Abstract
Introduction:
Giardia and Leishmania are important zoonotic parasites, yet their transmission dynamics in wildlife hosts on the Qinghai-Tibet Plateau remain unclear. As a keystone species on the Plateau, Ochotona curzoniaes overlap spatially with livestock and human activity areas and may serve as potential reservoir hosts for these pathogens. However, relevant molecular epidemiological data are currently lacking.
Methods:
To address this knowledge gap, the present study investigated the prevalence and molecular characteristics of Giardia and Leishmania in 114 O. curzoniaes collected from five townships in Zoige County, China, between March and December 2023. Intestinal contents and spleen samples were analyzed using nested PCR targeting Giardia bg, gdh, tpi genes and Leishmania ITS-1 gene. Positive products were sequenced, followed by BLAST comparison and phylogenetic analysis for species identification and genotyping.
Results:
Results showed 50 samples were Giardia-positive (43.9%), including 44 bg-positive and 14 gdh-positive samples, with eight samples positive for both genes. Five samples (4.39%) were positive for Leishmania. Significant differences in Giardia prevalence among the five locations were observed, whereas Leishmania prevalence did not differ significantly. Phylogenetic analysis identified G. intestinalis assemblage E (n = 38), G. microti (n = 6) based on bg, and a potentially novel genotype, tentatively designated Giardia sp. clone Z5 (n = 14) based on gdh. All Leishmania isolates were identified as L. major (n = 5).
Discussion:
This study provides the first evidence of G. intestinalis assemblage E, G. microti, Giardia sp. clone Z5, and L. major in O. curzoniae, highlighting their role as potential wildlife reservoirs and supporting ongoing surveillance and genotyping of zoonotic protozoa in the Qinghai-Tibet Plateau.
1 Introduction
Giardia is a zoonotic intestinal protozoan with a global distribution. It undergoes a two-stage life cycle, alternating between the cyst and trophozoite stages, and infects a broad range of hosts including humans, domestic animals, and wildlife (1). Infection can lead to giardiasis, a clinical condition characterized by diarrhea, abdominal pain and bloating. Globally, symptomatic giardiasis is estimated to cause approximately 280 million human cases annually (2). The prevalence of this disease exhibits significant geographical variation, affecting an estimated 2–5% of populations in developed countries, compared to 20–30% in developing nations (3, 4). The prevalence of Giardia varies substantially among animal hosts worldwide and is commonly strongly associated with age and husbandry density (5). In livestock, overall prevalence in bovines ranges from 1.09 to 74.2%, with calves and dairy cattle significantly higher than beef cattle (6, 7); in sheep, prevalence ranges from 1.5 to 89.2%, and lambs may have up to a sevenfold higher risk than adults (5); in goats, 4.0–43.5% (5, 8); and in pigs, 3.5–31.1% (5, 8). In companion animals, dogs and cats show prevalences of 1.1–45.9%, with particularly high rates in juveniles and high-density settings (e.g., kennels and shelters). In wildlife, Giardia has also been detected in pinnipeds, lagomorphs, reptiles, wild canids and felids (0.6–41.0%) (5, 8, 9). The epidemiology of Giardia is complicated by its substantial genetic diversity. The seven recognized species of Giardia include G. intestinalis (syn. G. lamblia, G. duodenalis), which infects humans and other mammals and is classified into eight distinct assemblages (A–H) that differ in their host specificity (10–12). Among these, assemblages A and B are considered zoonotic, with a broad host range encompassing humans, non-human primates, dogs, cats, and wildlife (8). In contrast, assemblages C–H exhibit greater host restriction: C and D primarily infect canids, while E, F, G, and H predominantly infect artiodactyls, cats, rodents, and marine mammals, respectively (8, 13–15). Although research on Giardia infections in animals has increased, most efforts have primarily focused on domestic species and urban wildlife. Consequently, data on Giardia in wildlife remain scarce, particularly in ecologically unique regions such as the Qinghai-Tibet Plateau. Therefore, prevention and control in livestock and companion animals can be implemented effectively based on host species, age, husbandry/management practices, and common Giardia assemblages. However, data remain scarce on the population genetic structure, cross-species transmission potential, and local epidemiology of Giardia in wildlife (especially in high-altitude regions).
Leishmaniasis, caused by Leishmania spp., is a neglected zoonosis transmitted by sandflies, presenting as visceral, cutaneous, or mucocutaneous forms, with visceral leishmaniasis being highly fatal if untreated (16–18). In nature, Leishmania maintains its life cycle through mammalian reservoir hosts and vectors. Dogs have long been considered as the main reservoir host, but recent studies in wild rabbits and hares in Spain, Brazil, and Israel revealed a “rabbit–sandfly” transmission cycle (19–21). Despite these advances, data on Leishmania infection in leporids within China remain strikingly scarce.
The Plateau pika (Ochotona curzoniae) is a small lagomorph abundant on the Qinghai-Tibet Plateau, often hosting multiple zoonotic pathogens including Bartonella (21.7%) (22), Echinococcus multilocularis (6.02%) (23), Toxoplasma gondii (3.96%) (24), and Cryptosporidium (7.0%) (25). In Zoige County, O. curzoniae live in close proximity to livestock and human settlements, creating frequent opportunities for cross-species transmission. While Cryptosporidium has been reported in local pikas (25), the occurrence of Giardia and Leishmania in this keystone species remains entirely unexplored. This study presents the first molecular investigation of Giardia and Leishmania in O. curzoniae, aiming to determine their prevalence and genetic identity, with implications for safeguarding public health and livestock productivity on the Plateau.
2 Materials and methods
2.1 Sample collection
Between March and December 2023, 114 O. curzoniae were captured using live traps from five townships in Zoige County (Dazha Temple 24, Axi 20, Hongxing 20, Maixi 20, Tangke 30). To minimize suffering, O. curzoniae were first anesthetized with isoflurane and subsequently euthanized by cervical dislocation. Intestinal contents (Giardia detection) and spleens (Leishmania detection) samples were collected using sterile gloves, stored in liquid nitrogen, transported to the laboratory, and stored at −80 °C. The body of each O. curzoniae was deeply buried to avoid being eaten by dogs, cats, or other wild carnivores.
