Abstract
Lymphoma is one of the most common neoplastic diseases in dogs, and T-cell lymphoma in particular has frequently been reported to show limited sensitivity to conventional chemotherapy from the onset of treatment when compared with B-cell lymphoma. Owing to its high-grade and aggressive clinical behavior, there is a strong need to explore novel therapeutic approaches for canine T-cell lymphoma, including strategies targeting aberrant gene regulation. In this study, we focused on the epigenetic enzyme enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) and investigated its functional role in canine T-cell lymphoma. The EZH2 gene was ectopically introduced into canine T-cell lymphoma cell lines using a lentiviral vector system, and colony-forming ability, and apoptosis rate were evaluated. EZH2 overexpression significantly enhanced colony-forming capacity, suppressed apoptosis, and increased the number of viable cells compared with control cells. These findings indicate that elevated EZH2 expression confers a survival advantage to canine T-cell lymphoma cells. The present study provides novel evidence that overexpression of EZH2 itself promotes tumor cell survival and aggressiveness. Our results suggest that EZH2 may play a functional role in the maintenance and progression of at least a subset of canine T-cell lymphoma and may represent a potential driver of tumor malignancy. These findings contribute to a deeper understanding of lymphomagenesis and support the potential of EZH2 as a therapeutic target in canine T-cell lymphoma.
1 Introduction
Lymphoma ranks third among the most common neoplastic diseases in dogs. Approximately 70–85% of cases are systemic and high grade, greatly reducing the chance of therapeutic interventions and thus prognosis and with treatment typically involving combination or single-agent chemotherapy as the first-line option. However, even when temporary remission is achieved, recurrence is common, and response duration is short even in cases responsive to rescue therapy. When considering all subtypes, T-cell lymphomas frequently show limited sensitivity to conventional chemotherapy from the onset of treatment, in comparison to more common subtypes such as B-cell lymphoma (1). The frequent high-grade aggression of certain canine tumors such as T-cell lymphomas grants the exploration of alternative therapeutical approaches, especially those targeting aberrant gene regulation.
Epigenetics refers to regulatory mechanisms, including DNA methylation and histone modifications, which control gene expression without altering the DNA sequence, playing a critical role in cancer development and progression (2). In the medical field, enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) has gained attention as an epigenetic regulator selected by molecular targeted therapies. EZH2 is a key protein constituting polycomb repressive complex 2 (PRC2), a complex involved in regulating differentiation and the cell cycle. Specifically, accumulation of Tri-Methyl-Histone H3 (Lys27) trimethylate (H3K27me3), generated by trimethylation via EZH2, is thought to enhance cell proliferation by suppressing the expression of tumor suppressor genes (3). Moreover, highly activating EZH2 mutations are frequently identified at early stages of tumorigenesis (4), suggesting that aberrantly activated PRC2 functions as a cancer driver. Consequently, EZH2 is recognized as an important tumorigenic factor, expressed in many human tumors, granting the development of EZH2-targeted epigenetic therapies.
While previous studies have reported EZH2 overexpression in multiple canine tumors, including lymphoma, it remains unclear whether this overexpression represents a mere epiphenomenon of malignant transformation or whether EZH2 functions as a key driver that actively contributes to tumor aggressiveness in canine lymphoma (5). Canine lymphoma closely resembles human non-Hodgkin lymphoma in terms of clinical behavior, histopathology, and molecular characteristics, and is therefore considered an excellent spontaneous animal model for the human non-Hodgkin lymphoma (1). Elucidating the shared tumor biological mechanisms between canine and human lymphoma has the potential to advance both human medicine and veterinary oncology. In humans, several studies in hematologic malignancies and various solid tumors have shown that EZH2 inhibition induces growth suppression, apoptosis, and immune activation (3, 6, 7). However, despite the frequent overexpression of EZH2 in tumors, relatively few studies have directly examined the functional consequences of EZH2 overexpression itself. In this study, we investigated the effects of EZH2 overexpression in canine T-cell lymphoma by ectopically introducing the EZH2 gene into canine T-cell lymphoma cell lines and evaluated phenotypic changes to analyze the function of EZH2 as a novel therapeutic target candidate.
