under Fe2+ toxicity. Multiple states pathway was rendered by Pathview-web tool and the DEGs involved in the pathway are highlighted in red (Upregulated) and green color (down-regulated).
Supplementary Figure S7Venn diagram showing the number of common differentially exon usage DEGs in different tissues under Fe2+ toxicity.
Supplementary Table S1RNA-Seq samples showing the number of reads and percentage of uniquely mapped reads into the rice genome.
Supplementary Table S2Total differentially expressed genes and their annotation in all tissue samples.
Supplementary Table S3Differentially expressed genes for ROS production and scavenging related genes.
Supplementary Table S4Differential expression of transcription factors.
Supplementary Table S5Differential expression of heavy metal related genes.
References
1
AdachiH.NakanoT.MiyagawaN.IshihamaN.YoshiokaM.KatouY.et al. (2015). Wrky transcription factors phosphorylated by mapk regulate a plant immune nadph oxidase in nicotiana benthamiana. Plant Cell27, 2645–2663. 10.1105/tpc.15.00213
2
AlexaA.RahnenführerJ. (2020). topGO: Enrichment Analysis for Gene Ontology. R package version 2.42.0.
3
AltschulS. F.GishW.MillerW.MyersE. W.LipmanD. J. (1990). Basic local alignment search tool. J. Mol. Biol. 215, 403–410. 10.1016/S0022-2836(05)80360-2
4
AndersS.ReyesA.HuberW. (2012). Detecting differential usage of exons from rna-seq data. Genome Res. 22, 2008–2017. 10.1101/gr.133744.111
5
ApweilerR.BairochA.BougueleretL.AltairacS.AmendoliaV.AuchinclossA.et al. (2009). The universal protein resource (uniprot) 2009. Nucleic Acids Res. 37, D169–D174. 10.1093/nar/gkn664
6
AschF.BeckerM.KpongorD. S. (2005). A quick and efficient screen for resistance to iron toxicity in lowland rice. J. Plant Nutr. Soil Sci. 168, 764–773. 10.1002/jpln.200520540
7
AudebertA.FofanaM. (2009). Rice yield gap due to iron toxicity in west africa. J. Agron. Crop Sci. 195, 66–76. 10.1111/j.1439-037X.2008.00339.x
8
AungM. S.MasudaH. (2020). How does rice defend against excess iron?: Physiological and molecular mechanisms. Front. Plant Sci. 11, 1102. 10.3389/fpls.2020.01102
9
AungM. S.MasudaH.KobayashiT.NishizawaN. K. (2018). Physiological and transcriptomic analysis of responses to different levels of iron excess stress in various rice tissues. Soil Sci. Plant Nutr. 64, 370–385. 10.1080/00380768.2018.1443754
10
AungM. S.MasudaH.NozoyeT.KobayashiT.JeonJ.-S.AnG.et al. (2019). Nicotianamine synthesis by osnas3 is important for mitigating iron excess stress in rice. Front. Plant Sci. 10, 660. 10.3389/fpls.2019.00660
11
BashirK.IshimaruY.ShimoH.NagasakaS.FujimotoM.TakanashiH.et al. (2011). The rice mitochondrial iron transporter is essential for plant growth. Nat. Commun. 2, 1–7. 10.1038/ncomms1326
12
BecanaM.MoranJ. F.Iturbe-OrmaetxeI. (1998). Iron-dependent oxygen free radical generation in plants subjected to environmental stress: toxicity and antioxidant protection. Plant Soil. 201, 137–147. 10.1023/A:1004375732137
13
BeckerM.AschF. (2005). Iron toxicity in rice - conditions and management concepts. J. Plant Nutr. Soil Sci. 168, 558–573. 10.1002/jpln.200520504
14
BligheK.RanaS.LewisM. (2021). EnhancedVolcano: Publication-Ready Volcano Plots With Enhanced Colouring And Labeling. R package version 1.10.10.