2.2 DNA extraction
Approximately 150 mg of intestinal and spleen tissue was homogenized in ddH2O and centrifuged at 5,000 × g for 5 min. DNA was extracted from the intestinal contents and spleen tissues of O. curzoniae using the TIANamp Stool DNA Kit (Cat. No. DP328) and TIANamp Genomic DNA Kit (Cat. No. DP304) (TIANGEN Biotech Co., Ltd., Beijing, China)1 (accessed on 20 December 2023), respectively, according to the manufacturer’s instructions. DNA concentration and purity were measured with a NanoDrop 2000 (Thermo Fisher, United States), selecting samples >30 ng/μL (A260) for subsequent experiments. Extracted DNA was stored at −20 °C.
2.3 PCR amplification
Nested PCR was performed targeting Giardia bg (26), gdh (27), tpi (26), and Leishmania ITS-1 (28) genes. Primer details are listed in Table 1. PCR reactions (25 μL) included 22 μL T3 Super PCR Mix (Qingke Bio), 1 μL of each primer (10 μmol. L−1), and 1 μL DNA template. Positive (G. intestinalis and Leishmania DNA) and negative (ddH2O) controls were included. PCR cycling: 98 °C 2 min; 35 cycles of 98 °C 10 s, 57 °C 10 s, 72 °C extension (size-dependent); final extension 72 °C 8 min; hold 16 °C. Products were visualized by 1.3% agarose gel electrophoresis.
Table 1
| Species | Target gene | Primer name | Primer sequence (5′–3′) | Product (bp) | Annealing temperature(°C) | References |
|---|---|---|---|---|---|---|
| Giardia sp. | bg | BgF1 | AAGCCCGACGACCTCACCCGCAGTGC | 753 | 55 | 26 |
| BgR1 | GAGGCCGCCCTGGATCTTCGAGACGAC | |||||
| BgF2 | GAACGAACGAGATCGAGGTCCG | 511 | 55 | |||
| BgR2 | CTCGACGAGCTTCGTGTT | |||||
| gdh | GdhF1 | TTCCGTRTYCAGTACAACTC | 754 | 50 | 27 | |
| GdhR1 | ACCTCGTTCTGRGTGGCGCA | |||||
| GdhF2 | ATGACYGAGCTYCAGAGGCACGT | 530 | 60 | |||
| GdhR2 | GTGGCGCARGGCATGATGCA | |||||
| Leishmania sp. | ITS | ITSF1 | CTGGATCATTTTCCGATG | 763 | 55 | 28 |
| ITSR1 | TGATACCACTTATCGCACTT | |||||
| ITSF2 | CATTTTCCGATGATTACACC | 587 | 55 | |||
| ITSR2 | TACTGCGTTCTTCAACGA |
Primer sequences used for Giardia and Leishmania identification.
2.4 Sequence analysis and phylogenetic tree
The final positive PCR products of Giardia and Leishmania were subjected to Sanger bidirectional sequencing by Chengdu Branch of Sangon Biotech Company (Shanghai, China) using the second pair of primers. Firstly, all the obtained sequences were analyzed and manually edited by employing DNA Star and were subjected to nucleotide BLAST search through the NCBI database. Subsequently, the sequences of Giardia and Leishmania with the highest similarity to the blast results were selected (1–4 sequences), and the bg and gdh gene sequences of Giardia, including G. lamblia assemblage A-H, G. agilis, G. ardeae, G. psittaci, G. muris, G. microti, G. varani, and the ITS gene sequences of Leishmania, including L. infantum, L. donovani, L. tropica, L. major, L. mexicana, L. braziliensis, were selected as reference sequences to construct the phylogenetic trees of Giardia and Leishmania, respectively. Lastly, the phylogenetic tree was constructed based on the Neighbor-Joining (NJ) method using MEGA 11.0, and 1,000 replicates (bootstrap value) were selected to assess the robustness of the findings.
2.5 Statistical analysis
Firstly, Pearson Chi-square test with the software SPSS 27.0 was used to assess whether a significant difference in prevalence of Giardia and Leishmania infections among O. curzoniae across sampling locations. A p < 0.05 was considered significant. Secondly, the specimen numbers analyzed in the present study are relatively low (when the count in any expected cell was <5), therefore the statistical outcomes obtained where reanalyzed with Fisher’s exact test and confirmed (29).
3 Results
3.1 Phylogenetic analysis based on bg and gdh gene of Giardia
Positive bg and gdh gene products of Giardia were sequenced, and five distinct sequences were obtained (GenBank accession numbers: PP472407–PP472410, PP502972). Phylogenetic analysis revealed two well-defined clades based on bg gene sequences (Figure 1). Giardia sp. clones Z1–Z3 (PP472407–PP472409) clustered with Giardia sp. isolate HS23098 (PV711370), G. microti isolate HS23129 (PV711371), and Giardia sp. clone XZ (OR770651) from China, showing the closest relationship with sequence identities of 99–100%. Giardia sp. clone Z4 (PP472410) clustered with G. intestinalis isolates from Jiangsu (MK890214), Inner Mongolia (OP189629), Gansu (KT698977), Shaanxi (MH230881), Qinghai (KY633469), and Hubei (PX115500), and further grouped with G. intestinalis assemblage E isolates from Ningxia (OQ978939), Inner Mongolia (OR455125), and Gansu (MZ494459), sharing 100% sequence identity.
Figure 1
Notably, Giardia sp. clone Z5 (PP502972), based on the gdh gene, formed an independent branch in the phylogenetic tree (Figure 2). It was closely related to G. intestinalis sequences (GU176082, GU176096) from seals in the United States but shared only 84.37% nucleotide identity. This genetic distance suggests that the isolate may represent a potentially novel genotype.
Figure 2
3.2 Phylogenetic analysis based on ITS gene of Leishmania
Two ITS-1 gene sequences of Leishmania were obtained from positive samples (GenBank PX570628 and PX570629). Both were identified as Leishmania major, designated as L. major isolate Z1 and L. major isolate Z2. Phylogenetic analysis showed that these isolates clustered with L. major from Turkey (MH347926), exhibiting the closest genetic relationship with 98.43% sequence identity (Figure 3).