2 Methods
2.1 Cell line
A canine T-cell lymphoma cell line, CLC, was provided by the Laboratory of Veterinary Internal Medicine, The United Graduate School of Veterinary Science, Yamaguchi University, where this cell line was originally derived, established, and cultured previously (8). CLC was originally established from a high-grade lymphoma in an eight-year-old female French Bulldog. The cells showed a CD3-positive/CD21-negative phenotype by flow cytometry and were negative for TCRγ and IgH rearrangements by PARR analysis (8). CLC cells were maintained in R10 complete medium [RPMI-1640 with L-Glutamine and Phenol Red (189–02025, Fujifilm Wako, Osaka, Japan) with 10% fetal bovine serum (FBS, A5256801, Invitrogen, Waltham, MA, United States), antibiotic-antimycotic mixed stock solution (09366–44, Nacalai Tesque, Kyoto, Japan) and 55 μM 2-mercaptoethanol (131–14,572, Fujifilm Wako)]. HEK293T cells (Lenti- X 293 T Cell Line) were purchased from Clontech (Mountain View, CA, United States) and maintained in Dulbecco’s modified Eagle medium (DMEM) and high glucose (043–30,085, Fujifilm Wako). Cells were supplemented with 10% FBS (Invitrogen), antibiotic-antimycotic mixed stock solution (Nacalai Tesque), and incubated at 37 °C in an atmosphere containing 5% CO2.
2.2 Cell line authentication statement
CLC cells were maintained at the Laboratory of Veterinary Internal Medicine, the United Graduate School of Veterinary Science, Yamaguchi University. The laboratory where the CLC cells were sourced from confirmed the animal species of origin were dogs (8).
2.3 Lentiviral vectors for lentiviral construction
First-strand cDNA library was synthesized from MDCK cell mRNA by PrimeScrip II 1st strand cDNA Synthesis Kit (6210A, TAKARA Bio, Kyoto, Japan), according to manufacturer’s instructions. The Canis familiaris EZH2 gene was amplified by PCR using the forward primer 5’-GGGGACAAGTTTGTACAAAAAAGCAGGC TTCG CCACCATGGACTACAAAGACGATGACGACAAGATGGG CCAGACTGGGAAGAAA-3′ and the reverse primer 5’-GGGGACC AC TTTGTACAAGAAAGCTGGGTTTCAAGGGATTTCCATCT CTCTTTCG-3′. The EGFP gene was amplified from pEGFP-C1 using the forward primer 5’-AAAAAGCAGGCTTAATGGTGAGCAAGG GCGAG-3′, the reverse primer 5’-AGAAAGCTGGGTTTTACTTG TACAGCTCGTCCATGCC-3′. The PCR products were cloned into pDONR223 and subsequently transferred into pLX302 (#25896, Addgene, Watertown, MA, United States) via the LR clonase reaction. We used pCMV-VSV-G-RSV-Rev and pCAG- HIVgp as packaging plasmids, which were gifted by H. Miyoshi (RIKEN, Tsukuba, Japan).
2.4 Transduction of cells with lentiviral vectors
A culture medium containing virus was produced by co-transfecting plasmids in HEK293T cells using lipofectamine® 3,000 (L3000015, Thermo Fisher Scientific, Waltham, MA, United States) and Plus reagent (11,514,015, Thermo Fisher Scientific), as previously described (9). CLC cells (5 × 105 cells/well) were plated in a 6-well plate and then cultured with 20% viral solution in DMEM (5 mL) and incubated overnight at 37 °C in 5% CO2. For selection of cells stably expressing EZH2, CLC cells were cultured in a medium containing 2.0 μg/mL puromycin. The recombinant DNA experiments were performed with the approval of the Nippon Veterinary and Life Science University Genetic Recombination Experiments Committee.