15
BolgerA. M.LohseM.UsadelB. (2014). Trimmomatic: A flexible trimmer for illumina sequence data. Bioinformatics30, 2114–2120. 10.1093/bioinformatics/btu170
16
BughioN.. (2002). Cloning an iron-regulated metal transporter from rice. J. Exp. Bot. 53, 1677–1682. 10.1093/jxb/erf004
17
CheJ.YokoshoK.YamajiN.MaJ. F. (2019). A vacuolar phytosiderophore transporter alters iron and zinc accumulation in polished rice grains. Plant Physiol. 181, 276–288. 10.1104/pp.19.00598
18
DengD.WuS. C.WuF. Y.DengH.WongM. H. (2010). Effects of root anatomy and fe plaque on arsenic uptake by rice seedlings grown in solution culture. Environ. Pollut. 158, 2589–2595. 10.1016/j.envpol.2010.05.015
19
DistéfanoA. M.LópezG. A.SetzesN.MarchettiF.CainzosM.CascallaresM.et al. (2020). Ferroptosis in plants: triggers, proposed mechanisms, and the role of iron in modulating cell death. J. Exp. Bot. 72, 2125–2135. 10.1093/jxb/eraa425
20
DobinA.DavisC. A.SchlesingerF.DrenkowJ.ZaleskiC.JhaS.et al. (2013). Star: Ultrafast universal rna-seq aligner. Bioinformatics29, 15–21. 10.1093/bioinformatics/bts635
21
FastQC (2010). Babraham Bioinformatics. A quality control tool for high throughput sequence data. Avaialble online at: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
22
FinattoT.OliveiraA. C. D.ChaparroC.MaiaL. C.FariasD. R.WoyannL. G.et al. (2015). Abiotic stress and genome dynamics: specific genes and transposable elements response to iron excess in rice. Rice8, 13. 10.1186/s12284-015-0045-6
23
GaoF.RobeK.GaymardF.IzquierdoE.DubosC. (2019). The transcriptional control of iron homeostasis in plants: a tale of bhlh transcription factors?Front. Plant Sci. 10, 6. 10.3389/fpls.2019.00006
24
GuZ.EilsR.SchlesnerM. (2016). Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics32, 2847–2849. 10.1093/bioinformatics/btw313
25
HeH.Van BreusegemF.MhamdiA. (2018). Redox-dependent control of nuclear transcription in plants. J. Exp. Bot. 69, 3359–3372. 10.1093/jxb/ery130
26
HoaglandD. R.SnyderW. C. (1933). Nutrition of strawberry plant under controlled conditions. Proc. Am. Soc. Horticult. Sci. 30, 288–294.
27
HuangS.AkenO. V.SchwarzländerM.BeltK.MillarA. H. (2016). The roles of mitochondrial reactive oxygen species in cellular signaling and stress response in plants. Plant Physiol. 171, 1551–1559. 10.1104/pp.16.00166
28
IshimaruY.BashirK.NakanishiH.NishizawaN. K. (2011). The role of rice phenolics efflux transporter in solubilizing apoplasmic iron. Plant Signal. Behav. 6, 1624–1626. 10.4161/psb.6.10.17694
29
IshimaruY.SuzukiM.TsukamotoT.SuzukiK.NakazonoM.KobayashiT.et al. (2006). Rice plants take up iron as an fe3+-phytosiderophore and as Fe2+. Plant J. 45, 335–346. 10.1111/j.1365-313X.2005.02624.x
30
ItoY.SaishoD.NakazonoM.TsutsumiN.HiraiA. (1997). Transcript levels of tandem-arranged alternative oxidase genes in rice are increased by low temperature. Gene203, 121–129. 10.1016/S0378-1119(97)00502-7
31
JagodzikP.Tajdel-ZielinskaM.CieslaA.MarczakM.LudwikowA. (2018). Mitogen-activated protein kinase cascades in plant hormone signaling. Front. Plant Sci. 9, 1387. 10.3389/fpls.2018.01387
32
JiangJ.MaS.YeN.JiangM.CaoJ.ZhangJ. (2017). Wrky transcription factors in plant responses to stresses. J. Integr. Plant Biol. 59, 86–101. 10.1111/jipb.12513
33
KakeiY.MasudaH.NishizawaN. K.HattoriH.AungM. S. (2021). Elucidation of novel cis-regulatory elements and promoter structures involved in iron excess response mechanisms in rice using a bioinformatics approach. Front. Plant Sci. 12, 766. 10.3389/fpls.2021.660303
34
KanehisaM.GotoS. (2000). Kegg: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30. 10.1093/nar/28.1.27
35