Figure 3
3.3 Detection of Giardia and Leishmania in O. curzoniae
Among 114 samples of O. curzoniae, a total of 53 were positive for Giardia or Leishmania, yielding an overall positivity rate of 46.49%. Giardia was detected in 50 samples (43.86%), including 44 positive for the bg gene (38.6%), 14 for the gdh gene (12.28%), and 8 positive for both genes (7.02%). The tpi gene remained undetectable despite multiple attempts. Leishmania was detected in five samples (4.39%), with mixed infections of Giardia and Leishmania observed in two samples (1.75%).
The detection rate of Giardia varied significantly among sampling sites (Pearson and Fisher tests, p < 0.001). The highest prevalence was recorded in Maixi (100%, n = 10), followed by Hongxing (70.0%), Tangke (46.7%), Axi (10%), and none detected in Dazhasi. bg gene sequencing identified G. intestinalis assemblage E (n = 38) and G. microti (n = 6), while gdh sequences were all identified as Giardia sp. clone Z5 (n = 14).
The detection rate of Leishmania showed no significant difference among sites (p > 0.05), with the highest rate observed in Dazhasi (8.33%, n = 2), followed by Axi and Maixi (5.0%, n = 1 each), Tangke (3.33%), and none in Hongxing (Table 2).
Table 2
| Variable | Overall infection rate (%) (no. Positive/no. of samples) | Infection rate (%) (n) | Species | |||
|---|---|---|---|---|---|---|
| Giardia spp. | Leishmania spp. | Giardia spp. | Leishmania spp. | |||
| bg | gdh | |||||
| Sampling sites | ||||||
| Dazhasi | 8.33 (2/24) | 0 | 8.33 (2) | L. major (2) | ||
| Axi | 15.0 (3/20) | 10.0 (2) | 5.0 (1) | G. intestinalis (2) | L. major (1) | |
| Hongxing | 70.0 (14/20) | 70.0 (14) | 0 | G. intestinalis (13) | Giardia sp. clone Z5 (3) | |
| Maixi | 100.0 (20/20) | 100.0 (20) | 5.0 (1) | G. intestinalis (13), G. microti (3) | Giardia sp. clone Z5 (9) | L. major (1) |
| Tangke | 46.67 (14/30) | 46.67 (14) | 3.33 (1) | G. intestinalis (10), G. microti (3) | Giardia sp. clone Z5 (2) | L. major (1) |
| Month | ||||||
| 3–5 | 23.07 (6/26) | 23.07 (6) | 0 | G. intestinalis (5) | Giardia sp. clone Z5 (1) | |
| 6–9 | 61.11 (33/54) | 57.4 (31) | 7.4 (4) | G. intestinalis (25), G. microti (5) | Giardia sp. clone Z5 (9) | L. major (4) |
| 10–11 | 41.17 (14/34) | 38.23 (13) | 2.9 (1) | G. intestinalis (8), G. microti (1) | Giardia sp. clone Z5 (4) | L. major (1) |
| Total | 46.49 (53/114) | 43.86 (50) | 4.39 (5) | G. intestinalis (38), G. microti (6) | Giardia sp. clone Z5(14) | L. major (5) |
Prevalence and species of Giardia and Leishmania in O. curzoniae.
The overall detection rate from June to September (61.11%) was significantly higher than those observed from March to May (23.07%). Similarly, the detection rate of Giardia from June to September (57.4%) was significantly higher than those in March to May (23.07%) (p < 0.05), No statistically significant differences were found among the other groups (p > 0.05) (Table 2).
4 Discussion
This study reports the first detection of Giardia in O. curzoniae from Sichuan Province, with a notably high infection rate of 43.86% (50/114). This prevalence is significantly higher than those previously reported in other animal hosts within the province, including yaks (15.7%) (30), adult sheep (14.9%) (31), stray dogs (11.3%) (32), pet chipmunks (8.6%) (33), racehorses (8.3%) (34) and forest musk deer (2.24%) (35). Such a high infection rate may be closely associated with the unique ecological behavior of O. curzoniae. These animals are typical colonial burrowers, and their dense underground tunnel systems provide ideal conditions for fecal–oral transmission (8, 36). The relatively stable temperature and humidity inside burrows, combined with low ultraviolet radiation, significantly prolong the survival of Giardia cysts (37, 38). In contrast, although domestic livestock are also gregarious, the open nature of grazing environments exposes cysts to UV light and climatic fluctuations, thereby reducing transmission efficiency. Similarly, stray dogs, pet chipmunks, and racehorses are less likely to encounter heavily contaminated environments due to differences in mobility and human management. Furthermore, this study employed highly sensitive nested PCR, which can detect extremely low copy numbers of parasite DNA, including DNA from inactivated organisms or subclinical infections; this may be one reason for the relatively high detected prevalence. Because all samples were collected from the intestinal contents and spleens of wild O. curzoniaes in the field and preserved in liquid nitrogen, the conditions were not compatible with conventional microscopy, and therefore parallel microscopic examination was not performed. In subsequent surveys in surrounding areas, we will integrate molecular detection with microscopy to more accurately assess the epidemiological characteristics of Giardia.
Compared to global data on lagomorphs, the prevalence in this study falls between reports in Nigeria (72.3%) (39) and in Brazil (40.0%) (40), Algeria (29.5%) (41) and Spain (27.8%) (42). Within China, the prevalence in O. curzoniae is markedly higher than in Shaanxi (3.54%), Henan (8.4%), Xinjiang (1.9%), Shandong (11.2%), and Jilin and Liaoning (9.86%) (43–47). These findings indicate that the prevalence of Giardia in lagomorph hosts exhibits pronounced geographical variation, likely influenced by multiple factors including climate conditions, detection methodologies, host population density, and habitat characteristics.
At the molecular level, the positive rate of the bg gene (38.6%, 44/114) was significantly higher than that of the gdh gene (12.3%, 14/114), consistent with previous findings (30, 31, 39, 44, 45, 48) and reflecting differences in detection sensitivity among target genes. Feng et al. reported that most primer sets yield approximately 60% positivity for the bg gene but only 40–60% for gdh (8); likewise, a study on Ghanaian HIV patients showed that bg detection sensitivity (31.7%) was markedly higher than gdh (17.5%) (48), further supporting the superior diagnostic value of the bg gene. In addition, we repeatedly attempted to amplify the tpi gene in this study, but it remained undetected. Inconsistent multilocus genotyping results have been reported multiple times in Giardia studies. For example, Cacciò et al. and Lebbad et al. observed relatively high PCR failure rates for the tpi gene in human populations and isolates from multiple animal sources (27, 49). This is usually attributed to sequence variation in primer-binding regions of the tpi gene that reduces amplification efficiency (50), and is particularly common in atypical hosts (such as O. curzoniaes) or novel genetic lineages.