2.5 Colony assay using methylcellulose medium
Using methylcellulose medium, we cultured EZH2-transfected cells and control cells at the same cell density for the same duration. We then measured colony numbers to evaluate whether differences in colony formation occurred between the two cell types in medium. Cells were seeded at 1.0 × 104 cells/well in 6-well plates containing 2 mL/well of MethoCult™ M3234 medium (03234, STEMCELL Technologies, Vancouver, BC, Canada) and 0.5 mL/well of RPMI medium. Cells were cultured for 4 days at 37 °C, 5% CO₂. Colony numbers in the Methocult medium were counted and measured under an optical microscope. Colonies were subjectively counted as either compact colonies with relatively high cell density or loose colonies with low cell density. Cultured cells in Methocult medium were recovered by washing with PBS and centrifugation (800 × g, 10 min). A total of three measurements were performed.
2.6 Detection of apoptosis by flow cytometry
To evaluate apoptotic cells following EZH2 gene transfer, the MEBCYTO Apoptosis Kit (4,700, Medical & Biological Laboratories, Tokyo, Japan) was used with Annexin V- FITC and propidium iodide (PI) staining. Initially, 2 × 105 cells were suspended in 85 μL of 1 × binding buffer, followed by the addition of 10 μL Annexin V- FITC and 5 μL PI. The mixture was then incubated at 25 °C for 15 min in the dark. The cells were then analyzed using a CytoFLEX flow cytometer (Beckman Coulter, Brea, CA, United States), and the data were processed using FlowJo v10.10.0 (BD Biosciences, Franklin Lakes, NJ, United States). Fluorescence compensation was performed using the following single-stained samples: (1) unstained cells, (2) Annexin V-FITC-stained cells, and (3) Propidium Iodide (PI)-stained cells. Annexin V (+)/PI (−) staining was indicative of early apoptosis. The apoptosis index was calculated as follows: Apoptosis index (%) = Annexin V- single- positive cells (%) + Annexin V/PI double- positive cells (%).
2.7 Statistical analysis
Colony counts are presented as the mean ± standard deviation. For the initial analysis, loose, dense, and total colony numbers were compared between CLC-control and CLC-EZH2 cells using unpaired two-tailed statistical tests. To further evaluate the effects of EZH2 overexpression while accounting for colony type and within-well dependency, colony counts were additionally analyzed using a mixed-effects two-way ANOVA, with vector (CLC-control vs. CLC-EZH2) and colony type (loose vs. dense) as fixed effects, with well included as a random effect. Post–hoc comparisons were performed using Sidak’s multiple comparisons test. To stabilize variance, colony counts were also analyzed after log-transformation. Degrees of freedom were estimated using the Kenward–Roger method. Differences in apoptotic cell populations between groups were analyzed using an unpaired two-tailed Student’s t-test after confirming homogeneity of variance. R (version 4.3.1) was used for statistical analysis. The significance level was set at 5% for all analyses.
3 Results
3.1 EZH2 is expressed in canine lymphoma cell lines following lentiviral gene transfer
A single band corresponding to EZH2 was detected in the cell line at a predicted molecular weight of 95 kDa (Figure 1A). A single band corresponding to α-tubulin was also detected in the cell line at a predicted molecular weight of 55 kDa as a control (Figure 1A). Western blot analysis showed enhanced expression following EZH2 gene introduction.
Figure 1
3.2 EZH2 gene introduction increases colony formation ability in MethoCult medium
Figure 1B shows the morphology of loose and compact colonies formed in MethoCult medium, which assesses clonogenic growth under semi-solid conditions. Loose colonies may represent loosely aggregated cell clusters with a tendency toward cell death indicating poor viability, whereas compact colonies represent compact aggregates of viable, proliferative cells; however, it remains unclear whether the loose phenotype is intrinsic or secondary to culture conditions. Colony formation was evaluated by counting loose and compact colonies in methylcellulose cultures. The mean ± standard deviation of loose colony counts were 527.7 ± 136.5 for the CLC-control cell line and 787.0 ± 130.3 for the CLC-EZH2 cell line, with no statistically significant difference between groups (p = 0.24). In contrast, compact colony counts were significantly higher in CLC-EZH2 cells (3341.3 ± 146.5) compared with CLC-control cells (2511.0 ± 218.5; p = 0.03). Consistently, the total colony count was significantly increased in the CLC-EZH2 cell line (4128.3 ± 34.9) relative to the CLC-control cell line (3038.7 ± 252.2; p = 0.01). Figure 1C shows the initial colony counting results from the first experiment.
