The Crandell-Rees Feline Kidney Cells (CRFK) were cultured in Dulbecco's modified Eagle's medium (DMEM; Corning) supplemented with 10 % fetal bovine serum (FBS) and 1% antibiotics (Penicillin-Streptomycin Solution, Corning) at 37°C in a humidified atmosphere containing 5% CO₂. The cell line presented in this study were obtained from American Type Culture Collection and represented the permissive cells for FeHV-1 (ATCC).

The first set of experiments aimed to demonstrate the dependence of autophagy triggered by FeHV-1 on the viral dose. In brief, FeHV-1 strain Ba/91 (kindly provided by Prof. C. Buonavoglia, School of Veterinary Medicine of Bari) at a multiplicity of infection (MOI) of 0.1, 1, and 10 were used to infect 90% confluent 25 cm² flasks. After 2 h of viral adsorption, the infected and control cells were washed twice with phosphate-buffered saline (PBS) and incubated in fresh medium for 24 h (25). Cryolysates were obtained and employed for the western blot analysis. In the same experiment, we included the use of UV-inactivated FeHV-1 to assess whether autophagy was also induced by replication-incompetent viruses.

The second set of experiments aimed to prove the time dependence of the FeHV-1 mediated autophagy. Briefly, FeHV-1 strain Ba/91 at a MOI of 1 was used to infect 90% confluent 25 cm² flasks. After 2 h of viral adsorption, cells were incubated at different time points (3-6-12-24-48-72 h post infection), and pellets, supernatants, and cryolysates were obtained and employed for the subsequent analysis.

The third panel of experiments aimed to evaluate the proviral or antiviral role of the autophagy induced by FeHV-1. The same experiments as described above were replicated in 6-well plates, where the cells were treated with different chemicals to assess their properties to interfere with autophagic flux and the viral replication process (26). Cells were incubated for 3 h prior to infection with DMEM containing the following chemicals and concentrations: 100 nM bafylomycin A1 (BAF) (Sigma), 50 μM hydroxychloroquine (CHL) (Sigma), 100 nM rapamycin (RAP) (Sigma). After infection, fresh medium was added to monolayers, harvested at 12, 24, 48, and 72 h (including infected and control cells) (14, 27).

All experiments described in the previous subsection were replicated in 96-wells plates. The 3-(4,5-dmethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) was prepared according to the procedure used by Montagnaro et al. (28). Briefly, 100 μl of the reagent (0.5 mg/mL; SERVA) was added to each well and kept at 37°C. After 1 h, 100 μl of solubilization buffer (dimethylsulfoxide) was added with the aim of dissolving the formazan crystals produced by the viable cells. After 3 h at 37°C, the optical absorbance at 570 nm was read using a spectrophotometer. The MTT method was also used to determine the cytotoxic effects of the chemical reagents and siRNA. The results were expressed as a percentage of cell viability, using the control group as reference value. Each experiment was performed in triplicate.

A three-color immunofluorescence staining method was performed with control and infected cells. Primary antibodies against LC3-II (Novus Biologicals, rabbit monoclonal antibody) and FeHV-1 (Novus Biologicals, mouse monoclonal) were used according to manufacturer's instructions (diluted 1:200 in BSA). Secondary labeled antibodies (Anti-rabbit secondary antibody Alexa Fluor 488 and anti-mouse secondary antibody Alexa Fluor 610) were used (ThermoFischer Scientific) at a dilution of 1:100. Cell nuclei were stained using 4′,6-diamidin-2-fenilindolo (DAPI; Vector Laboratories). A laser scanning microscope (Leica™ Microsystems, Germany) was used for scanning and photography.