KanehisaM.SatoY.MorishimaK. (2016). Blastkoala and ghostkoala: Kegg tools for functional characterization of genome and metagenome sequences. J. Mol. Biol. 428, 726–731. 10.1016/j.jmb.2015.11.006
36
KawaharaY.de la BastideM.HamiltonJ. P.KanamoriH.MccombieW. R.OuyangS.et al. (2013). Improvement of the oryza sativa nipponbare reference genome using next generation sequence and optical map data. Rice6, 3–10. 10.1186/1939-8433-6-4
37
KeunenE.SchellingenK.StraetenD. V. D.RemansT.ColpaertJ.VangronsveldJ.et al. (2015). Alternative oxidase1a modulates the oxidative challenge during moderate cd exposure in arabidopsis thaliana leaves. J. Exp. Bot. 66, 2967–2977. 10.1093/jxb/erv035
38
KimC. Y.VoK. T. X.NguyenC. D.JeongD. H.LeeS. K.KumarM.et al. (2016). Functional analysis of a cold-responsive rice wrky gene, oswrky71. Plant Biotechnol. Rep. 10, 13–23. 10.1007/s11816-015-0383-2
39
KobayashiT.. (2019). Understanding the complexity of iron sensing and signaling cascades in plants. Plant Cell Physiol. 60, 1440–1446. 10.1093/pcp/pcz038
40
KobayashiT.ItaiR. N.NishizawaN. K. (2014). Iron deficiency responses in rice roots. Rice7, 27. 10.1186/s12284-014-0027-0
41
KobayashiT.NishizawaN. K. (2012). Iron uptake, translocation, and regulation in higher plants. Annu. Rev. Plant Biol. 63, 131–152. 10.1146/annurev-arplant-042811-105522
42
KobayashiT.NishizawaN. K. (2014). Iron sensors and signals in response to iron deficiency. Plant Sci. 224, 36–43. 10.1016/j.plantsci.2014.04.002
43
KobayashiT.NishizawaN. K. (2015). Intracellular iron sensing by the direct binding of iron to regulators. Front. Plant Sci. 6, 155. 10.3389/fpls.2015.00155
44
LiB.SunL.HuangJ.GöschlC.ShiW.ChoryJ.et al. (2019b). Gsnor provides plant tolerance to iron toxicity via preventing iron-dependent nitrosative and oxidative cytotoxicity. Nat. Commun. 10, 3896. 10.1038/s41467-019-11892-5
45
LiC.henYang. (2019a). The molecular mechanisms underlying iron deficiency responses in rice. Int. J. Mol. Sci. 21, 43. 10.3390/ijms21010043
46
LiH.HandsakerB.WysokerA.FennellT.RuanJ.HomerN.et al. (2009). The sequence alignment/map format and samtools. Bioinformatics25, 2078–2079. 10.1093/bioinformatics/btp352
47
LiangS.XiongW.YinC.XieX.JinY. J.ZhangS.et al. (2019). Overexpression of osard1 improves submergence, drought, and salt tolerances of seedling through the enhancement of ethylene synthesis in rice. Front. Plant Sci. 10, 1088. 10.3389/fpls.2019.01088
48
LiaoY.SmythG. K.ShiW. (2014). Featurecounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics30, 923–930. 10.1093/bioinformatics/btt656
49
LiuX.BaiX.WangX.ChuC. (2007). Oswrky71, a rice transcription factor, is involved in rice defense response. J. Plant Physiol. 164, 969–979. 10.1016/j.jplph.2006.07.006
50
LiuY.HeC. (2017). A review of redox signaling and the control of map kinase pathway in plants. Redox. Biol. 11, 192–204. 10.1016/j.redox.2016.12.009
51
LoveM. I.HuberW.AndersS. (2014). Moderated estimation of fold change and dispersion for rna-seq data with deseq2. Genome Biol. 15, 550. 10.1186/s13059-014-0550-8
52
LuoW.PantG.BhavnasiY. K.BlanchardS. G.BrouwerC. (2017). Pathview web: user friendly pathway visualization and data integration. Nucleic Acids Res. 45, W501–W508. 10.1093/nar/gkx372
53
MitsuharaI.IwaiT.SeoS.YanagawaY.KawahigasiH.HiroseS.et al. (2008). Characteristic expression of twelve rice pr1 family genes in response to pathogen infection, wounding, and defense-related signal compounds (121/180). Mol. Geneti. Genomics279, 415–427. 10.1007/s00438-008-0322-9
54
MittlerR.VanderauweraS.GolleryM.Van BreusegemF. (2004). Reactive oxygen gene network of plants. Trends Plant Sci. 10, 1360–1385. 10.1016/j.tplants.2004.08.009
55