To further assess the effects of EZH2 overexpression while accounting for colony type and within-well dependency, colony counts were additionally analyzed using a mixed-effects two-way ANOVA with vector and colony type as fixed effects and well as a random effect. Analysis of raw colony counts demonstrated a significant main effect of EZH2 overexpression, with post hoc comparisons confirming a significant increase in compact colonies, whereas no significant difference was observed in loose colonies. Following log-transformation to stabilize variance, the effect of EZH2 overexpression did not reach statistical significance in either colony type, although a trend toward increased colony formation was observed. Together, these analyses indicate that EZH2 overexpression increases absolute colony numbers, particularly compact colonies, while the relative magnitude of this effect is modest when variance is taken into account.
3.3 EZH2 gene introduction decreased the proportion of apoptotic cells
Figure 2A shows the flow cytometry results for the Annexin V assay in CLC-control and CLC-EZH2. Viable cell numbers were significantly increased in CLC-EZH2 cells compared with control cells (41.8 ± 9.5 vs. 83.2 ± 8.9, p = 0.019; Figure 2B). The mean percentage of early apoptotic cells was 16.7% for the CLC-control cell line and 1.7% for the CLC-EZH2 cell line (p = 0.04). The mean percentage of late apoptotic cells was 46.6% for the CLC-control cell line and 25.7% for the CLC-EZH2 cell line (p = 0.63). Analysis of the four measurements revealed that the CLC-EZH2 cell line had a significantly higher proportion of viable cells and a lower proportion of early apoptotic cells compared to the CLC-control cell line. Furthermore, although not statistically significant, the CLC-EZH2 cell line tended to have a higher proportion of late apoptotic cells than the CLC-control cell line.
Figure 2
4 Discussion
Given the apparent importance of the function of the epigenetic regulator EZH2, we investigated the effects of further enhancing EZH2 activity. In canine T-cell lymphoma cell lines, EZH2 expression was detected, and enforced that the overexpression of EZH2 resulted in increased colony-forming ability and suppression of apoptosis. The expression of EZH2 and its association with tumorigenesis have been reported in numerous human tumors, including lymphoma; however, in dogs, although EZH2 expression has been described in several tumors, its direct association with tumorigenesis remains unclear (5).
In the present study, we were unable to elucidate the precise molecular mechanisms by which EZH2 suppresses apoptosis. While a number of studies have reported relevant findings, our understanding of the precise molecular mechanisms remains incomplete. Notably, chemical inhibition or depletion of EZH2 has been reported to induce apoptosis in both p53-proficient and p53-deficient cancer cells (10, 11). These findings suggest that EZH2 may regulate apoptosis through multiple pathways rather than through a single, linear mechanism. These pathways of apoptosis suppression are multi-faceted and include the downregulation of tumor suppressor genes such as p53 and GSK-3β with the concurrent upregulation of oncogenes, such as STAT3 and NOTCH1 (12, 13). It is understood that this dual regulatory capacity contributes to increased cell survival and proliferation while also helping maintain the stem-like properties in tumor cells, which would in turn promote tumorigenesis and its progression (14). The contrasting fact that EZH2 can also have a tumor suppressive role due to suffering loss-of-function mutations in certain hematological human tumors, illustrates a complex context-dependent function that requires further research to elucidate its role in CLC cell lines (13, 14).
Previous studies have reported that the MYC gene is highly expressed in the CLC cell line (8). Given that activation of the MYC-miRNA-EZH2 feed-forward loop as well as the MYC-EZH2-CDKN1C axis has been described in lymphomas, it is possible that CLC cells harbor such oncogenic regulatory networks (15, 16). In addition, the CLC cell line exhibits hyperphosphorylation of pRb (17). Since EZH2 has been reported to function downstream of the pRB-E2F pathway, these alterations may be mechanistically interconnected (18).
