Territory-linked coffee quality in Lengupá Province (Boyacá, Colombia): a case study toward a denomination of origin

Abstract

Coffee quality associated with origin has traditionally been approached through geographical delimitations and technical product attributes, with less attention to the articulation between territory, production practices, and integrated expressions of quality. In this context, the aim of this study was to analyze the coffee-growing territory of Lengupá Province (Boyacá, Colombia) from the perspective of origin-linked differential quality, integrating territorial and productive characterization with a holistic notion of coffee quality, as a conceptual and technical basis for future research and for the discussion of a potential first Denomination of Origin centered on a coffee-producing microregion in Colombia. An exploratory study was conducted based on fieldwork with producers, characterization of the production system, physicochemical and sensory analysis of coffee beans, and microbiological characterization of the fermentation process. The results reveal a transversal coherence of coffee quality at the provincial scale, with comparable productive and quality profiles across municipalities and internal variability mainly associated with post-harvest management and process control decisions. From an integrated analytical perspective, coffee quality is interpreted as the expression of shared productive and fermentative styles rather than the result of isolated markers, supporting the understanding of Lengupá as a coffee-producing microregion with common agroecological, productive, and sociocultural foundations. Overall, the findings provide conceptual and technical evidence to discuss origin-based differentiation schemes grounded in territorial and productive coherences, and to advance the development of instruments for origin valorization and protection in small-scale coffee farming contexts.

1 Introduction

Colombia has historically been recognized as a coffee-producing country, with nearly three centuries of productive tradition, and holds a national-scale Denomination of Origin, Café de Colombia, as well as six officially recognized regional denominations (Nariño, Cauca, Huila, Santander, Tolima, and Sierra Nevada de Santa Marta) obtained progressively following the initial recognition of the country origin (SIC, 2005). Within the framework of coffee Denominations of Origin in Colombia, coffee quality has been defined and assessed primarily through a set of physical, chemical, and sensory attributes, supported by standardized methodologies for analysis and control. This approach has made it possible to establish homogeneous technical indicators aimed at ensuring product traceability, facilitating objective comparisons among producing regions, and supporting processes of origin-based differentiation. The consolidation of these technical benchmarks has been central to structuring quality control systems associated with Denominations of Origin and to strengthening the positioning of regional coffees in specialized markets (Pabón Usaquén and Osorio Pérez, 2019).

In parallel, within the field of territorially anchored agri-food products, the notion of territory-linked differential quality has been developed from a historical and relational perspective, in which quality is not limited to technical parameters of the final product. Under this approach, quality is understood as a collective construction linked to food identity, territorial embeddedness, and the dynamics of proximity and collective action that articulate local resources, actors, and institutions within a specific territory (Sanz-Cañada and Muchnik, 2016).

From this perspective, territory is not conceived solely as a biophysical substrate, but as a socially constructed space in which agroecological conditions, production practices, local knowledge, organizational processes, and historical dynamics converge and are expressed in differentiated product characteristics. In the literature on localized agri-food systems, this approach emphasizes that product quality and specificity are shaped through networks of actors, institutions, and territorially embedded forms of collective action, rather than exclusively as the result of a set of measurable technical attributes (Torres-Salcido and Sanz-Cañada, 2018).

In the case of coffee, although physical, chemical, and sensory analyses constitute fundamental tools for the characterization and protection of its differential quality, their explicit integration with the territorial factors that underpin them remains an area of ongoing development. Recent studies have shown that physicochemical, biochemical, and sensory variables can be consistently associated with geographical origin, post-harvest processing, and environmental production conditions, providing elements for coffee differentiation, typicity, and traceability (Scholz et al., 2018; Cortés-Macías et al., 2022; Urugo et al., 2024). However, these approaches have focused mainly on the relationship between measurable bean attributes and cup quality, with a still limited incorporation of the social and productive dimensions of territory, particularly in contexts characterized by high diversity (Urugo et al., 2024). Advancing toward broader interpretations of quality makes it possible to situate technical results within a territorial framework that contributes to understanding their origin, meaning, and differentiation, without diminishing their analytical value.

In this regard, the notion of coffee ecotopes is particularly relevant for the analysis of origin-linked quality. Ecotopes allow the identification of relatively homogeneous territorial units from an agroecological perspective, defined by the interaction of climate, soil, relief, and altitudinal range, which generate differentiated conditions for coffee production and provide a technical framework for regional planning and for interpreting territorial patterns of productive and quality variability (Gómez et al., 1991). Beyond their technical usefulness, these ecotopes may serve as a basis for identifying coffee microregions, understood as territorial spaces with environmental, productive, and sociocultural coherence, capable of expressing differential quality attributes and supporting processes of origin valorization.

Lengupá Province, located in the southeastern region of the department of Boyacá (Colombia), represents a relevant setting for this type of analysis. It is a coffee-producing territory characterized by small-scale production, agroecological diversity, and a form of coffee farming closely linked to local peasant dynamics, in which the production of differentiated coffees has gained relevance in recent years. However, technical and scientific information that integrates territory, production practices, and coffee quality in a comprehensive manner remains limited in this province, constraining its understanding from a broad quality perspective and its discussion within frameworks for quality protection with origin designation.

In this context, the objective of this study was to analyze the coffee-growing territory of Lengupá Province from the perspective of origin-linked differential quality, articulating territorial and productive characterization with a holistic notion of coffee quality, as a conceptual and technical basis for future research and for the discussion of a potential first Denomination of Origin centered on a coffee-producing microregion in Colombia.

2 Materials and methods

2.1 Study area

The study was conducted in Lengupá Province, located in the southeastern region of the department of Boyacá (Colombia), which comprises the municipalities of Rondón, Zetaquira, Miraflores, Berbeo, Páez, San Eduardo, and Campohermoso. Coffee farming in the province is carried out on hillside areas within an approximate altitudinal range between 1,200 and 2,000 m a.s.l., with mean annual temperatures between 18 and 22 °C and a bimodal rainfall regime. The main coffee harvest is concentrated between October and January (Cenicafé, 2026).

The total coffee-growing area in Lengupá Province is approximately 3,230 ha, of which 3,140 ha (97.2%) correspond to shaded or semi-shaded cultivation systems. These systems integrate forest species native to the territory and other agricultural crops intended for food production within farming units. Coffee farming in the province comprises approximately 3,495 coffee farms operated by around 2,989 coffee growers and corresponds to a small-scale peasant coffee system based on family units. Total annual coffee production in the province is approximately 2.5 million kilograms of dry coffee (Comité de Cafeteros de Boyacá, 2025).