Genotyping based on the bg gene revealed the presence of both G. microti and G. intestinalis assemblage E in O. curzoniae, with the latter being dominant. Previous studies have detected assemblages A, B, and E in lagomorphs, with B being the most frequent (39–45, 47, 51); however, findings from Shandong Province align with our results, with assemblage E predominating (46). These observations suggest that geographical environment and host species may be key determinants shaping the distribution of Giardia assemblages. Notably, assemblage E typically infects artiodactyls and has been reported in yaks from Sichuan (30). Given that O. curzoniae and yaks share the same alpine grazing habitats in Zoige County, cross-species transmission may occur between these hosts. Moreover, assemblage E has been repeatedly identified in humans, particularly in children (52, 53), indicating its potential zoonotic risk. Therefore, it is essential to establish an integrated control strategy to disrupt the Giardia transmission chain among O. curzoniae, yaks, and humans.
Interestingly, eight samples exhibited inconsistent genotyping results between the bg and gdh loci, a phenomenon also reported in rabbits from Algeria and in human isolates from Iran and Egypt (8, 41, 54, 55). This inconsistency may result from mixed infections or allelic sequence heterozygosity (ASH). Giardia is a diplomonad parasite known to exhibit high ASH levels. Woschke et al. found ambiguous nucleotide positions in 20.9% of tpi sequences from assemblage B isolates (56), while Kooyman et al. further demonstrated that ASH levels in assemblages C and D are even higher than in B, and significantly greater than in A and E (57). Additionally, multi–host mixed infections have been widely reported (58, 59); Kareem et al. identified at least 25 mammalian species exhibiting Giardia coinfections (59). The sympatric distribution and frequent ecological interactions of O. curzoniae with yaks, Tibetan sheep, rodents, and canids in Zoige further increase the likelihood of mixed infections. Notably, some isolates in this study showed only 84.37% sequence identity to reference strains (GU176082, GU176096) in gdh-based analysis and were phylogenetically closest to assemblage B (Figure 2), suggesting a potentially novel genotype closely related to assemblage B, tentatively designated Giardia sp. clone Z5. This isolate shows relatively low homology to known Assemblage B, suggesting that it may represent an independent evolutionary lineage with substantial genetic divergence. This is similar to the previously observed inconsistency between locus polymorphism and genotyping in non-human primates (60) and human/macaque–derived isolates (27), further reflecting the evolutionary complexity and adaptive potential of this parasite. We speculate that this lineage may have arisen through long-term adaptive evolution within O. curzoniae hosts. Previous studies have shown that intestinal parasites, including Giardia, can adapt to specific gut microenvironments via genetic variation and host-imposed selective pressures (61). As a keystone species in alpine ecosystems, O. curzoniaes have unique physiological traits, gut microbiota composition, and geographic distribution patterns; these factors may jointly impose strong local selection pressures that drive genetic differentiation in Giardia populations parasitizing them, ultimately resulting in pronounced genetic distances. Future studies will expand the host range and incorporate analyses of additional genetic loci, or whole genome sequencing, to further clarify the taxonomic status of this isolate.
This study also represents the first detection of Leishmania spp. in O. curzoniae from Sichuan Province, with a prevalence of 4.39% (5/114), significantly lower than infection rates reported in local canine populations from Wenchuan (23.5%), Heishui (28.2%), and Jiuzhaigou (24.1%) (62). Molecular identification confirmed that the detected species was L. major, while the circulating strain in nearby dogs is L. infantum. Dogs are recognized as highly adapted reservoirs of L. infantum, capable of sustaining long-term infections due to their immunological tolerance (63, 64); in contrast, L. major is primarily maintained by rodent reservoirs (65). Studies have shown that some rodent hosts can carry L. major chronically without developing overt disease, thus acting as key reservoirs in transmission cycles (66). Given their ecological and behavioral similarities to these wild rodents, O. curzoniae–through their communal burrow systems–offer a favorable microenvironment for both sand fly breeding and parasite persistence, providing the ecological basis for their potential role as L. major reservoir hosts. However, their infection tolerance, parasite proliferation dynamics, and infection duration require further verification through controlled infection experiments.
The detection rate in this study is close to the reported prevalence in small wild rodents in Turkey (1.12%) and capybaras in Latin America (6.25%) (67, 68), but is markedly lower than that in great gerbils in central Iran (44.4%), rats (25%) and house mice (24%) in northern Greece (69, 70). These differences may be closely related to host ecological behavior, frequency of vector contact, and population density. O. curzoniaes inhabit burrow environments at higher elevations with colder climates, which may limit vector breeding and opportunities for contact, thereby reducing infection risk. In addition, species differ genetically and physiologically in their immune responses to Leishmania, which may lead to differences in susceptibility and pathogen load. For example, in the same area of Xinjiang, China, infection rates differed among livestock: sheep 30.36% (17/56), goats 21.57% (11/51), cattle 17.78% (8/45), and donkeys 21.62% (8/37) (71). Moreover, a systematic review reported that Leishmania has been detected in 189 wildlife species (72), indicating a broad host range. Although the prevalence in O. curzoniaes in this study was low, they may still act as one of the potential reservoir hosts in this ecosystem and, together with other wildlife and even livestock, contribute to the transmission of Leishmania.
The prevalence of Giardia (43.86%) was markedly higher than that of Leishmania (4.39%). This difference may be explained by the following factors: Giardia is transmitted directly via the fecal–oral route, and its environmentally resistant cysts can persist and spread rapidly within host populations through contaminated water sources or environments (73). Variations in environmental conditions and O. curzoniaes population density across different sampling sites may lead to differences in local transmission intensity. Moreover, Giardia cysts are capable of long-term survival and accumulation in cold and humid environments, potentially giving rise to localized transmission hotspots. These factors may together explain the significant differences in Giardia detection rates observed among sampling sites. In contrast, the life cycle of Leishmania depends strictly on specific sand fly vectors (74). Zoige County features a high–altitude cold climate, with an average elevation of 3,500 m and an annual mean temperature of 2–4 °C, along with distinctive vegetation (alpine swamp meadow) and soil types (peat/gley soil). These conditions are unsuitable for the breeding and activity of local sandfly vectors, resulting in a generally sparse distribution of sandflies. Consequently, the transmission cycle of Leishmania is severely restricted, which may account for both the low overall detection rate and the lack of significant differences in detection rates among sampling sites.