EZH2 is known to harbor gain-of-function hotspot mutations, which are observed in a subset of human lymphomas (3, 7). These mutations can result in increased epigenetic heterogeneity, global reprogramming, and differentiation blockade, among other important oncogenic driving actions (19, 20). Although we were unable to assess the presence of such mutations in this study, it is plausible that similar EZH2 mutations may also exist in canine lymphoma.
In the medical field, therapeutic agents targeting EZH2 exist, some currently undergoing different clinical trial phases to treat relapsing or refractory lymphomas (21). At the cellular level, studies with human-derived cells have reported that EZH2 confers resistance to apoptosis in cancer cells, one of the mechanisms being preventing specific gene expressions that would normally activate as lymphocytes complete maturation, thus driving lymphomagenesis (10, 21).
In Methocult medium, EZH2 gene-transduced canine lymphoma cells exhibited significantly higher colony-forming capacity than control cells. This suggests that EZH2 introduction may be associated with maintaining or enhancing the clonogenic capacity of cultured cells in canine lymphoma cell lines, as has already been demonstrated in mouse-derived hematopoietic cells (22) and human B-cell lymphoma cultured cells (23). However, whether this increase in colony formation directly reflects enhanced self-renewal capacity remains to be determined and warrants further investigation, including the analysis of stemness-associated markers.
We hypothesized that differences in apoptosis underlie the phenotypic changes observed in canine lymphoma cells cultured in MethoCult medium. To test this, we performed an Annexin V assay using flow cytometry. Compared to control cells, the EZH2-transduced canine lymphoma cell line exhibited significantly higher survival rates and a markedly lower proportion of apoptotic cells. Based on this result, it is considered that the introduction of the EZH2 gene suppressed apoptosis in cultured canine lymphoma cells, thereby enhancing tumorigenesis by inducing changes in their proliferative capacity and survival.
In the present study, we attempted to introduce EZH2 gene into three canine lymphoma cell lines; however, successful overexpression was achieved in only one cell line. Because the biological functions of EZH2 may differ depending on the cell line or individual case, further investigation will be required to clarify its context-dependent roles in canine lymphoma. In addition, the genetic profile of CLC cells has not yet been fully characterized, which should also be considered a limitation of the present study. Furthermore, because the analyses were performed using only a single cell line, the in vivo behavior and biological relevance of EZH2 overexpression remain unclear. The present findings therefore represent only one aspect of the role of EZH2 in lymphoma, and further studies with additional experimental data will be required to clarify its broader biological significance.
To our knowledge, this is the first study evaluating phenotypic changes following EZH2 gene introduction in canine lymphoma. Therefore, EZH2 may represent a potential novel molecular target for canine lymphoma treatment. As documented for human cell lines, we found that altered EZH2 expression in canine lymphoma cell lines also induces changes in the phenotype of cultured cells. The altered proliferation and survival capacity due to suppressed apoptosis is a critical factor related to tumor malignancy and prognosis. In conclusion, our findings then suggest that lymphoma cells may acquire resistance to cell death through the expression of EZH2. Although the precise mechanisms underlying EZH2-mediated suppression of apoptosis remain unclear, inhibition of EZH2 may represent a promising therapeutic strategy that targets epigenetic regulation to induce apoptosis in lymphoma cells.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
Ethical approval was not required for the study involving animals in accordance with the local legislation and institutional requirements because Ethical approval was not required because the study used an established canine lymphoma cell line and did not involve the use of live animals.