2.2 Study design

The study followed a case study design with an observational approach, aimed at the integrated description of the coffee-growing territory and the different dimensions of coffee quality. The methodological approach was based on the articulation of territorial, productive, and quality-related information obtained directly from coffee farms within the study area, integrating tools for productive characterization and multidimensional analysis. The design jointly considered territorial and productive characterization and the evaluation of coffee quality through physical, chemical, microbiological, and sensory components, all collected during the same production period to ensure a coherent interpretation of territorial conditions, associated practices, and the characteristics of the resulting coffee (Beltrán-Vargas et al., 2023).

Given its exploratory nature, this study was not intended to establish causal relationships or statistical representativeness for the entire province. Instead, it aimed to identify consistent patterns linking territorial characteristics, production practices, and multidimensional expressions of coffee quality. Accordingly, statistical analyses were used as exploratory tools to support pattern recognition rather than hypothesis testing.

2.3 Selection of producers

Twenty-one coffee producers from Lengupá Province were selected based on their local recognition and representativeness within the territory, considering their experience in coffee production and their distribution across the producing municipalities of the province. The selected producers were distributed as follows: Rondón (3), Zetaquira (4), Miraflores (3), Berbeo (2), Páez (4), San Eduardo (4), and Campohermoso (1). The selection included farms located at different altitudinal ranges and cultivation systems, including semi-shade and shade systems (20 producers) and full sun exposure (1 producer). Variations in productive arrangements and crop and post-harvest management practices were also considered in order to reflect the diversity of productive conditions present in the province.

This purposive sampling strategy was designed to capture territorial heterogeneity rather than to achieve statistical representativeness of the entire province. The selection of producers was intended to reflect variability in agroecological conditions, production systems, and post-harvest practices across municipalities, providing an analytical basis for exploring patterns of origin-linked quality.

2.4 Collection of territorial information

To collect information associated with the coffee-growing territory of Lengupá Province, a semi-structured survey was designed and applied to the selected producers. The instrument aimed to describe territorial and productive characteristics of local coffee farming, incorporating elements of the production system, agronomic practices, harvesting and processing activities, as well as sociocultural and historical aspects linked to coffee production, in line with qualitative and descriptive approaches widely used in territorial coffee studies (Tavares and Valduga, 2023). The instrument underwent an external validation process through review by national and international experts in coffee production systems, who assessed the relevance and coherence of the included sections. Additionally, internal validation was conducted with local producers from Lengupá Province to adjust language and ensure comprehension of the questions within the specific territorial context. The survey was applied in person during visits to the production units.

2.5 Sample collection, transport, and preservation

Samples were collected from each selected production unit from a single coffee lot produced during the same harvest season (2024–2025) and corresponding to the third harvesting round. Coffee processing was carried out on each farm according to the usual practices of each producer. Two types of samples were collected: fermented coffee (mucilage) and dry coffee (parchment).

2.5.1 Fermented coffee (mucilage)

This study aimed to characterize the overall microbial profile of the fermentation process under real production conditions. Therefore, a composite sampling strategy was implemented to capture the integrated microbial signal of fermentation rather than time-resolved dynamics. For each producer, fermentation times ranged from 8 to 72 h, depending on the empirical criteria used to determine the endpoint of fermentation. Both fermentation duration and processing practices were defined by each producer according to their customary post-harvest management.

Samples were collected every 8 h throughout the fermentation process, starting at hour 0 after depulping. Subsamples were placed in sterile resealable zip-lock bags and stored under refrigerated conditions in the field until the full set of time-point samples was completed. Once all subsamples from a given producer were collected, they were transported under refrigerated conditions to the Bioplasma Laboratory of the Universidad Pedagógica y Tecnológica de Colombia (UPTC) in Tunja, Boyacá, where they were ultra-frozen at −40 to −45 °C and stored until all study samples were assembled (Góngora et al., 2024).

For processing, subsamples corresponding to different fermentation times were thawed as rapidly as possible, ensuring that sample temperature did not exceed 40 °C. Mucilage was extracted from each subsample through gentle mechanical friction of the coffee beans within the sampling bags. Due to the temporal succession of microbial populations during fermentation, equal proportions of mucilage from each time point were combined into a composite (pooled) sample to preserve signals of transient populations throughout the process (Holguín-Sterling et al., 2023).

The composite sample was homogenized by vortex agitation, and a subsample was transferred into sterile 2.0 mL screw-cap microtubes (DNase-, RNase-, and endotoxin-free). DNA was immediately stabilized using DNA/RNA Shield™ (Zymo Research, USA), following the manufacturer’s protocol for plant-derived samples, using a ratio of ≤150 mg of sample per 800 μL of preservation solution. This reagent allows nucleic acid preservation and prevents microbial degradation during storage and transport.

Stabilized samples were transported under refrigerated conditions to Macrogen (South Korea) for DNA extraction and metataxonomic analyses.

2.5.2 Parchment coffee

In parallel, a parchment coffee sample corresponding to the same coffee lot from which fermentation samples were obtained was collected. Sampling was conducted once each producer indicated that the coffee had reached adequate drying conditions. At each production unit, 5 kg of parchment coffee were sampled and stored in 15 kg GrainPro® hermetic bags. From this material, a 1 kg subsample was obtained and packed in GrainPro® sample bags for physical, chemical, and sensory quality analyses (Eshete et al., 2024). These samples were sent to the National Coffee Research Center (Cenicafé), located in Chinchiná, Caldas, Colombia, for the corresponding analyses.