Control and infected cells from each experiment were washed twice with PBS and scraped. After centrifugation, the obtained pellets were then lysed on ice for 30 min in lysis buffer (1 mM EDTA, 150 mM NaCl, 50 mM TRIS-HCL pH7.5), supplemented with protease and phosphatase cocktail inhibitors (Sigma). After the determination of lysate concentration by the Bradford assay (Bio-rad), approximately 20 μg of each lysate was mixed with Laemmli buffer 5x, heated at 96°C for 5 min and separated in acrylamide gels (acrylamide percentage ranging from 10 to 15%). Each gel was transferred into a polyvinylidene difluoride (PVDF) or nitrocellulose (Biorad) membrane using a semidry transfer apparatus (TransBlot Turbo, Bio-Rad). Each membrane was blocked for 1 h at room temperature using 5% Bovine Serum Albumin (BSA; Serva) or non-fat dry milk (NFDM; Serva) dissolved in Tris-buffered saline (TBS: 12.5 mM Tris–HCl pH 7.4; 125 mM NaCl). Then the membranes were incubated overnight with a panel of primary antibodies (1:1000): LC3I/II (Cell signaling), SQSTM1/p62 (Cell signaling), β-Actin (Santacruz), α-tubulin (Cell signaling), and FeHV-1 (Novus biological). After three wash steps made using TTBS, an appropriate secondary peroxidase-conjugated antibody (Cell signaling) was used for a 1-h incubation. Visualization was performed using Clarity Western ECL Substrate (Bio-rad) and a ChemiDoc Blot scanner (Bio-Rad). Protein bands were detected, and expression levels were assessed by densitometric analysis using Image Lab software.

Supernatants from previous experiments were serially diluted and used to infect CRKF cultured in 96-well plates with DMEM supplemented with 2% SFB. The Reed-Muench method was used to determine the viral titer (29). DNA was extracted from aliquots of the same supernatants using a commercial kit (Qiagen), quantified, and used as a template for gene expression analysis. The thymidine-kinase (TK) gene was amplified in a SYBR green real time PCR using specific primers (Forward primer: 5′ TGTCCGCATTTACATAGATGG 3′; Reverse primer: 5′ GGGGTGTTCCTCACATACAA 3′) (25, 30). A CFX 96 Touch real-time PCR detection system was used for the real-time reading of the reaction (Bio-rad). Expression was measured using a standard curve generated with virus crude DNA (TCID ₅₀ 10⁷) at serial dilutions.

To determine the effects of cell autophagy on viral replication a small interfering RNA (siRNA) approach was used. The sequence of siRNA targeting the autophagy-related genes ATG5 was synthesized (sense 5′GGAUGCAAUUGAAGCUCAUtt 3′ and antisense 5′ AUGAGCUUCAAUUGCAUCCtt 3′) and used to transfect CRFK monolayers in 6-well plates using Lipofectamine 3000 (Thermo Fisher) and following the manufacturer's instructions. ATG5 initiates the formation of double membrane vesicles, and its silencing is commonly used in the study involving autophagy and viruses. Briefly, two microtubes were prepared separately, the first containing 10 pm of siRNA and 250 μl Optimem, the second containing 125 μl Optimem and 7.5 μl of Lipofectamine. The two mixes were combined in equal parts and were added to the monolayers after 15 min of incubation. After 24 and 48 h, monolayers were infected with FeHV-1 using a MOI of 1. At 24 h after infection, supernatants and pellets were used as described above. The siRNA efficiency was assessed by measuring the protein expression in a western blot analysis using a specific ATG5 antibody (Cell Signaling).

All experiments were performed independently three times. Variables are expressed as mean ± standard deviation (SD) and were analyzed by one-way ANOVA and multiple t test using GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA, USA). A p value of < 0.05 was considered statistically significant (indicated as ^*) and a p value lower than 0.01 was considered highly statistically significant (indicated as ^**).

In order to assess the autophagy modulation mediated by FeHV-1, western blot analysis was used with two specific markers: LC3-II and SQSTM1/p62. Microtubule-associated protein light chain II (LC3-II) is an important autophagy marker that origins from LC3-I (unlipidated form), and whose accumulation occurs during autophagy induction (5). The addition of the lipid group (phosphotidylethanolamine) is mediated by Atg-7 and permits LC3-II to associate with the autophagosomal membrane. LC3-II increases during autophagy and is commonly used to assess autophagy activity. Another important marker examined in this study is SQSTM1/p62, whose degradation or accumulation indicates whether autophagic flux is complete or incomplete (31). The first experiment investigated viral-dose dependent autophagy and the role of inactivated FeHV-1 in the induction of autophagy. With increasing MOI of FeHV-1, we observed an increase in the LC3-II expression and a progressive decrease in SQSTM1/p62 (Figures 1A–C). There were no differences between cells infected with the UV-treated virus and control cells, indicating that replication is required for induction of autophagy (Figure 1A). These results suggest that autophagy was dose-dependent. In the following experiments, a MOI of 1 was used for viral infection.

We discovered a significant increase in the LC3-II expression as well as a statistically significant decrease in SQSTM1/p62 12 h after infection, indicating a complete autophagic flux. Both processes increased over time with respect to the control (Figures 1D–F). Thus, FeHV-1-mediated autophagy was not only dependent on viral dose but also on time.