Author contributions
HK: Investigation, Writing – original draft, Data curation, Formal analysis. RI-S: Writing – review & editing, Investigation. AO: Investigation, Writing – review & editing. SK: Writing – review & editing, Investigation. VG-A: Writing – review & editing, Supervision. AW: Supervision, Writing – review & editing. YA: Writing – review & editing, Supervision, Methodology. IK: Supervision, Methodology, Writing – review & editing. TM: Resources, Supervision, Writing – review & editing. NG: Supervision, Funding acquisition, Writing – review & editing. MM: Resources, Writing – review & editing, Supervision. YM: Conceptualization, Investigation, Formal analysis, Methodology, Supervision, Funding acquisition, Project administration, Writing - original draft, Writing – review & editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This work was supported by Grant-in-Aid for Scientific Research for Young Scientists from Japan Society for the Promotion of Science (JSPS; 22K15017), Extramural Collaborative Research Grant of Cancer Research Institute, Kanazawa University, and by the Initiative for Realizing Discovery in the Research Environment from MEXT, Japan. This work was supported by MEXT Promotion of Development of a Joint Usage/Reseach System Project: Coalition of Universities for Research Excellence Program (CURE) Grant Number JPMXP1323015484.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that Generative AI was used in the creation of this manuscript. We used OpenAI ChatGPT-5.3 for English proofreading and methodological suggestions. All outputs were reviewed and edited by the authors. No AI-generated data were used.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1.
MarconatoLGelainMEComazziS. The dog as a possible animal model for human non-Hodgkin lymphoma: a review. Hematol Oncol. (2013) 31:1–9. doi: 10.1002/hon.2017,
2.
DawsonMAKouzaridesT. Cancer epigenetics: from mechanism to therapy. Cell. (2012) 150:12–27. doi: 10.1016/j.cell.2012.06.013,
3.
KimKHRobertsCW. Targeting EZH2 in cancer. Nat Med. (2016) 22:128–34. doi: 10.1038/nm.4036,
4.
BodorCGrossmannVPopovNOkosunJO'RiainCTanKet al. EZH2 mutations are frequent and represent an early event in follicular lymphoma. Blood. (2013) 122:3165–8. doi: 10.1182/blood-2013-04-496893,
5.
ChoiHJLeeHBParkHKChoSMHanHJLeeSJet al. EZH2 expression in naturally occurring canine tumors. Comp Med. (2018) 68:148–55.
6.
IsshikiYChenXTeaterMKaragiannidisINamHCaiWet al. EZH2 inhibition enhances T cell immunotherapies by inducing lymphoma immunogenicity and improving T cell function. Cancer Cell. (2025) 43:49–68.e9. doi: 10.1016/j.ccell.2024.11.006,
7.
LundKAdamsPDCoplandM. EZH2 in normal and malignant hematopoiesis. Leukemia. (2014) 28:44–9. doi: 10.1038/leu.2013.288,
8.
UmekiSEmaYSuzukiRKuboMHayashiTOkamuraYet al. Establishment of five canine lymphoma cell lines and tumor formation in a xenotransplantation model. J Vet Med Sci. (2013) 75:467–74. doi: 10.1292/jvms.12-0448,
9.
MurohashiMHinoharaKKurodaMIsagawaTTsujiSKobayashiSet al. Gene set enrichment analysis provides insight into novel signalling pathways in breast cancer stem cells. Br J Cancer. (2010) 102:206–12. doi: 10.1038/sj.bjc.6605468,
10.
WuZLeeSTQiaoYLiZLeePLLeeYJet al. Polycomb protein EZH2 regulates cancer cell fate decision in response to DNA damage. Cell Death Differ. (2011) 18:1771–9. doi: 10.1038/cdd.2011.48,
11.
SmonskeyMLasorsaERosarioSKirkJSHernandez-IlizaliturriFJEllisL. EZH2 inhibition re-sensitizes multidrug resistant B-cell lymphomas to etoposide mediated apoptosis. Oncoscience. (2016) 3:21–30. doi: 10.18632/oncoscience.288,
12.
ChristofidesAKarantanosTBardhanKBoussiotisVA. Epigenetic regulation of cancer biology and anti-tumor immunity by EZH2. Oncotarget. (2016) 7:85624–40. doi: 10.18632/oncotarget.12928,
13.
YamaguchiHHungMC. Regulation and role of EZH2 in cancer. Cancer Res Treat. (2014) 46:209–22. doi: 10.4143/crt.2014.46.3.209,
14.
XavierPLPMullerSFukumasuH. Epigenetic mechanisms in canine cancer. Front Oncol. (2020) 10:591843. doi: 10.3389/fonc.2020.591843,
15.