2.6 Microbiological characterization of coffee fermentation

Microbiological characterization of the coffee fermentation process was performed using amplicon-based metataxonomic sequencing, aimed at taxonomic identification and estimation of relative abundances of bacteria and yeasts present in the samples. Total microbial DNA extraction was conducted by an external specialized laboratory (Macrogen, South Korea) following standardized protocols for food matrices. As a quality control criterion prior to library preparation, samples were required to meet a minimum genomic DNA concentration suitable for amplification of the 16S rRNA and ITS marker regions (Pino et al., 2023). Library construction was carried out through PCR amplification of standard marker regions. For bacterial characterization, the V3–V4 region of the 16S rRNA gene was amplified using primers Bakt_341F (CCTACGGGNGGCWGCAG) and Bakt_805R (GACTACHVGGGTATCTAATCC). For yeast characterization, the ITS region was amplified using primers ITS3 (GCATCGATGAAGAACGCAGC) and ITS4 (TCCTCCGCTTATTGATATGC) (de Carvalho Neto et al., 2018). Libraries were sequenced on an Illumina MiSeq platform using paired-end reads. Raw data were generated in FASTQ format and processed using a standard amplicon bioinformatics workflow. Adapter and primer removal was performed using Cutadapt (Martin, 2011), followed by quality filtering, error correction, paired-end read merging, and chimera removal using DADA2, allowing inference of amplicon sequence variants (ASVs) (Callahan et al., 2016). Normalization and organization of ASV tables were performed in QIIME (Caporaso et al., 2010). Taxonomic assignment was conducted using a Bayesian classifier implemented in DADA2 based on the Ribosomal Database Project approach (Wang et al., 2007), and UNITE databases were used for fungal sequences (Nilsson et al., 2019). Microbiological results were reported as relative abundances (%) of identified taxa at the genus level and, when sequence resolution allowed, at the species level. Additional sequencing quality control metrics and taxonomic assignment outputs are provided as Supplementary material.

2.7 Physical, chemical, and sensory analysis of coffee

Physical, chemical, and sensory quality analyses were conducted at the National Coffee Research Center (Cenicafé) in Chinchiná, Caldas, Colombia.

2.7.1 Physical analysis

Physical coffee quality was evaluated using dry parchment coffee samples, which were hulled to obtain green coffee beans. The physical analysis included determination of moisture content, hulling loss, percentage of defects, presence of physical defects (broca-damaged, black, and sour beans), percentage of healthy beans, and yield factor, following standardized procedures for coffee physical quality analysis applied by Cenicafé (Osorio et al., 2021).

2.7.2 Chemical analysis

Chemical characterization of coffee was performed using near-infrared reflectance spectroscopy (NIRS). Analyses were conducted at Cenicafé on green coffee bean samples using standardized and validated calibration models for Colombian coffee. Contents of chlorogenic acids, caffeine, sucrose, trigonelline, and total lipids were estimated, as well as fatty acid profile composition, including linoleic, oleic, palmitic, stearic, and arachidic acids (Gómez et al., 2021).

2.7.3 Sensory analysis of coffee

Sensory evaluation was carried out through cupping tests in the sensory analysis laboratory of Cenicafé, following established roasting and sample preparation protocols in accordance with Colombian Technical Standard NTC 4883 and the guidelines of the Specialty Coffee Association (SCA). Evaluations were performed by trained cuppers, and attributes recorded included fragrance/aroma, flavor, aftertaste, acidity, body, balance, and overall impression, as well as the presence of sensory attributes and defects (Osorio et al., 2021).

2.8 Data analysis

Data derived from territorial characterization, production system variables, and microbiological, physicochemical, and sensory analyses were organized into multiple structured datasets to evaluate relationships among variables at different analytical levels. These datasets were constructed from specific combinations of variables according to the objective of each analysis, including matrices relating microbial communities with fermentation conditions, spatial origin, sensory attributes, physicochemical composition, and sample-level integrated datasets.

Variables associated with the territorial and productive context of the samples were incorporated as part of the analytical framework, allowing the integration of environmental gradients and production-related factors within the multivariate analysis. These variables were included according to their measurement scale, either as continuous or categorical/grouping variables, depending on the structure of each dataset.

Microbial variables were expressed as relative abundances (%) and aggregated at the genus level, while physicochemical and sensory variables were treated as continuous variables. Prior to multivariate analysis, quantitative variables were centered and scaled to ensure comparability across different units and magnitudes.

Principal Component Analysis (PCA) was applied as an exploratory multivariate technique to identify patterns of association among microbiological, physicochemical, sensory, fermentation, and territorial variables. Given the diversity and dimensionality of the datasets, PCA was implemented through a comparative modeling approach in which multiple combinations of variables were evaluated across datasets to identify stable and interpretable structures.

The selection of PCA models was based on both conceptual coherence and statistical performance. Variable combinations were defined according to meaningful relationships among data domains (e.g., microbiology–fermentation, microbiology–spatial context, microbiology–sensory attributes, and physicochemical–sensory relationships). From these combinations, only those PCA models that maximized interpretability and exhibited the highest cumulative explained variance in the first two principal components were retained.

In practical terms, only PCA configurations with cumulative explained variance greater than 40% in PC1 and PC2 were selected for interpretation and graphical representation. This threshold ensured an adequate representation of the multivariate structure of the data while maintaining clarity in visualization and supporting biological and technological interpretation.

All statistical analyses and graphical outputs were performed in R software version 4.4.1 (R Core Team), using the packages dplyr for data manipulation, FactoMineR for multivariate analysis, ggplot2 for visualization, and grid for graphical arrangement.

3 Results

3.1 Description of the coffee-growing territory and production system in Lengupá Province

Table 1 presents a synthesis of the territorial, productive, traditional, biodiversity-related, sociocultural, historical, and reputational attributes of the coffee production system identified in Lengupá Province, based on the survey applied to the producers participating in the study.

3.2 Microbiological characterization of coffee during fermentation

Figure 1 shows the composition of bacterial communities present in fermenting coffee, expressed as relative abundances derived from analysis of the 16S rRNA region. The analyzed samples exhibited a bacterial composition mainly composed of taxa belonging to the genera Leuconostoc, Gluconobacter, Acetobacter, Tatumella, Weissella, and Lactococcus, with variations in the relative proportion of these groups among the evaluated production units.

Figure 1

Figure 2 presents the composition of fungal communities in fermenting coffee, obtained from analysis of the ITS region. Relative abundances indicate the presence of yeasts belonging to the genera Hanseniaspora, Pichia, Kazachstania, Saccharomyces, Wickerhamomyces, Cryptococcus, and other genera detected in variable proportions across samples. In addition, a high percentage of sequences classified as unassigned was recorded, grouped under the categories “Other” or “Unclassified.”

Figure 2

3.3 Physical and chemical quality analysis of coffee

Table 2 presents the results of the physical and chemical characterization of green coffee beans obtained for the analyzed samples.

3.4 Sensory quality analysis of coffee

Table 3 presents the results of the sensory analysis of the evaluated samples, including the scores assigned to the attributes fragrance/aroma, flavor, aftertaste, acidity, body, balance, uniformity, clean cup, sweetness, taster score, and total score. Fragrance/aroma and flavor descriptors were recorded using a numerical coding system to optimize presentation space.