MuhammadT.ZhangJ.MaY.LiY.ZhangF.ZhangY.et al. (2019). Overexpression of a mitogen-activated protein kinase slmapk3 positively regulates tomato tolerance to cadmium and drought stress. Molecules24, 556. 10.3390/molecules24030556
56
MüllerM.Munné-BoschS. (2015). Ethylene response factors: a key regulatory hub in hormone and stress signaling. Plant Physiol. 169, 32–41. 10.1104/pp.15.00677
57
NozoyeT.von WirénN.SatoY.HigashiyamaT.NakanishiH.NishizawaN. K. (2019). Characterization of the nicotianamine exporter ena1 in rice. Front. Plant Sci. 10, 502. 10.3389/fpls.2019.00502
58
OgoY.KobayashiT.ItaiR. N.NakanishiH.KakeiY.TakahashiM.et al. (2008). A novel nac transcription factor, idef2, that recognizes the iron deficiency-responsive element 2 regulates the genes involved in iron homeostasis in plants. J. Biol. Chem. 283, 13407–13417. 10.1074/jbc.M708732200
59
PhukanU. J.JeenaG. S.TripathiV.ShuklaR. K. (2017). Regulation of apetala2/ethylene response factors in plants. Front. Plant Sci. 8, 150. 10.3389/fpls.2017.00150
60
R Core Team (2021). R: A Language and Environment for Statistical Computing. Vienna: R Foundation for Statistical Computing.
61
RegonP.DeyS.ChowardharaB.SahaB.KarS.TantiB.et al. (2021). Physio-biochemical and molecular assessment of iron (fe2+) toxicity responses in contrasting indigenous aromatic joha rice cultivars of assam, india. Protoplasma258, 289–299. 10.1007/s00709-020-01574-1
62
RhoadsD. M.UmbachA. L.SubbaiahC. C.SiedowJ. N. (2006). Mitochondrial reactive oxygen species. Contribution to oxidative stress and interorganellar signaling. Plant Physiol. 141, 357–366. 10.1104/pp.106.079129
63
SahrawatK. L.. (2005). Iron toxicity in wetland rice and the role of other nutrients. J. Plant Nutr. 27, 1471–1504. 10.1081/PLN-200025869
64
SakaiH.LeeS. S.TanakaT.NumaH.KimJ.KawaharaY.et al. (2013). Rice annotation project database (rap-db): an integrative and interactive database for rice genomics. Plant Cell Physiol. 54, e6. 10.1093/pcp/pcs183
65
SenouraT.SakashitaE.KobayashiT.TakahashiM.AungM. S.MasudaH.et al. (2017). The iron-chelate transporter osysl9 plays a role in iron distribution in developing rice grains. Plant Mol. Biol. 95, 375–387. 10.1007/s11103-017-0656-y
66
ShenC.YueR.SunT.ZhangL.YangY.WangH. (2015). Osarf16, a transcription factor regulating auxin redistribution, is required for iron deficiency response in rice (Oryza sativa l.). Plant Sci. 231, 148–158. 10.1016/j.plantsci.2014.12.003
67
SmirnoffN.ArnaudD. (2019). Hydrogen peroxide metabolism and functions in plants. New Phytol. 221, 1197–1214. 10.1111/nph.15488
68
SrivastavaD.VermaG.ChauhanA. S.PandeV.ChakrabartyD. (2018). Rice (Oryza sativa L.) tau class glutathione S-transferase (OsGSTU30) overexpression in Arabidopsis thaliana modulates a regulatory network leading to heavy metal and drought stress tolerance†. Metallomics11, 375–389. 10.1039/C8MT00204E
69
SteinerA. A.van WindenH. (1970). Recipe for ferric salts of ethylenediaminetetra acetic acid. Plant Physiol. 46, 862–863. 10.1104/pp.46.6.862
70
TaylorS. C.NadeauK.AbbasiM.LachanceC.NguyenM.FenrichJ. (2019). The ultimate qpcr experiment: producing publication quality, reproducible data the first time. Trends Biotechnol. 37, 761–774. 10.1016/j.tibtech.2018.12.002
71
VanderauweraS.ZimmermannP.RombautsS.VandenabeeleS.LangebartelsC.GruissemW.et al. (2005). Genome-wide analysis of hydrogen peroxide-regulated gene expression in arabidopsis reveals a high light-induced transcriptional cluster involved in anthocyanin biosynthesis. Plant Physiol. 139, 806–821. 10.1104/pp.105.065896
72
WangX.CaiX.XuC.WangQ.DaiS. (2016). Drought-responsive mechanisms in plant leaves revealed by proteomics. Int. J. Mol. Sci. 17, 1706. 10.3390/ijms17101706
73
WickhamH.. (2016). ggplot2 - Elegant Graphics for Data Analysis. New York, NY: Springer-Verlag.