ZhaoXLwinTZhangXHuangAWangJMarquezVEet al. Disruption of the MYC-miRNA-EZH2 loop to suppress aggressive B-cell lymphoma survival and clonogenicity. Leukemia. (2013) 27:2341–50. doi: 10.1038/leu.2013.94,
16.
SircarASinghSXu-MonetteZYCoyleKMHiltonLKChavdoulaEet al. Exploiting the fibroblast growth factor receptor-1 vulnerability to therapeutically restrict the MYC-EZH2-CDKN1C axis-driven proliferation in mantle cell lymphoma. Leukemia. (2023) 37:2094–106. doi: 10.1038/s41375-023-02006-8,
17.
MaylinaLKambayashiSBabaKOkudaM. Simultaneous analysis of the p16 gene and protein in canine lymphoma cells and their correlation with pRb phosphorylation. Vet Sci. (2022) 9:393. doi: 10.3390/vetsci9080393,
18.
BrackenAPPasiniDCapraMProsperiniEColliEHelinK. EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer. EMBO J. (2003) 22:5323–35. doi: 10.1093/emboj/cdg542,
19.
MorinRDArthurSEAssoulineS. Treating lymphoma is now a bit EZ-er. Blood Adv. (2021) 5:2256–63. doi: 10.1182/bloodadvances.2020002773,
20.
BarsottiAMRyskinMZhongWZhangWGGiannakouALorethCet al. Epigenetic reprogramming by tumor-derived EZH2 gain-of-function mutations promotes aggressive 3D cell morphologies and enhances melanoma tumor growth. Oncotarget. (2015) 6:2928–2938. doi: 10.18632/oncotarget.2758,
21.
MorschhauserFTillyHChaidosAMcKayPPhillipsTAssoulineSet al. Tazemetostat for patients with relapsed or refractory follicular lymphoma: an open-label, single-arm, multicentre, phase 2 trial. Lancet Oncol. (2020) 21:1433–42. doi: 10.1016/S1470-2045(20)30441-1,
22.
KammingaLMBystrykhLVde BoerAHouwerSDoumaJWeersingEet al. The polycomb group gene Ezh2 prevents hematopoietic stem cell exhaustion. Blood. (2006) 107:2170–9. doi: 10.1182/blood-2005-09-3585,
23.
BeguelinWPopovicRTeaterMJiangYBuntingKLRosenMet al. EZH2 is required for germinal center formation and somatic EZH2 mutations promote lymphoid transformation. Cancer Cell. (2013) 23:677–92. doi: 10.1016/j.ccr.2013.04.011,
Summary
Keywords
apoptosis, dog, enhancer of zeste 2 polycomb repressive complex 2 subunit, epigenetics, lymphoma
Citation
Kawamura H, Ishikawa-Shinohara R, Okamura A, Kohno S, Gonzalez-Astudillo V, Wakabayashi A, Aikawa Y, Kitabayashi I, Mizuno T, Gotoh N, Michishita M and Machida Y (2026) Enhancer of zeste 2 polycomb repressive complex 2 subunit overexpression suppresses apoptosis in canine T-cell lymphoma: an in vitro functional analysis. Front. Vet. Sci. 13:1823343. doi: 10.3389/fvets.2026.1823343
Received
05 March 2026
Revised
18 May 2026
Accepted
21 May 2026
Published
12 June 2026
Volume
13 - 2026
Edited by
Beatriz Hernández-Suárez, INSERM U1220 Institut de Recherche en Santé Digestive, France
Reviewed by
Abdulazeez Giwa, Lagos State University, Nigeria
Ewan Hunter, Oxford BioDynamics PLC, 833709, United Kingdom
Updates
Copyright
© 2026 Kawamura, Ishikawa-Shinohara, Okamura, Kohno, Gonzalez-Astudillo, Wakabayashi, Aikawa, Kitabayashi, Mizuno, Gotoh, Michishita and Machida.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yukino Machida, ymachida@go.tuat.ac.jp
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.