Figures 3–5 present the results of multivariate analyses conducted using Principal Component Analysis (PCA), integrating chemical variables of the coffee bean, microbial communities (bacteria and yeasts), and total SCA score. These plots allow an integrated exploration of the overall structure of associations among the analyzed variables, without establishing causal interpretations in this section. Only variables with a mean explained variance greater than 40% in the first and second components are presented.

Figure 3

Figure 4

Figure 5

4 Discussion

The results of this study allow the identification of coffee quality attributes in Lengupá Province from an integrated territorial perspective, in which physical, chemical, microbiological, and sensory attributes are articulated with tangible and intangible territorial assets. This approach provides relevant elements not only for understanding the differential quality of coffee produced in Lengupá, but also for reflecting on the current dynamics of coffee Denominations of Origin (DOs) in Colombia, particularly with regard to the recognition and operationalization of territorial specificities that underpin origin-based differentiation.

In the coffee DOs currently in force in Colombia, the delimitation of protected areas is defined mainly on the basis of political–administrative references, such as municipalities or departments, as evidenced in the DO Café de Colombia (SIC, 2005) and in the regional DOs Café de Nariño (SIC, 2011a), Café de Cauca (SIC, 2011b), Café del Huila (SIC, 2013), Café de Santander (SIC, 2014), and Café de Tolima (SIC, 2017a). Within this set, the DO Café de la Sierra Nevada presents a supra-departmental delimitation that integrates coffee-producing municipalities from Cesar, La Guajira, and Magdalena, associated with the Sierra Nevada de Santa Marta massif, its altitudinal gradient, and the coffee ecotopes of the region (SIC, 2017b). In parallel, Colombian coffee DOs have grounded their regulatory frameworks in the description of general agroecological conditions, including variety, altitude, climate, and soils, together with the definition of a representative sensory profile and the standardization of practices aimed at ensuring product consistency (Osorio et al., 2021). While these elements have been essential for the legal protection and valorization of regional coffees, the human and cultural dimensions are often addressed in aggregated terms, with limited detail on concrete practices, productive artifacts, and explicit linkages between territory, know-how, and coffee quality.

In this context, the main contribution of the present study lies in identifying and analytically articulating a set of territorial specificities that are rarely explicitly incorporated into DO schemes, yet constitute the material and symbolic basis of origin-linked differential quality in Lengupá. These specificities are summarized in Table 1.

From a territorial and productive standpoint, Lengupá Province is characterized by a predominantly family-based, small-scale coffee system. Most producers manage small farms and, on average, cultivate less than 1 ha planted with coffee (Comité de Cafeteros de Boyacá, 2025). Although the study included coffee growers operating larger areas, these cases do not represent the dominant territorial pattern but rather coexist with a largely small-scale productive base. This feature constitutes a relevant contrast with other coffee territories, including several with DOs, where larger and more technologically intensive productive structures are more common (Osorio et al., 2021). In Lengupá, heterogeneity in farm size does not translate into fragmentation of productive identity but into the coexistence of strategies sustained within a shared territorial, ecological, and cultural framework. This finding is relevant for the discussion of DOs because it suggests that origin-based differentiation does not necessarily depend on productive homogeneity, but rather on coordination processes and collective action that enable shared territorial criteria and the recognition of a common base of quality and know-how in family farming contexts (Pereira et al., 2017).

The varietal diversity identified in Lengupá highlights the influence of Colombia’s national coffee institutional framework in shaping production systems. The predominance of rust-resistant varieties such as Castillo, F6, and Cenicafé 1 reflects a technical orientation centered on productivity, sanitary stability, and agronomic risk reduction, consistent with patterns documented across most coffee-growing regions in the country. This trend has also been reported in Colombian coffee DOs, where the adoption of improved materials is often interpreted as a mechanism of technical standardization and quality assurance aligned with institutional guidelines (SIC, 2005; SIC, 2011a; SIC, 2011b; SIC, 2013; SIC, 2014; SIC, 2017a; SIC, 2017b). In this sense, the role of the National Federation of Coffee Growers, expressed through the use of certified seed, the adoption of resistant varieties, and the widespread use of chemical inputs, structures the homogenization of practices and contributes to the establishment of minimum standards of bean quality.

However, the results indicate that this institutional framework does not eliminate territorial margins of autonomy. Instead, it coexists with farm-level decisions oriented toward sensory differentiation, particularly under small-scale family production. In Lengupá, the continued presence of varieties traditionally associated with differentiated sensory profiles, such as Bourbon and Geisha, reflects local experimentation and decision-making that are rarely discussed explicitly in DO resolutions, where varietal considerations tend to emphasize materials endorsed by the national institutional framework. This coexistence reinforces the idea that origin-based differentiation is shaped not only through technical standardization, but also through deliberate valuation of cup quality, local know-how, and the pursuit of distinctive sensory attributes. Previous studies have shown that these factors influence small producers’ engagement with DO schemes, which are often perceived as frameworks for flexible coordination and territorial recognition rather than as instruments that impose uniform production models (Laksono et al., 2021). In this sense, the Lengupá case suggests that DOs may operate as articulation frameworks capable of integrating institutional standards with territorial specificity, rather than as strictly standardizing devices.

A robust territorial asset identified in this study is the predominance of shade and semi-shade coffee production. This feature provides a relevant point of differentiation from several Colombian coffee DOs, where shade is mentioned in general terms but is not explicitly articulated with biodiversity, specific practices, and the material organization of production systems (SIC, 2005; SIC, 2011a; SIC, 2011b; SIC, 2013; SIC, 2014; SIC, 2017a; SIC, 2017b). In Lengupá, tree cover and on-farm diversity shape a productive landscape of high ecological complexity, in which shade composition and farm surroundings are linked to diverse associated fauna. This configuration suggests functional ecological interactions typical of long-established shaded systems. This biological network reinforces the multifunctional character of local coffee farming, consistent with evidence indicating that biodiverse coffee systems can generate ecological co-benefits without compromising production performance and, in some contexts, may support conditions associated with bean quality (Wright et al., 2024). From a territorial perspective, these results allow biodiversity to be discussed not only as an environmental attribute, but as a structural component of the coffee landscape that can be integrated into origin-based differentiation narratives, in which product quality is anchored to a specific, historically constructed, and socially recognized production environment.

