Abstract
MicroRNA (miRNA) detection by reverse transcription (RT) quantitative real-time PCR (RT-qPCR) is the most popular method currently used to measure miRNA expression. Although the majority of miRNA families are constituted of several 3′-end length variants (“isomiRs”), little attention has been paid to their differential detection by RT-qPCR. However, recent evidence indicates that 3′-end miRNA isoforms can exhibit 3′-length specific regulatory functions, underlining the need to develop strategies to differentiate 3′-isomiRs by RT-qPCR approaches. We demonstrate here that polyadenylation-based RT-qPCR strategies targeted to 20–21 nt isoforms amplify entire miRNA families, but that primers targeted to >22 nt isoforms were specific to >21 nt isoforms. Based on this observation, we developed a simple method to increase selectivity of polyadenylation-based RT-qPCR assays toward shorter isoforms, and demonstrate its capacity to help distinguish short RNAs from longer ones, using synthetic RNAs and biological samples with altered isomiR stoichiometry. Our approach can be adapted to many polyadenylation-based RT-qPCR technologies already exiting, providing a convenient way to distinguish long and short 3′-isomiRs.
Introduction
MicroRNAs (miRNAs) are short RNAs controlling the translation of target messenger RNAs (mRNAs). They are processed from hairpin-like transcripts to their mature form through a sequential cleavage operated by Drosha in the nucleus, and Dicer, in the cytoplasm (). Mature miRNA intracellular levels are under stringent control, as inefficient miRNA biogenesis and the resulting global decrease of miRNA levels are directly associated with the development of tumor cells (; Wu et al., 2013). Conversely, however, accumulation of select miRNAs can also promote cancer development through the coordinated action on tumor suppressors such as Pten, or pro-inflammatory pathways such as NF-κB (; ; ; ; ). Intracellular miRNA levels are therefore tightly controlled through the modulation of their expression and processing, with as many as 180 binding proteins interacting with select precursor miRNAs (pre-miRNAs) recently identified (Treiber et al., 2017).
While pre-miRNA-binding proteins can control the processing of Dicer and Drosha, they also have the capacity to influence how the pre-miRNAs are cleaved, directly impacting on the 5′-end and 3′-end length of the mature miRNA (). Such processing variations resulting in miRNA isoforms (referred to as templated isomiRs) are very frequently observed (; Tan et al., 2014; ; ; ; Telonis et al., 2017), and significantly broaden the landscape of miRNA molecules existing in a cell. This may help identify disease-specific isoforms, which could potentially be developed as novel biomarkers (Telonis et al., 2017). Critically, both 5′ and 3′-length variations have been linked to different biological functions, emphasizing their functional importance (Tan et al., 2014; Yu et al., 2017).
miRNAs can be detected through many different technologies, including small RNA-sequencing (RNA-Seq), microarrays, RT-qPCR approaches, nCounter® Nanostring, and northern blot, among others. Each miRNA detection technique has its strengths and weaknesses, but RT-qPCR has been found to be the most sensitive approach to quantify circulating miRNAs (), favoring its use in biomarkers studies. RT-qPCR remains the most popular technique used to date for its ease of use and low-cost. Importantly, however, the capacity of RT-qPCR approaches to distinguish between 3′-isomiRs remains poorly defined, with prior reports indicating that RT-qPCR approaches only poorly distinguish 3′-isomiRs with ±1 base variation (Wu et al., 2007; ; ).
The present work describes a simple approach amenable to widely used polyadenylation-based RT-qPCR protocols, conferring increased selectivity toward shorter isoforms. We demonstrate its usefulness on synthetic RNAs and biological samples with naturally altered isomiR stoichiometry.
Materials and Methods
Cell Culture
Human hTERT BJ fibroblasts (referred to as human fibroblasts herein – gift from V. Hornung, Ludwig-Maximilians-University), were grown in DMEM (Life Technologies) supplemented with 10% sterile fetal bovine serum (Life Technologies), 1 mM sodium pyruvate and 1× antibiotic/antimycotic (Life Technologies) (referred to as complete DMEM). 80,000 human fibroblasts were plated in a 24-well plate, and stimulated with human IFN-β for 24 h. Bone marrow derived macrophages (BMDMs) from C57BL/6 wild-type mice were generated as previously described (), and stimulated in 20% L-929 condition medium on day 7 of differentiation with lipopolysaccharide (LPS) from Escherichia coli Serotype O111:B4 (TLR4 agonist, Enzo Life Sciences) or recombinant mouse IFN-β () (gift from N. A. de Weerd and P. J. Hertzog, Hudson Institute). Recombinant human IFN-β (Rebif, Merck Serono) was used at a final activity of 1000 IU/ml.