This study revealed that both the overall detection rate (61.11%) and the Giardia detection rate (57.4%) from June to September were significantly higher than those observed from March to May (23.07 and 23.07%, respectively), indicating a clear seasonal pattern. This seasonal variation may be related to the climatic conditions in Zoige County. The average temperature from June to September is 9 °C, whereas the average temperatures from March to May was below 3 °C. Such low temperatures may restrict both the activity of O. curzoniae and the transmission of Giardia.
In summary, this study highlights the dual ecological significance of O. curzoniae on the Qinghai-Tibet Plateau–as both ecological keystone species and potential reservoir hosts of zoonotic pathogens. Their unique social behavior and habitat ecology not only influence parasite transmission dynamics but may also position them as critical ecological bridges in the circulation of zoonotic diseases within the Plateau ecosystem.
5 Conclusion
Here, we report the first molecular evidence for the co-circulation of Giardia and Leishmania in O. curzoniae from the Zoige County of China. The prevalence was substantial for Giardia (43.9%) in contrast to a much lower prevalence for Leishmania (4.39%). Molecular characterization identified three distinct Giardia taxa: G. intestinalis assemblage E, G. microti and tentatively designated Giardia sp. clone Z5. A single Leishmania species (L. major) was detected. Collectively, our findings significantly expand the known repertoire of parasites harbored by O. curzoniae and highlight their potential role as a wildlife reservoir for zoonotic transmission in the region. Future investigations are warranted to determine the spatial distribution and zoonotic potential of these parasite genotypes in pika populations across the Qinghai-Tibet Plateau, which is essential for assessing the emerging risks to public health.
Statements
Data availability statement
The sequences generated in this study were submitted to the GenBank, The names of the repository/repositories and accession number(s) can be found at: https://www.ncbi.nlm.nih.gov/genbank/, PP472407–PP472410, PP502972, PX570628, and PX570629.
Ethics statement
The animal study was approved by the Animal Ethics Committee of Southwest Minzhu University Plateau. The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
LD: Conceptualization, Data curation, Funding acquisition, Resources, Writing – original draft, Writing – review & editing. N-CY: Data curation, Methodology, Validation, Writing – original draft. ZY: Data curation, Formal analysis, Funding acquisition, Investigation, Writing – review & editing. R-hJ: Data curation, Formal analysis, Investigation, Writing – review & editing. H-XC: Data curation, Formal analysis, Investigation, Writing – review & editing. T-CT: Data curation, Formal analysis, Supervision, Visualization, Writing – review & editing, Writing – original draft. L-LH: Funding acquisition, Methodology, Resources, Supervision, Writing – original draft, Writing – review & editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This study was supported by the Talent Introduction Research Initiation Fund of Sichuan Tourism University (0087), Sichuan Science and Technology Program (2026NSFSC1749) Key Laboratory of Sichuan Cuisine Artificial Intelligence (CR24ZX02), Food Nutrition and Health Key Laboratory of Sichuan Universities (FN25ZX16), Teacher Training Project of Yibin University (412-2021PY066), Sichuan Provincial Key R&D Program (2024YFTX0023): Investigation on the Epidemiology of Yak Parasites in Aba Prefecture and Research, Demonstration, and Extension of Precision Control Technologies.
Acknowledgments
We express our sincere gratitude to the staff of the Aba Academy of Agricultural Sciences and the Zoige County Bureau of Agriculture and Animal Husbandry for their tremendous assistance and hard work during the sample collection phase of this study. This work would not have been possible without their dedication.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that Generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Footnotes
References
1.
AppelbeeAJThompsonRCOlsonME. Giardia and Cryptosporidium in mammalian wildlife--current status and future needs. Trends Parasitol. (2005) 21:370–6. doi: 10.1016/j.pt.2005.06.004,
2.
EinarssonEMa'ayehSSvärdSG. An Up-date on Giardia and Giardiasis. Curr Opin Microbiol. (2016) 34:47–52. doi: 10.1016/j.mib.2016.07.019,
3.
CaiWRyanUXiaoLFengY. Zoonotic giardiasis: an update. Parasitol Res. (2021) 120:4199–218. doi: 10.1007/s00436-021-07325-2,
4.
LalleMHanevikK. Treatment-refractory giardiasis: challenges and solutions. Infection Drug Resistance. (2018) 11:1921–33. doi: 10.2147/IDR.S141468,
5.
RyanUZahediA. Molecular epidemiology of giardiasis from a veterinary perspective. Adv Parasitol. (2019) 106:209–54. doi: 10.1016/bs.apar.2019.07.002,
6.
FengYGongXZhuKLiNYuZGuoYet al. Prevalence and genotypic identification of Cryptosporidium spp., Giardia duodenalis and Enterocytozoon bieneusi in pre-weaned dairy calves in Guangdong, China. Parasit Vectors. (2019) 12:41. doi: 10.1186/s13071-019-3310-5,
7.
BartleyPMRoeheBKThomsonSShawHJPetoFInnesEAet al. Detection of potentially human infectious assemblages of Giardia duodenalis in fecal samples from beef and dairy cattle in Scotland. Parasitology. (2019) 146:1123–30. doi: 10.1017/S0031182018001117,
8.
FengYXiaoL. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. (2011) 24:110–40. doi: 10.1128/CMR.00033-10,
9.
Ramírez-OcampoSCotte-AlzateJDEscobedoÁARodríguez-MoralesAJ. Prevalence of zoonotic and non-zoonotic genotypes of Giardia intestinalis in cats: a systematic review and meta-analysis. Infez Med. (2017) 25:326–38. doi: 10.26226/morressier.56d6be7cd462b80296c9591a
10.
del CampoJSierackiMEMolestinaRKeelingPMassanaRRuiz-TrilloI. The others: our biased perspective of eukaryotic genomes. Trends Ecol Evol. (2014) 29:252–9. doi: 10.1016/j.tree.2014.03.006,
11.
WangHMarucciGMunkeAHassanMMLalleMOkamotoK. High-resolution comparative atomic structures of two Giardiavirus prototypes infecting G. Duodenalis parasite. PLoS Pathog. (2024) 20:e1012140. doi: 10.1371/journal.ppat.1012140,
12.