A particularly relevant contribution to the DO discussion is the identification of functional continuity between biodiversity, territorial resources, and concrete production practices. The use of local woods in the construction of drying structures and nurseries, as well as traditional tools such as the canasto de gaita for coffee washing, demonstrates that surrounding vegetation is not merely an ecological backdrop but also a source of materials, knowledge, and technical decisions that structure production. Such linkages between biological resources, local know-how, and specific practices tend to remain weakly articulated in DO resolutions, where natural and human factors are often described in general and non-operational terms. In contrast, the Lengupá case illustrates how these territorial specificities can be translated into robust and verifiable descriptive criteria, strengthening the link between biodiversity, territorial governance, and origin designation, in line with recent debates on the role of geographical indications in active biodiversity conservation (Cristallo, 2025).

In addition, the systematic use of sand from local rivers in germination substrates and the traditional practice of disinfecting substrates with boiling water constitute concrete expressions of local know-how that directly connect the physical territory with agronomic management. While these practices do not determine sensory quality in isolation, they form part of a shared technical and cultural matrix that contributes to product identity and territorial embeddedness. In Colombian coffee DOs, such practices are often implicit or diluted within general crop management descriptions, limiting their capacity to capture the diversity of relationships between territory and production processes. Making these practices explicit in the Lengupá case therefore represents a relevant methodological contribution toward origin designation schemes that are more sensitive to local particularities and to operational linkages between territorial resources and productive practices (Cristallo, 2025).

The sociocultural and historical dimension constitutes a structuring component of the Lengupá coffee system. Results indicate a coffee farming tradition strongly anchored in families and the territory, supported by intergenerational transmission of know-how, direct participation of family units in production tasks, and predominant use of local labor. This generational continuity provides a relatively stable framework of shared practices and criteria that contributes to territorial coherence.

The historical dimension constitutes another relevant differentiating element in the construction of Lengupá’s coffee identity. Institutional records situate the expansion and consolidation of Colombian coffee farming as a long-term process beginning in the eighteenth century and strengthening during the nineteenth century, with progressive regional differentiation associated with settlement routes, agroecological conditions, and local production systems (Federación Nacional de Cafeteros de Colombia, 1958). In this context, the historical reference to the municipality of Berbeo and to Hacienda Lengupá, a Jesuit settlement established around 1743, links coffee farming in the territory to early agrarian processes contemporaneous with the initial phases of coffee diffusion in the country. This suggests that Lengupá may have served as a historical corridor connecting early coffee nuclei in the northeastern Andes with later expansion areas. While this hypothesis requires corroboration through targeted historical and documentary research, it supports the temporal depth of coffee activity in the province. Unlike current coffee DOs, where historical narratives are typically presented at broad scales, the Lengupá case enables a more localized historical reading anchored in a concrete microregion and a long-term territorial trajectory.

Consistent with this territorial assemblage, in which historical, environmental, sociocultural, and productive elements converge, the microbiology of coffee fermentation constitutes a key dimension for understanding how local practices and territorial conditions translate into differential coffee characteristics (Figures 1, 2). Microbiological characterization was based on pooled samples integrating subsamples collected throughout fermentation in order to capture the overall community profile. This design responds to the partially overlapping microbial successions typical of coffee fermentation, with populations that emerge, coexist, and replace each other as substrate availability, oxygen conditions, and operational parameters change. Accordingly, within the scope of this study, results should be interpreted as an integrated reading of the fermentation ecosystem rather than as a detailed reconstruction of temporal dynamics at each sampling time, given that pooling prioritizes preservation of the overall process signal (Holguín-Sterling et al., 2023).

Bacterial relative abundance profiles (Figure 1) consistently show the coexistence of lactic acid bacteria (LAB), with predominance of Leuconostoc and the presence of Weissella, Lactococcus, and Levilactobacillus, together with acetic acid bacteria (AAB) such as Gluconobacter and Acetobacter, as well as taxa associated with mixed fermentations, including Tatumella and other Enterobacteriaceae. This assemblage aligns with reports for coffee fermentations in Colombia, where functional consortia composed of LAB and AAB are frequently observed and where relative proportions vary with processing conditions and practices rather than with strict geographical provenance (Holguín-Sterling et al., 2023). Complementarily, metataxonomic studies in Colombian coffee farms have described a core fermentation microbiome in which genera such as Leuconostoc and Gluconobacter occur across production units, while other taxa appear differentially depending on process management (Góngora et al., 2024).

LAB become particularly relevant when considering their functional role and their relationship with sensory performance. In the multivariate analysis (Figure 4), genera such as Leuconostoc and Lactococcus project in the same direction as the total SCA score vector, indicating a positive association between their higher relative contribution and better sensory performance. Studies on coffee fermentation in Colombia have reported that LAB-dominated communities, particularly those with high participation of Leuconostoc and other Lactobacillales, tend to exhibit more stable fermentation dynamics, progressive acidification, and controlled mucilage transformation, favoring cleaner and more balanced sensory profiles (Cruz-O’Byrne et al., 2023). In this context, the Lengupá results suggest that LAB contribute to sustaining conditions compatible with desirable sensory expression within a territorially mediated fermentation style shaped by shared processing practices.

A central point in the microbiological discussion concerns variation in AAB relative abundance, particularly Acetobacter and Gluconobacter. In Figure 4, these taxa project in directions opposite to the total SCA score vector, suggesting that, within the observed processing conditions, greater relative weight of AAB covaries with less favorable sensory performance, without implying a direct causal relationship. This pattern is consistent with reports in which AAB participate in sugar and ethanol oxidation, but their relative dominance may contribute to excessive acetic acid accumulation and to vinegary or over-fermented notes when process control is insufficient (Haile and Kang, 2019).

Ecologically, the presence of Acetobacter and Gluconobacter should be interpreted as part of expected microbial transitions in coffee fermentation. These groups often become relevant in early phases or under conditions favoring oxidation, before being progressively displaced by LAB as substrate and environmental conditions change (de Carvalho Neto et al., 2018). Metataxonomic studies have reported that while AAB are common members of coffee fermentation consortia, sustained increases in their relative abundance tend to be associated with a greater incidence of sensory defects, whereas a more balanced functional relationship between AAB and LAB is linked to better cup performance (Peñuela-Martínez et al., 2023).

Taken together, the Lengupá results support interpreting microbiology as a functional expression of processing management styles rather than as an isolated territorial attribute. PCA suggests that technical decisions related to fermentation practices modulate the balance between AAB and LAB, influencing the likelihood of expressing desirable sensory attributes or defects. This interpretation is particularly relevant for an origin-linked label because it allows translation of microbial complexity into verifiable management and control criteria, without proposing exclusion of specific microbial groups or assuming that their presence is inherently negative.