Reverse Transcription Quantitative Real-Time PCR (RT-qPCR)
Total RNA from human fibroblasts or BMDMs was purified using the GenElute Total RNA Purification kit (Sigma). Synthetic miRNAs and RNAs were synthesized as single-stranded RNAs by Integrated DNA Technologies (IDT), and resuspended in duplex buffer (100 mM potassium acetate, 30 mM HEPES, pH 7.5, DNase–RNase free H2O)—these were directly polyadenylated and reverse transcribed, without being transfected into cells. For polyadenylation detection, the Mir-X miRNA First-Strand Synthesis kit (Clontech) was used on total RNA or synthetic miRNA/RNA according to the manufacturer’s instructions. Briefly, 1–8 μg of total RNA or 2.25 pmol of synthetic miRNA/RNA in a total volume of 3.75 μL was combined with 5 μL of mRQ Buffer and 1.25 μL of mRQ Enzyme. The mixture was incubated for 1 h at 37°C and the reaction was stopped after incubation at 85°C for 5 min. Fifteen microliter of RNase and DNase free water was added to the reverse-transcribed polyadenylated total cellular RNA, and 1 μL of the resulting mix was used per qPCR reaction with the Power SYBR Green mastermix (Applied Biosystems). The reverse-transcribed polyadenylated synthetic miRNA/RNA reaction was diluted 1/100 in RNase and DNase free water, prior to qPCR analysis. The mRQ 3′ Primer (Clontech) was used as reverse primer in all Mir-X cDNA qPCRs. The U6 RNA forward primer used for Mir-X cDNA qPCRs was provided in the Mir-X kit and was used as reference small RNAs using the 2-ΔΔCq method. For detection with the miRCURY LNA hsa-miR-222-3p (YP00204551 – targeted to the 21 nt isoform), 1.125 pmol of synthetic miRNA was polyadenylated and reverse transcribed with the miRCURY LNA RT Kit, following the manufacturer’s instructions (Qiagen). The reverse-transcribed polyadenylated synthetic miRNA reaction was diluted 1/100 in RNase and DNase free water, prior to qPCR analysis. One microliter of the resulting dilution was used per qPCR reaction with the Power SYBR Green mastermix (Applied Biosystems). Stem-loop hsa-miR222-3p TaqMan® assays (Applied Biosystems) were used according to the manufacturer’s instructions, where 3.2 fmol of synthetic miRNA was reverse transcribed with specific reverse transcription primers. The manufacturer’s references of the assays used are: miR-222-3p (#2276 and #525 – targeted to the 21 nt and the 24 nt isoforms, respectively). One microliter of the resulting cDNA was amplified with the SensiFAST Probe Hi-ROX Kit (Bioline). All RT-qPCRs were carried out on the HT7900 RT-PCR system (Applied Biosystems). Relative amplification of synthetic miRNAs/RNA was calculated using 2-ΔCq, relative to the indicated Cq. Each RT-qPCR was carried out in technical duplicate. Melting curves were used in each run to confirm specificity of amplification. The synthetic RNAs are listed in Table 1, while the primers used are listed in Table 2.
Table 1
| RNA name | Sequence (5′-3′) |
|---|---|
| miR-221-20 nt | rArGrCrUrArCrArUrUrGrUrCrUrGrCrUrGrGrGrU |
| miR-221-23 nt | rArGrCrUrArCrArUrUrGrUrCrUrGrCrUrGrGrGrUrUrUrC |
| miR-222-21 nt | rArGrCrUrArCrArUrCrUrGrGrCrUrArCrUrGrGrGrU |
| miR-222-22 nt | rArGrCrUrArCrArUrCrUrGrGrCrUrArCrUrGrGrGrUrC |
| miR-222-23 nt | rArGrCrUrArCrArUrCrUrGrGrCrUrArCrUrGrGrGrUrCrU |
| miR-222-24 nt | rArGrCrUrArCrArUrCrUrGrGrCrUrArCrUrGrGrGrUrCrUrC |
| miR-222-25 nt | rArGrCrUrArCrArUrCrUrGrGrCrUrArCrUrGrGrGrUrCrUrCrU |
| RNA#1 | rGrArArGrGrArGrGrGrUrGrArCrCrUrGrArUrArArArCrCrArA |
| RNA#2 | rArCrUrCrCrUrUrCrArUrUrCrUrCrCrCrUrUrUrCrArArArGrGrCrU |
| RNA#3 | rGrArGrGrUrUrUrArGrGrUrArUrCrGrArArGrUrUrGrGrGrUrCrArA |
| RNA#4 | rCrArGrArArCrArArArGrGrCrArUrCrGrUrUrGrGrArGrUrUrCrArG |
| RNA#5 | rArGrUrArUrCrUrCrArArCrArGrCrUrArArUrUrUrGrGrCrUrGrCrG |
| RNA#6 | rGrArArGrGrArGrGrGrUrGrArCrCrUrGrArUrArGrGrUrUrArC |
| RNA#7 | rArGrCrArGrCrUrArUrCrArGrGrUrCrArCrCrCrUrCrCrUrUrCrUrU |
| RNA#7-MIS | rArGrCrArGrCrUrArUrCrArGrGrUrArArArCrCrUrCrCrUrUrCrUrU |
Synthetic RNAs used in the study.