HeyworthMF. Giardia duodenalis genetic assemblages and hosts. Parasite. (2016) 23:13. doi: 10.1051/parasite/2016013,
13.
SunJQinZFuYQinHSunMDongHet al. Assessment of potential zoonotic transmission of Giardia duodenalis from dogs and cats. One Health. (2023) 17:100651. doi: 10.1016/j.onehlt.2023.100651,
14.
Lasek-NesselquistEWelchDMSoginML. The identification of a new Giardia duodenalis assemblage in marine vertebrates and a preliminary analysis of G. Duodenalis population biology in marine systems. Int J Parasitol. (2010) 40:1063–74. doi: 10.1016/j.ijpara.2010.02.015,
15.
DavoodiTFeiziJKarimiKMohammadiMRPouryousefAAziziEet al. Giardia duodenalis in rodents: a global systematic review and meta-analysis. Vet Med Sci. (2025) 11:e70546. doi: 10.1002/vms3.70546,
16.
YanaseRPruzinovaKOwinoBOReaEMoreira-LeiteFTaniguchiAet al. Discovery of essential kinetoplastid-insect adhesion proteins and their function in Leishmania-sand fly interactions. Nat Commun. (2024) 15:6960. doi: 10.1038/s41467-024-51291-z,
17.
NagiN. Bangladesh eliminates visceral leishmaniasis. Lancet Microbe. (2024) 5:e420. doi: 10.1016/S2666-5247(24)00028-4,
18.
LodiLVoarinoMStoccoSRicciSAzzariCGalliLet al. Immune response to viscerotropic Leishmania: a comprehensive review. Front Immunol. (2024) 15:1402539. doi: 10.3389/fimmu.2024.1402539,
19.
Martín-SánchezJDíaz-SáezVMorillas-MárquezFCorpas-LópezVIbáñez-De HaroPTorres-LlamasAet al. Wild rabbits are Leishmania infantum reservoirs in southeastern Spain. Zoonoses Public Health. (2024) 71:584–90. doi: 10.1111/zph.13139,
20.
SilvaLMSBarataCVda SilvaWSINetoMBOOliveiraMRGomesACet al. New insights into Leishmaniasis in rabbits raised in the northeast region of Brazil. Acta Parasitol. (2024) 69:1961–6. doi: 10.1007/s11686-024-00922-y,
21.
StudentskyLOrshanLAkadFBen AviIDiazDElbazSet al. Leishmania donovani transmission cycle associated with human infection, Phlebotomus alexandri sand flies, and hare blood meals, Israel1. Emerg Infect Dis. (2023) 29:945–55. doi: 10.3201/eid2905.221657,
22.
HaoLYuanDGuoLHouWMoXYinJet al. Molecular detection of Bartonella in ixodid ticks collected from yaks and Plateau pikas (Ochotona curzoniae) in Shiqu County, China. BMC Vet Res. (2020) 16:235. doi: 10.1186/s12917-020-02452-x,
23.
ZhengJXSunXHWeiXWangGYuanCQWengXDet al. Species composition of a small mammal community and prevalence of Echinococcus spp. in the alpine pastoral area of the eastern Tibetan Plateau. Pathogens. (2024) 13:558. doi: 10.3390/pathogens13070558,
24.
ZhangXXLouZZHuangSYZhouDHJiaWZSuCet al. Genetic characterization of toxoplasma gondii from Qinghai Vole, Plateau Pika and Tibetan ground-tit on the Qinghai-Tibet Plateau, China. Parasites Vectors. (2013) 6:291. doi: 10.1186/1756-3305-6-291,
25.
TangTCJikeRHZhuLQChenCXHaoLL. Molecular epidemiological survey of Cryptosporidium in Ochotona curzoniae and Bos grunniens of Zoige County, Sichuan Province. Animals. (2025) 15:2140. doi: 10.3390/ani15142140,
26.
ZhangXWangLLanXDanJRenZCaoSet al. Occurrence and multilocus genotyping of Giardia duodenalis in captive non-human primates from 12 zoos in China. PLoS One. (2020) 15:e0228673. doi: 10.1371/journal.pone.0228673,
27.
CacciòSMBeckRLalleMMarinculicAPozioE. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages a and B. Int J Parasitol. (2008) 38:1523–31. doi: 10.1016/j.ijpara.2008.04.008,
28.
De SilvaNLDe SilvaVNHDeerasingheATHRathnapalaULItohMTakagiHet al. Development of a highly sensitive nested PCR and its application for the diagnosis of cutaneous Leishmaniasis in Sri Lanka. Microorganisms. (2022) 10:990. doi: 10.3390/microorganisms10050990,
29.
Bitilinyu-BangohJVoskuijlWThitiriJMentingSVerhaarNMwalekwaLet al. Performance of three rapid diagnostic tests for the detection of Cryptosporidium spp. and Giardia duodenalis in children with severe acute malnutrition and diarrhoea. Infect Dis Poverty. (2019) 8:96. doi: 10.1186/s40249-019-0609-6,
30.
FanYHuGYangDHouXZhangMNiuYet al. Occurrence and genetic diversity of Cryptosporidium spp. and Giardia intestinalis from yaks (Bos grunniens) in Ganzi, Sichuan Province, China. Microorganisms. (2025) 13:1261. doi: 10.3390/microorganisms13061261
31.
ZhongZTuROuHYanGDanJXiaoQet al. Occurrence and genetic characterization of Giardia duodenalis and Cryptosporidium spp. from adult goats in Sichuan Province, China. PLoS One. (2018) 13:e0199325. doi: 10.1371/journal.pone.0199325,
32.
ZhangYZhongZDengLWangMLiWGongCet al. Detection and multilocus genotyping of Giardia duodenalis in dogs in Sichuan province, China. Parasite. (2017) 24:31. doi: 10.1051/parasite/2017032,
33.
DengLLuoRLiuHZhouZLiLChaiYet al. First identification and multilocus genotyping of Giardia duodenalis in pet chipmunks (Eutamias asiaticus) in Sichuan Province, southwestern China. Parasit Vectors. (2018) 11:199. doi: 10.1186/s13071-018-2790-z,
34.