For the fungal component, relative abundance profiles show a consistent predominance of yeasts of the genus Hanseniaspora, accompanied by Pichia, Torulaspora, and unresolved taxa within Saccharomycetales (Figure 2). This configuration occurs across municipalities and fermentation types, suggesting a shared yeast profile at the territorial scale. In PCA, Hanseniaspora projects in the same multivariate space as the total SCA score (Figure 5), indicating consistent covariation between its relative abundance and sensory performance. Functionally, Hanseniaspora species are characterized by high metabolic activity linked to pathways involved in the transformation of aromatic precursors derived from amino acids, including shikimate-, phenylpyruvate-, mandelate-, and Ehrlich-related routes, which can contribute to the formation of aromatic alcohols and acetylated esters of sensory relevance (Valera et al., 2025). In this context, the recurrence of Hanseniaspora may be interpreted as part of a territorially mediated fermentation style that favors early aromatic complexity under spontaneous fermentation, rather than as a feature of isolated practices or a single locality.

The fraction classified as “Other” or “Unclassified,” visible both in relative abundance (Figure 2) and in PCA projection (Figure 5), likely reflects microbial complexity not fully resolved by the metataxonomic approach used, including limits of taxonomic resolution and the inherent diversity of fermenting coffee matrices. Consistent with the exploratory nature of the study, this unassigned fraction highlights a relevant direction for future research aimed at deepening understanding of microbial diversity and functionality associated with local environments and management conditions in Lengupá (Peñuela-Martínez et al., 2023).

From an applied territorial perspective, these results support discussing microbiology not as a checklist of taxa to preserve or eliminate, but as the biological expression of a system of practices. Accordingly, the differential value of Lengupá coffee does not lie in microbial exclusivity, but in the recognizability of a fermentation profile shared across municipalities despite productive differences, shaped by decisions such as fermentation time, oxygen management, temperature control, and process hygiene. This is particularly relevant for the design of an origin-linked label, as it allows translation of microbiological complexity into verifiable technical criteria without imposing rigid requirements regarding the presence or absence of specific microorganisms. Operationally, this opens the possibility of defining good practices and process-control thresholds aimed at reducing defects rather than standardizing microbial profiles, while maintaining diversity of productive styles within a shared quality framework.

Overall, the microbiological results indicate that Lengupá Province exhibits a recognizable fermentation style shared across municipalities, sensitive to processing practices, and associated with coffee sensory performance. This constitutes a functional territorial asset that can be integrated into the narrative and technical criteria of an origin designation, providing a scientific basis for linking local practices, biological processes, and differential product quality.

Regarding physical and chemical components, the similarity observed between means and medians for most analyzed variables suggests a common baseline of bean quality at the territorial scale despite productive heterogeneity among farms (Table 2). This is relevant for origin designation discussions because it indicates that Lengupá is not defined solely by variability, but also by shared features of coffee composition. Nevertheless, results identify critical improvement points, particularly moisture control and coffee berry borer incidence, whose variability may affect product stability and subsequent performance. Chemical compounds were determined using near-infrared spectroscopy (NIRS), a technique previously validated for green coffee beans in the same laboratory where the samples in this study were processed (Gómez et al., 2021).

The bean chemical composition observed in Lengupá (Table 2) falls within ranges comparable to those described for Colombian coffees assessed at regional scales, where sucrose is recognized as a relevant precursor and cup quality emerges from the interaction between bean composition and post-harvest management rather than from a single chemical marker (Osorio et al., 2021). Within this framework, chlorogenic acids should be interpreted cautiously due to their dual role in quality, given that their contribution depends on relative level and subsequent transformations; therefore, isolated readings are insufficient to anticipate sensory performance. In Figure 3, PCA suggests a positive association between SCA score and altitude and, to a lesser extent, lipid-related variables, consistent with evidence linking higher-altitude environments and their microclimates, including incident radiation, with slower maturation and conditions that can favor higher-quality sensory attributes, although modulated by crop exposure and processing type (Soares Ferreira et al., 2022). Partial alignment of the score with total lipids and with fatty acids such as linoleic and palmitic acids is consistent with their dominance in green coffee lipid profiles and with altitude-related variation, providing a plausible basis for covariation with attributes such as body and persistence (Tsegay et al., 2020). In contrast, the divergent projection of sucrose and chlorogenic acids reinforces that, within the observed territorial range, their relative variation does not by itself explain sensory performance, and that Lengupá coffee quality is better interpreted as an integrated outcome of environment, agronomic management, and processing decisions.

From a sensory standpoint, Table 3 indicates that a substantial proportion of samples, when not affected by severe defects, reach specialty coffee scores and exhibit complex and heterogeneous profiles characterized by the coexistence of sweet and fruity notes, balanced acidity, and good body. This diversity confirms that the sensory potential of Lengupá coffee is already expressed within the current production system and that origin-based differentiation does not require radical transformations, but rather more rigorous technical control of post-harvest practices in a broad sense, including fermentation, drying, and storage. By contrast, samples with severe defects show a marked loss of complexity and sensory value, reinforcing that the main limitations are operational rather than territorial and are associated with failures in post-harvest management.

This interpretation is supported by multivariate analyses (Figures 3–5), which show consistent associations between SCA score and sets of chemical and microbiological variables, without robust segregation by municipality. This suggests that the sensory identity of Lengupá coffee reflects transversal territorial coherence shared across municipalities, where similar agroecological conditions and widely diffused processing practices generate comparable patterns, while observed differences are explained mainly by management and process-control decisions. In this context, the sensory complexity reflected in Table 3 can be interpreted as the result of interactions between bean chemical precursors and microbial dynamics during processing, whose final expression depends on process balance rather than on a single factor, in line with approaches recognizing fermentation and post-harvest processing as critical stages in the construction of coffee sensory profiles (Sunarharum et al., 2018).

Finally, the limits of the study and future steps should be acknowledged. The exploratory nature of the research and the sample size justify interpreting the findings as territorial hypotheses. Future work should expand sampling, incorporate time-resolved fermentation analyses, and advance the translation of these territorial specificities into technical and narrative criteria that may strengthen a potential origin designation. In this sense, the present study does not represent an endpoint, but rather a foundation for rethinking how Colombian coffee DOs might more explicitly incorporate the diversity and richness of their territories.