These results were confirmed in immunofluorescence analysis performed using a specific LC3-II monoclonal antibody and a specific FeHV-1 antibody. Autophagosomes were observed mainly in the infected cells (also in this case beginning from 12 h from infection), which expressed FeHV-1 proteins in the nuclei (very evident at 48 and 72 h post infection) as shown in Figure 2.

Permissive CRFK cells were treated with autophagy inducers and inhibitors before being infected with FeHV-1 to further determine the relationship between autophagy and FeHV-1 infection and to evaluate its possible proviral or antiviral role. BAF and CHL, which block the phagosome-lysosome fusion, were used as late-stage autophagy inhibitors, whereas RAP was utilized as an autophagy inducer to decrease mTOR activity and promote cell autophagy. The difference in viability between treated and infected cells and infected cells was evaluated using the MTT assay (Figure 3). The cytotoxic effects of FeHV-1 were reduced by late-stage autophagy inhibitors. Cells treated with BAF at 48 and 72 h as well as with CHL at 72 h showed a significant increase in viability (Figures 3A–C). FeHV-1-mediated cytotoxicity on permissive cells increased with the use of RAP, resulting in significantly lower viability values at 24 and 48 h post infection. The viability of CRFK cells was not significantly affected when modifications of autophagy were carried out using the described inhibitors and inducers (Figure 3).

In a further step, a new panel of experiments was designed to assess the impact of the inhibitors and inducers described above on viral titers. The use of BAF and CHL significantly reduced viral yield, as shown in Figures 3A, B (from 12 h for BAF and 24 h p.i. for CHL). At 24 h after infection, the use of RAP increased the viral titer (Figure 3C).

Protein lysates were obtained from infected CRFK at different times in the presence or absence of the previously mentioned compounds. Conversion of LC3-I to LC3-II, the degradation of SQSTM1/p62, as well as the expression of two viral proteins (gB and gI), were evaluated for all the compounds.

After infection, LC3-II and SQSTM1/p62 increased significantly in response to BAF treatment (12 h p.i.) (Figure 4A). Subsequently, LC3-II levels decline or return to baseline levels, while p62 accumulation persists for all observed time points (Figures 4B, C). Interestingly, we observed a decrease in gI protein expression at each time point and an increase in gB protein beginning 24 hours p.i., reversing the gI/gB ratio in favor of gB (Figures 4D, E).

The densitometric analysis revealed that CHL treatment reduced autophagosome turnover and SQSTM1/p62 degradation (Figure 5A). In fact, LC3-II levels significantly increased at each time point, and the increase of SQSTM1/p62 was always significant except 48 h p.i. (Figures 5B, C). The concentrations of gB and gI were lower in treated cells than in untreated cells, particularly at 24 and 72 h after infection for gB and 48 and 72 h after infection for gI (Figures 5D, E).

Effects of RAP on autophagy and viral glycoprotein expression were also detected using Western blot, with results opposite to those observed using late-stage inhibitors (Figure 6A). LC3-II expression was significantly reduced after an initial increase (12 h post infection) (Figure 6B). SQSTM1/p62 levels were always significantly lower in treated cells (except after 24 h p.i) (Figure 6C). The expression of gB and gI increased at 24 and 72 h p.i., indicating that rapamycin-induced autophagy facilitated the infection (Figures 6D, E).

To exclude the possibility that pharmacological components had non-specific effects on the experiments and to further investigate the role of autophagy in FehV-1 replication, small interference RNA was used to interfere with the expression of autophagy proteins. Considering the results of the previous experiments, we focused on the late stage of autophagy, and we specifically targeted Autophagy-Related Gene 5 (ATG5), an important regulatory gene during autophagosome formation and maturation.

No differences were observed in the MTT assay between control and ATG^_ cells (Figure 7A). The viral titers determined using the TCID₅₀ assay and real-time PCR showed a significant difference between supernatants collected from ATG5^_ and ATG5 competent cells (Figures 7B, D). Protein expression of ATG5 decreased in ATG5^_ control cells, as shown in Figures 7C, G, especially after 48 h of incubation with siRNA. LC3-II levels in siRNA-treated cells are statistically lower at 48 h post infection (Figure 7H). At the same time, we also evaluated the expression of viral glycoprotein (gB and gI, significantly reduced compared with the infected group) (Figures 7E, F). These findings suggest that autophagy deficiency interferes with FeHV-1 infection.