DengLLiWZhongZLiuXChaiYLuoXet al. Prevalence and molecular characterization of Giardia intestinalis in racehorses from the Sichuan province of southwestern China. PLoS One. (2017) 12:e0189728. doi: 10.1371/journal.pone.0189728,
35.
SongYLiWLiuHZhongZLuoYWeiYet al. First report of Giardia duodenalis and Enterocytozoon bieneusi in forest musk deer (Moschus berezovskii) in China. Parasit Vectors. (2018) 11:204. doi: 10.1186/s13071-018-2681-3,
36.
ThompsonRCPalmerCSO'HandleyR. The public health and clinical significance of Giardia and Cryptosporidium in domestic animals. Vet J. (2008) 177:18–25. doi: 10.1016/j.tvjl.2007.09.022,
37.
AdamRD. Giardia duodenalis: biology and pathogenesis. Clin Microbiol Rev. (2021) 34:e0002419. doi: 10.1128/CMR.00024-19,
38.
LiDCraikSASmithDWBelosevicM. Comparison of levels of inactivation of two isolates of Giardia lamblia cysts by UV light. Appl Environ Microbiol. (2007) 73:2218–23. doi: 10.1128/AEM.02024-06,
39.
AkinkuotuOAGreenwoodSJMcClureJTTakeetMIOtesileEBOlufemiF. Multilocus genotyping of Giardia duodenalis infecting rabbits in Ogun state, Nigeria. Vet Parasitol Regional Stud Rep. (2018) 13:171–6. doi: 10.1016/j.vprsr.2018.06.005,
40.
BaptistaCBAraújoMJInácioSVde Araújo MendesBCCosta de AquinoMCFerrariEDet al. First report of Giardia duodenalis in pet rabbits in Brazil. Prev Vet Med. (2023) 218:105981. doi: 10.1016/j.prevetmed.2023.105981,
41.
HennebMFeknousNBelabbasRMukbelRMHammadHBLaatamnaA. First report on genotyping of Giardia duodenalis in farmed rabbits in Algeria. Acta Parasitol. (2025) 70:84. doi: 10.1007/s11686-025-01017-y,
42.
RegoLCastro-ScholtenSCanoCJiménez-MartínDKösterPCCaballero-GómezJet al. Iberian wild leporidae as hosts of zoonotic enteroparasites in Mediterranean ecosystems of southern Spain. Zoonoses Public Health. (2023) 70:223–37. doi: 10.1111/zph.13018,
43.
TangHYeYKangRYuJCaoY. Prevalence and multi-locus genotyping of Giardia duodenalis in rabbits from Shaanxi province in northwestern China. Parasite. (2021) 28:54. doi: 10.1051/parasite/2021052,
44.
QiMXiJLiJWangHNingCZhangL. Prevalence of zoonotic Giardia duodenalis assemblage B and first identification of assemblage E in rabbit fecal samples isolates from Central China. J Eukaryot Microbiol. (2015) 62:810–4. doi: 10.1111/jeu.12239,
45.
ZhangXQiMJingBYuFWuYChangYet al. Molecular characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in rabbits in Xinjiang, China. J Eukaryot Microbiol. (2018) 65:854–9. doi: 10.1111/jeu.12629,
46.
LiTSZouYPengJJWangLQZhangHSCongWet al. Prevalence and genotype distribution of Giardia duodenalis in rabbits in Shandong Province, eastern China. Biomed Res Int. (2020) 2020:4714735. doi: 10.1155/2020/4714735,
47.
JiangJMaJGZhangNZXuPHouGZhaoQet al. Prevalence and risk factors of Giardia duodenalis in domestic rabbbits (Oryctolagus cuniculus) in Jilin and Liaoning province, northeastern China. J Infect Public Health. (2018) 11:723–6. doi: 10.1016/j.jiph.2018.02.008,
48.
WeinreichFHahnAEberhardtKAKannSFeldtTSarfoFSet al. Comparative evaluation of real-time screening PCR assays for Giardia duodenalis and of assays discriminating the assemblages a and B. Microorganisms. (2022) 10:1310. doi: 10.3390/microorganisms10071310,
49.
LebbadMMattssonJGChristenssonBLjungströmBBackhansAAnderssonJOet al. From mouse to moose: multilocus genotyping of Giardia isolates from various animal species. Vet Parasitol. (2010) 168:231–9. doi: 10.1016/j.vetpar.2009.11.003,
50.
WielingaCMThompsonRC. Comparative evaluation of Giardia duodenalis sequence data. Parasitology. (2007) 134:1795–821. doi: 10.1017/S0031182007003071,
51.
AsghariAMohammadiMRNaseriLShamsiLBadriMPouryousefA. A global systematic review and Meta-analysis of Giardia duodenalis in rabbits: epidemiology, genetic diversity and possible zoonotic concerns. Vet Med Sci. (2025) 11:e70176. doi: 10.1002/vms3.70176,
52.
Abdel-MoeinKASaeedH. The zoonotic potential of Giardia intestinalis assemblage E in rural settings. Parasitol Res. (2016) 115:3197–202. doi: 10.1007/s00436-016-5081-7,
53.
FantinattiMBelloARFernandesODa-CruzAM. Identification of Giardia lamblia assemblage E in humans points to a new Anthropozoonotic cycle. J Infect Dis. (2016) 214:1256–9. doi: 10.1093/infdis/jiw361,
54.
Hashemi-HafshejaniSMeamarARMoradiMHemmatiNSolaymani-MohammadiSRazmjouE. Multilocus sequence typing of Giardia duodenalis genotypes circulating in humans in a major metropolitan area. Front Med. (2022) 9:976956. doi: 10.3389/fmed.2022.976956,
55.
FahmyHMEl-SerougiAOEl DeebHKHusseinHMAbou-SeriHMKlotzCet al. Giardia duodenalis assemblages in Egyptian children with diarrhea. Eur J Clin Microbiol Infectious Dis. (2015) 34:1573–81. doi: 10.1007/s10096-015-2389-7,
56.
WoschkeAFaberMStarkKHoltfreterMMockenhauptFRichterJet al. Suitability of current typing procedures to identify epidemiologically linked human Giardia duodenalis isolates. PLoS Negl Trop Dis. (2021) 15:e0009277. doi: 10.1371/journal.pntd.0009277,
57.