5 Conclusion

Overall, this study shows that coffee quality in Lengupá Province is configured as an integrated territorial construct, in which physical, chemical, microbiological, and sensory attributes are articulated with agroecological conditions, production practices, local know-how, and sociocultural dynamics consolidated over time. The transversal coherence observed across the municipalities of the province, together with internal variability mainly associated with management decisions and process control, supports interpreting Lengupá as a coffee microregion with shared agroecological, productive, and sociocultural bases that extend beyond political-administrative boundaries. From an integrated analytical perspective, microbiological, physicochemical, and sensory characterization indicates that coffee quality reflects shared productive and fermentative styles, modulated by local post-harvest practices, rather than isolated markers, resulting in a common territorial baseline of quality with sensory expressions that differ according to post-harvest management. These findings provide conceptual and technical elements to discuss origin-linked quality protection schemes based on territorial, ecological, and productive coherences, suggesting that microregions may constitute more relevant units for the valorization and recognition of origin in small-scale coffee-farming contexts.

References

• 1

  Beltrán-VargasH. J.Flores-SánchezD.Vázquez-GarcíaV.Espinosa-CalderónA. (2023). Agroecological management of smallholding coffee cropping systems in the highlands of Veracruz, Mexico. Trop. Subtrop. Agroecosyst.26:077. doi: 10.56369/tsaes.4604

  • CrossRef
  • Google Scholar

• 2

  CallahanB. J.McMurdieP. J.RosenM. J.HanA. W.JohnsonA. J. A.HolmesS. P. (2016). DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods13, 581–583. doi: 10.1038/nmeth.3869,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 3

  CaporasoJ. G.KuczynskiJ.StombaughJ.BittingerK.BushmanF. D.CostelloE. K.et al. (2010). QIIME allows analysis of high-throughput community sequencing data. Nat. Methods7, 335–336. doi: 10.1038/nmeth.f.303,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 4

  Cenicafé (2026). Boletín Agrometeorológico Cafetero. Enero 2026. Manizales: Centro Nacional de Investigaciones de Café.

  • Google Scholar

• 5

  Comité de Cafeteros de Boyacá (2025). Estadísticas Cafeteras Departamentales. Tunja: Comité Departamental de Cafeteros de Boyacá.

  • Google Scholar

• 6

  Cortés-MacíasE. T.Fuentes LópezC.GentileP.Girón-HernándezJ.Fuentes LópezA. (2022). Impact of post-harvest treatments on physicochemical and sensory quality attributes of coffee (Coffea arabica L.): toward a sustainable development of high-quality coffee in Huila, Colombia. Postharvest Biol. Technol.187:111852. doi: 10.1016/j.postharvbio.2022.111852

  • CrossRef
  • Google Scholar

• 7

  CristalloD. (2025). Geographical indications and biodiversity: an overview of regulatory challenges and critical perspectives. New Medit.3, 47–58. doi: 10.30682/nm2503e

  • CrossRef
  • Google Scholar

• 8

  Cruz-O’ByrneR.Piraneque-GambasicaN.Aguirre-ForeroS. (2023). Lactic acid bacteria diversity and dynamics in Colombian coffee fermentation. Coffee Sci.18:e182141. doi: 10.25186/.v18i.2141

  • CrossRef
  • Google Scholar

• 9

  de Carvalho NetoD. P.de Melo PereiraG. V.de CarvalhoJ. C.Thomaz SoccolV.SoccolC. R. (2018). High-throughput rRNA gene sequencing reveals high and complex bacterial diversity associated with Brazilian coffee bean fermentation. Food Technol. Biotechnol.56, 90–95. doi: 10.17113/ftb.56.01.18.5546,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 10

  EsheteF. A.TolaY. B.KuyuC. G.TolessaK.MulugetaD.GureS. (2024). Physicochemical stability and sensory quality of selected Ethiopian coffee (Coffea arabica L.) brands as affected by packaging materials during storage. Heliyon10:e29323. doi: 10.1016/j.heliyon.2024.e29323,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 11

  Federación Nacional de Cafeteros de Colombia (1958). Manual del Cafetero Colombiano. Bogotá: Federación Nacional de Cafeteros de Colombia.

  • Google Scholar

• 12

  GómezL.CaballeroA.BaldiónJ. V. (1991). Ecotopos Cafeteros de Colombia. Bogotá: Federación Nacional de Cafeteros de Colombia.

  • Google Scholar

• 13

  GómezC. R.OrtizA.GallegoC. P.EcheverriL. F. (2021). Validación de curvas de calibración por NIRS para la predicción de compuestos químicos de café almendra. Rev. Cenicafé72:e72204. doi: 10.38141/10778/72204

  • CrossRef
  • Google Scholar

• 14

  GóngoraC. E.Holguín-SterlingL.Pedraza-ClarosB.Pérez-SalinasR.OrtizA.Navarro-EscalanteL. (2024). Metataxonomic identification of microorganisms during the coffee fermentation process in Colombian farms (Cesar Department). Foods13:839. doi: 10.3390/foods13060839,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 15

  HaileM.KangW. H. (2019). The role of microbes in coffee fermentation and their impact on coffee quality. J. Food Qual.2019:4836709. doi: 10.1155/2019/4836709

  • CrossRef
  • Google Scholar

• 16

  Holguín-SterlingL.Pedraza-ClarosB.Pérez-SalinasR.OrtizA.Navarro-EscalanteL.GóngoraC. E. (2023). Physical–chemical and metataxonomic characterization of the microbial communities present during the fermentation of three varieties of coffee from Colombia and their sensory qualities. Agriculture13:1980. doi: 10.3390/agriculture13101980

  • CrossRef
  • Google Scholar

• 17

  LaksonoP.IrhamM.MulyoJ. H.SuryantiniA.PermadiD. B. (2021). Small-scale farmers’ preference in adopting geographical indications’ code of practice to produce coffee in Indonesia: a choice experiment study. E3S Web of Conf.316:02018. doi: 10.1051/e3sconf/202131602018

  • CrossRef
  • Google Scholar

• 18

  MartinM. (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal17, 10–12. doi: 10.14806/ej.17.1.200

  • CrossRef
  • Google Scholar

• 19

  NilssonR. H.LarssonK.-H.TaylorA. F. S.Bengtsson-PalmeJ.JeppesenT. S.SchigelD.et al. (2019). The UNITE database for molecular identification of fungi: handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res.47, D259–D264. doi: 10.1093/nar/gky1022,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 20

  OsorioV.PabónJ.CalderónP. A.ImbachiL. C. (2021). Physical and sensory quality and chemical composition of coffee grown in the Department of Huila. Cenicafé J.72:e72201. doi: 10.38141/10778/72201