74
WinterbournC. C.. (1995). Toxicity of iron and hydrogen peroxide: the fenton reaction. Toxicol. Lett. 82–83, 969–974. 10.1016/0378-4274(95)03532-X
75
WuL.UedaY.LaiS.FreiM. (2017). Shoot tolerance mechanisms to iron toxicity in rice (Oryza sativa l.). Plant Cell Environ. 40, 570–584. 10.1111/pce.12733
76
YangX.SunW.LiuJ.-P.LiuY.-J.ZengQ.-Y. (2009). Biochemical and physiological characterization of a tau class glutathione transferase from rice (Oryza sativa). Plant Physiol. Biochem. 47, 1061–1068. 10.1016/j.plaphy.2009.07.003
77
YuR.TangY.LiuC.DuX.MiaoC.ShiG. (2017). Comparative transcriptomic analysis reveals the roles of ROS scavenging genes in response to cadmium in two pak choi cultivars. Sci. Rep. 7, 9217. 10.1038/s41598-017-09838-2
78
ZhaiZ.GayombaS. R.JungH. I.VimalakumariN. K.PiñerosM.CraftE.et al. (2014). Opt3 is a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium in arabidopsis. Plant Cell. 26, 2249–2264. 10.1105/tpc.114.123737
79
ZhangC.ShinwariK. I.LuoL.ZhengL. (2018). Osysl13 is involved in iron distribution in rice. Int. J. Mol. Sci. 19, 3537. 10.3390/ijms19113537
80
ZhangS.KlessigD. F. (2001). Mapk cascades in plant defense signaling. Trends Plant Sci. 6, 520–527. 10.1016/S1360-1385(01)02103-3
81
ZhaoJ.YangW.ZhangS.YangT.LiuQ.DongJ.et al. (2018). Genome-wide association study and candidate gene analysis of rice cadmium accumulation in grain in a diverse rice collection. Rice11, 1–15. 10.1186/s12284-018-0254-x
82
ZhuA.IbrahimJ. G.LoveM. I. (2018). Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differences. Bioinformatics35, 2084–2092. 10.1093/bioinformatics/bty895
Summary
Keywords
Fe2+ toxicity, RNA-Seq, transcriptome, Fe homeostasis, ROS
Citation
Regon P, Dey S, Rehman M, Pradhan AK, Chowra U, Tanti B, Talukdar AD and Panda SK (2022) Transcriptomic Analysis Revealed Reactive Oxygen Species Scavenging Mechanisms Associated With Ferrous Iron Toxicity in Aromatic Keteki Joha Rice. Front. Plant Sci. 13:798580. doi: 10.3389/fpls.2022.798580
Received
20 October 2021
Accepted
21 January 2022
Published
24 February 2022
Volume
13 - 2022
Edited by
Anket Sharma, University of Maryland, United States
Reviewed by
Tomoko Nozoye, Meiji Gakuin University, Japan; Ertugrul Filiz, Duzce University, Turkey; Avinash Chandra Pandey, The International Maize and Wheat Improvement Center (CIMMYT), India
Updates

Check for updates
Copyright
© 2022 Regon, Dey, Rehman, Pradhan, Chowra, Tanti, Talukdar and Panda.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Sanjib Kumar Panda profskpanda73@gmail.com
This article was submitted to Plant Abiotic Stress, a section of the journal Frontiers in Plant Science
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.