KooymanFNJWagenaarJAZomerA. Whole-genome sequencing of dog-specific assemblages C and D of Giardia duodenalis from single and pooled cysts indicates host-associated genes. Microbial Genomics. (2019) 5:e000302. doi: 10.1099/mgen.0.000302,
58.
MateusaMOzoliņaZTerentjevaMDeksneG. Giardia duodenalis styles, 1902 prevalence in cattle (Bos taurus Linnaeus, 1758) in Europe: a systematic review. Microorganisms. (2023) 11:309. doi: 10.3390/microorganisms11020309,
59.
Hatam-NahavandiKAhmadpourEBadriMEslahiAVAnvariDCarmenaDet al. Global prevalence of Giardia infection in nonhuman mammalian hosts: a systematic review and meta-analysis of five million animals. PLoS Negl Trop Dis. (2025) 19:e0013021. doi: 10.1371/journal.pntd.0013021,
60.
LeveckeBGeldhofPClaereboutEDornyPVercammenFCacciòSMet al. Molecular characterisation of Giardia duodenalis in captive non-human primates reveals mixed assemblage a and B infections and novel polymorphisms. Int J Parasitol. (2009) 39:1595–601. doi: 10.1016/j.ijpara.2009.05.013,
61.
LiTLiJTangZLiuXYaoSZhuJet al. Genomic evolution of enteric pathogens: mechanisms of pathogenicity and diagnostic innovations. Front Microbiol. (2025) 16:1647437. doi: 10.3389/fmicb.2025.1647437,
62.
ShangLMPengWPJinHTXuDZhongNNWangWLet al. The prevalence of canine Leishmania infantum infection in Sichuan Province, southwestern China detected by real time PCR. Parasites Vectors. (2011) 4:173. doi: 10.1186/1756-3305-4-173,
63.
Dantas-TorresF. Canine leishmaniasis in the Americas: etiology, distribution, and clinical and zoonotic importance. Parasites Vectors. (2024) 17:198. doi: 10.1186/s13071-024-06282-w,
64.
de SouzaTLSantiagoMARibeiroFNFigueiredoFBJuniorAAVMMenezesRCet al. Splenic macrophage functional profile and its role in the immunopathogenesis of canine visceral leishmaniasis. Front Immunol. (2025) 16:1617751. doi: 10.3389/fimmu,
65.
AllahmoradiMNajafiFKooshaMKazemiradELatifiANaddafSRet al. Molecular tracking of Leishmania major in an archived Rattus norvegicus spleen sample in Iran: a case report. Iran J Parasitol. (2024) 19:496–501. doi: 10.18502/ijpa.v19i4.17172,
66.
DirkxLHendrickxSMerlotMBultéDStarickMElstJet al. Long-term hematopoietic stem cells as a parasite niche during treatment failure in visceral leishmaniasis. Communications Biol. (2022) 5:626. doi: 10.1038/s42003-022-03591-7,
67.
KarakuşMÖktemMASözenMMaturFÇolakFNalçaciMet al. First molecular detection and identification of Leishmania species in small wild rodents from Turkey. Parasitology. (2020) 147:1088–93. doi: 10.1017/S0031182020000803,
68.
FerrerEGarcíaHBolivarACañizalesIGuerreroRHerreraL. First molecular detection of Trypanosoma cruzi, T. Rangeli and Leishmania spp. in capybaras. Vet Parasitol Regional Stud Rep. (2021) 23:100516. doi: 10.1016/j.vprsr.2020.100516,
69.
Marvi-MoghadamNMohebaliMRassiYZahraei-RamazaniAROshaghiMAJafariRet al. Leishmania spp infection in patients and great gerbils (Rhombomys opimus) in a high-risk focus of zoonotic cutaneous Leishmaniasis in Central Iran: a microscopic and molecular survey. J Arthropod Borne Dis. (2024) 18:253–63. doi: 10.18502/jad.v18i3.18576,
70.
TsakmakidisΙAngelopoulouKDovasCIDokianakisΕTamvakisΑSymeonidouIet al. Leishmania infection in rodents in Greece. Trop Med Int Health. (2017) 22:1523–32. doi: 10.1111/tmi.12982,
71.
GaoCHWangJYZhangSYangYTWangY. Survey of wild and domestic mammals for infection with Leishmania infantum following an outbreak of desert zoonotic visceral Leishmaniasis in Jiashi, People's Republic of China. PLoS One. (2015) 10:e0132493. doi: 10.1371/journal.pone.0132493,
72.
Azami-ConesaIGómez-MuñozMTMartínez-DíazRA. A systematic review (1990-2021) of wild animals infected with zoonotic Leishmania. Microorganisms. (2021) 9:1101. doi: 10.3390/microorganisms9051101,
73.
ZhaoQNingXYueZJianFLiDLangJet al. Unveiling the presence and genotypic diversity of Giardia duodenalis on large-scale sheep farms: insights from the Henan and Ningxia regions, China. Parasites Vectors. (2024) 17:312. doi: 10.1186/s13071-024-06390-7,
74.
CecilioPRogerioLATDSTangKWillenLIniguezEet al. Leishmania sand fly-transmission is disrupted by Delftia tsuruhatensis TC1 bacteria. Nat Commun. (2025) 16:3571. doi: 10.1038/s41467-025-58769-4,
Summary
Keywords
Leishmania, genotypes, Zoige County, Giardia lamblia, Plateau pika
Citation
Deng L, Yin N-C, Yi Z, Jike R, Chen H-X, Tang T-C and Hao L-L (2026) Dual detection and novel genotypes of Giardia and Leishmania in Ochotona curzoniae from Zoige County, Qinghai-Tibet Plateau. Front. Vet. Sci. 13:1855828. doi: 10.3389/fvets.2026.1855828
Received
14 April 2026
Revised
27 May 2026
Accepted
29 May 2026
Published
22 June 2026
Volume
13 - 2026
Edited by
Pablo Oyarzún-Ruiz, University of Concepcion, Chile
Reviewed by
Mengtong Lei, Qinghai University, China
Diana Maritza Echeverry Berrio, Universidad San Sebastián, Chile
Updates
Copyright
© 2026 Deng, Yin, Yi, Jike, Chen, Tang and Hao.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Tian-Cai Tang, tiancaitang@126.com; Li-Li Hao, 22100089@swun.edu.cn
† These authors have contributed equally to this work and share first authorship
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.