rX denotes RNA bases.
Table 2
| Forward primer name | Sequence (5′-3′) |
|---|---|
| F222-25 | AGCTACATCTGGCTACTGGGTCTCT |
| F222-24 | AGCTACATCTGGCTACTGGGTCTC |
| F222-23 | AGCTACATCTGGCTACTGGGTCT |
| F222-22 | AGCTACATCTGGCTACTGGGTC |
| F222-21 | AGCTACATCTGGCTACTGGGT |
| F221-23 | AGCTACATTGTCTGCTGGGTTTC |
| F221-20 | AGCTACATTGTCTGCTGGGT |
| F221-20-4A | AGCTACATTGTCTGCTGGGTAAAA |
| F222-21-2A | AGCTACATCTGGCTACTGGGTAA |
| F222-21-5A | AGCTACATCTGGCTACTGGGTAAAAA |
| F1-25 | GAAGGAGGGTGACCTGATAAACCAA |
| F1-21 | GAAGGAGGGTGACCTGATAAA |
| F1-21-4A | GAAGGAGGGTGACCTGATAAAAAAA |
| F222-25-4A | AGCTACATCTGGCTACTGGGTCTCTAAAA |
| F222-24-4A | AGCTACATCTGGCTACTGGGTCTCAAAA |
| F222-23-4A | AGCTACATCTGGCTACTGGGTCTAAAA |
| F222-22-4A | AGCTACATCTGGCTACTGGGTCAAAA |
| F222-21-4A | AGCTACATCTGGCTACTGGGTAAAA |
| F199a-20 | CCCAGTGTTCAGACTACCTG |
| F199a-20-4A | CCCAGTGTTCAGACTACCTGAAAA |
| F199a-23 | CCCAGTGTTCAGACTACCTGTTC |
| F2-27 | ACTCCTTCATTCTCCCTTTCAAAGGCT |
| F2-22 | ACTCCTTCATTCTCCCTTTCAA |
| F2-22-4A | ACTCCTTCATTCTCCCTTTCAAAAAA |
| F3-27 | GAGGTTTAGGTATCGAAGTTGGGTCAA |
| F3-22 | GAGGTTTAGGTATCGAAGTTGG |
| F3-22-4A | GAGGTTTAGGTATCGAAGTTGGAAAA |
| F4-27 | CAGAACAAAGGCATCGTTGGAGTTCAG |
| F4-22 | CAGAACAAAGGCATCGTTGGAG |
| F4-22-4A | CAGAACAAAGGCATCGTTGGAGAAAA |
| F5-27 | AGTATCTCAACAGCTAATTTGGCTGCG |
| F5-22 | AGTATCTCAACAGCTAATTTGG |
| F5-22-4A | AGTATCTCAACAGCTAATTTGGAAAA |
| F6-25 | GAAGGAGGGTGACCTGATAGGTTAC |
| F6-21 | GAAGGAGGGTGACCTGATAGG |
| F6-21-4A | GAAGGAGGGTGACCTGATAGGAAAA |
| F7-27 | AGCAGCTATCAGGTCACCCTCCTTCTT |
| F7-22 | AGCAGCTATCAGGTCACCCTCC |
| F7-22-4A | AGCAGCTATCAGGTCACCCTCCAAAA |
| F7MIS-27 | AGCAGCTATCAGGTAAACCTCCTTCTT |
| F7MIS-22 | AGCAGCTATCAGGTAAACCTCC |
| F7MIS-22-4A | AGCAGCTATCAGGTAAACCTCCAAAA |
| miR-221-3p MySEQ | CCTACACGACGCTCTTCCG ATCTAGCTACATTGTCTGCTGGG |
| snoRNA-202 MySEQ | CCTACACGACGCTCTTCCGATCTGC TGTACTGACTTGATGAA AGTAC |
DNA primers used in the study.