  • CrossRef
  • Google Scholar

• 21

  Pabón UsaquénJ. P.Osorio PérezV. (2019). Factores e indicadores de la calidad física, sensorial y química del café. In Centro Nacional de Investigaciones de Café (Ed.), Aplicación de ciencia, tecnología e innovación en el cultivo del café ajustado a las condiciones particulares del Huila, Manizales: Cenicafé, 162–187. doi: 10.38141/10791/0005_7

  • CrossRef
  • Google Scholar

• 22

  Peñuela-MartínezA. E.Velasquez-EmilianiA. V.AngelC. A. (2023). Microbial diversity using a metataxonomic approach, associated with coffee fermentation processes in the Department of Quindío, Colombia. Fermentation9:343. doi: 10.3390/fermentation9040343

  • CrossRef
  • Google Scholar

• 23

  PereiraM. E. B. G.LourenzaniA. E. B. S.BankutiS. M. S.PigattoG. A. S. (2017). Coordenação na agricultura familiar e o desenvolvimento territorial: o caso das indicações geográficas para o café. Rev. Econ. Sociol. Rural.55, 131–178. doi: 10.5007/2175-7984.2016v15nesp1p131

  • CrossRef
  • Google Scholar

• 24

  PinoA. F. S.Delgado EspinosaZ. Y.Ramos CabreraE. V. (2023). Characterization of the rhizosphere bacterial microbiome and coffee bean fermentation in the Castillo-Tambo and Bourbon varieties in the Popayán-Colombia plateau. BMC Plant Biol.23:217. doi: 10.1186/s12870-023-04182-2,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 25

  Sanz-CañadaJ.MuchnikJ. (2016). Geographies of origin and proximity: approaches to local agro-food systems. Cult. Hist. Digit. J.5:e002. doi: 10.3989/chdj.2016.002

  • CrossRef
  • Google Scholar

• 26

  ScholzM. B. S.KitzbergerC. S. G.PrudencioS. H.SilvaR. S. S. F. (2018). The typicity of coffees from different terroirs determined by groups of physico-chemical and sensory variables and multiple factor analysis. Food Res. Int.114, 72–80. doi: 10.1016/j.foodres.2018.07.058,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 27

  SIC. (2005). Café de Colombia. Acto administrativo de protección de la denominación de origen: Resolución No. 4819 de 4 de marzo de 2005. Bogotá: Superintendencia de Industria y Comercio.

  • Google Scholar

• 28

  SIC. (2011a). Café de Nariño. Acto administrativo de protección de la denominación de origen: Resolución No. 6093 de 11 de febrero de 2011. Bogotá: Superintendencia de Industria y Comercio.

  • Google Scholar

• 29

  SIC. (2011b). Café de Cauca. Acto administrativo de protección de la denominación de origen: Resolución No. 41788 de 10 de agosto de 2011. Bogotá: Superintendencia de Industria y Comercio.

  • Google Scholar

• 30

  SIC. (2013). Café del Huila. Acto administrativo de protección de la denominación de origen: Resolución No. 17989 de 16 de abril de 2013. Bogotá: Superintendencia de Industria y Comercio.

  • Google Scholar

• 31

  SIC. (2014). Café de Santander. Acto administrativo de protección de la denominación de origen: Resolución No. 50042 de 25 de agosto de 2014. Bogotá: Superintendencia de Industria y Comercio.

  • Google Scholar

• 32

  SIC. (2017a). Café de Tolima. Acto administrativo de protección de la denominación de origen: Resolución No. 2458 de 30 de enero de 2017. Bogotá: Superintendencia de Industria y Comercio.

  • Google Scholar

• 33

  SIC. (2017b). Café de la Sierra Nevada. Acto administrativo de protección de la denominación de origen: Resolución No. 2484 de 30 de enero de 2017. Bogotá: Superintendencia de Industria y Comercio.

  • Google Scholar

• 34

  Soares FerreiraD.da Silva OliveiraM. E.RibeiroW. R.FileteC. A.CastanheiraD. T.RochaB. C. P.et al. (2022). Association of altitude and solar radiation to understand coffee quality. Agronomy12:1885. doi: 10.3390/agronomy12081885

  • CrossRef
  • Google Scholar

• 35

  SunarharumW. B.WilliamsD. J.SmythH. E. (2018). Effect of different post-harvest processing methods on the sensory profile of coffee assessed by a static group. Agric. Food Sci. Sustain. Agric. Environ.1, 9–14. doi: 10.21776/ub.afssaae.2018.001.01.2

  • CrossRef
  • Google Scholar

• 36

  TavaresB. C.ValdugaV. (2023). Coffeescape: análise da produção bibliográfica internacional sobre paisagens culturais do café. Rev. Dep. Geogr.43:e206540. doi: 10.11606/eISSN.2236-2878.rdg.2023.206540

  • CrossRef
  • Google Scholar

• 37

  Torres-SalcidoG.Sanz-CañadaJ. (2018). Territorial governance: a comparative research of local agro-food systems in Mexico. Agriculture8:18. doi: 10.3390/agriculture8020018

  • CrossRef
  • Google Scholar

• 38

  TsegayG.Redi-AbshiroM.ChandravanshiB. S.EleE.MohammedA. M.MamoH. (2020). Effect of altitude of coffee plants on the composition of fatty acids of green coffee beans. BMC Chem.14:36. doi: 10.1186/s13065-020-00688-0,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 39

  UrugoM. M.TolaY. B.KebedeB. T.OgahO.MattinsonD. S. (2024). Associations of Arabica coffee cup quality with green bean geographic origin, physicochemical properties, biochemical composition, and volatile aroma compounds. J. Agric. Food Res.18:101549. doi: 10.1016/j.jafr.2024.101549

  • CrossRef
  • Google Scholar

• 40

  ValeraM. J.BoidoE.FariñaL.DellacassaE.CarrauF. (2025). Functional metabolism of aromatic precursors in Hanseniaspora: a source of natural bioactive compounds. FEMS Yeast Res.25:foaf049. doi: 10.1093/femsyr/foaf049,

  • Pubmed Abstract
  • CrossRef
  • Google Scholar

• 41

  WangQ.GarrityG. M.TiedjeJ. M.ColeJ. R. (2007). Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol.73, 5261–5267. doi: 10.1128/AEM.00062-07

  • CrossRef
  • Google Scholar

• 42

  WrightD. R.GordonA.BennettR. E.SelinskeM. J.LentiniP. E.GarrardG. E.et al. (2024). Biodiverse coffee plantations provide co-benefits without compromising yield. J. Sustain. Agric. Environ.3, 1–12. doi: 10.1002/sae2.70005

  • CrossRef
  • Google Scholar