Small RNA-Seq Library Preparation and RNA Sequencing
Small RNA libraries from human fibroblasts treated or not with IFN-β for 24 h were made using the NEBNext Small RNA Library Prep Set for Illumina (New England Biolabs) according to the manufacturer’s instructions and library quality was analyzed using an Agilent Bioanalyzer 2100 (Agilent Technologies) (). The libraries were sequenced on a NextSeq 500 machine at the ACRF Cancer Genomics Facility to produce single end, 50 base pair reads. Adapter-trimmed FASTQ files have been deposited in the EBI European Nucleotide Archive (PRJEB22632). Targeted amplification of miR-221-3p and snoRNA 202 was carried out using total RNA from BMDM using modified PAT-seq (), with miR-221-3p MySEQ and snoRNA-202 MySEQ forward primers. miRNA isoforms were identified using an in house perl script (). For each microRNA, read alignments which overlapped the mature microRNA’s genomic locus were classified and counted according to the start and end positions of the alignments.
Statistical Analyses
Statistical analyses were carried out using Prism 7 (GraphPad Software Inc.). Two-tailed unpaired t-tests and non-parametric Mann–Whitney U-tests were used to compare pairs of conditions, when appropriate. Symbols used: ∗P ≤ 0.05, ∗∗P ≤ 0.01, ∗∗∗P ≤ 0.001, ∗∗∗∗P ≤ 0.0001. ns, not significant.
Results
Conventional Polyadenylation RT-qPCR Exhibits Specificity toward Long IsomiRs
It has previously been suggested that qPCR approaches relying on stem-loop or polyadenylation reverse transcription do not have the capacity to distinguish miRNA isoforms differing in their 3′-end (Wu et al., 2007; ; ). However, we hypothesized that primers targeted to longer miRNA isoforms should have limited capacity to amplify shorter isomiRs, due to a lack of binding of the primer 3′-end, which is essential in 5′-3′ polymerase amplification (). Given that templated miRNA isoforms can vary greatly in length, we decided to test the capacity of polyadenylated reverse transcribed synthetic miR-222-3p variants ranging from 21 to 25 nt (Yu et al., 2017), to be detected by a range of forward primers directly matching the isoform targeted (Figure 1A). Not too surprisingly, forward primers targeted to the shorter isoforms could all amplify the longer ones, which were anticipated since the longer isomiRs have perfect binding sites for these primers. Nonetheless, forward primers targeted to longer isomiRs showed clear selectivity toward these isoforms, when compared to shorter ones (Figure 1A). As such, forward primers could not amplify isomiRs lacking 2 or more nucleotides at the 3′-end (Figure 1A). A similar observation was made with synthetic miR-221-3p 20 and 23 nt isomiRs (Figure 1B), confirming that the lack of perfect annealing of the forward primer 3′-end to shorter isoforms strongly impacted their amplification, and that selectivity could be achieved toward the amplification of longer 3′-isomiRs over shorter ones.
FIGURE 1
Forward Primer 3′-Extension Increases Selectivity toward Short IsomiRs
The previous observation led us to speculate that alteration of the forward primer 3′-end, may be used to confer increased selectivity toward shorter isomiRs (Figure 2A). We decided to make use of the poly-A sequence which is added during the 3′-end polyadenylation, and tested the impact of 2 and 5 “A” added to the 3′-end of the primer targeted to miR-222-3p 21 nt, on the amplification of the miR-222-3p 24 nt isoform—reasoning that the 3′-structural distortion created when binding to longer isoforms would dampen their amplification (Figure 2A). This approach confirmed that modification of the 3′-end could be used to limit amplification of the longer isoforms by >80%, with comparable results independent of the amount of A residues added (Figure 2B), possibly pertaining to the importance of the last few 3′-end residues in 5′-3′ polymerase activity (). We opted for an addition of 4 “A” in further experiments (referred to as 4A-modification hereafter), under the assumption that it would allow better discrimination of longer RNAs with A-rich 3′-end. In line with this, amplification of a polyadenylated reverse transcribed 25 nt RNA#1 containing an “AAACCAA” 3′-end was decreased by more than 60% with the 4A-modification (Figure 2C). To confirm the performance of the 4A-modification, we next assessed its selectivity on our panel of 21–25 nt miR-222-3p variants (Figure 2D). Modified forward primers showed a decreased capacity to amplify isomiRs with >2 nt additional bases at the 3′-end (Figure 2D), supporting that increased specificity toward shorter isomiRs could be achieved with the 4A-modification of polyadenylation RT-qPCR (compare Figures 1A, 2D). In addition, we compared the amplification of our panel of 21–25 nt miR-222-3p variants by our 4A-modified miR-222-3p 21 nt primer approach, to that by miRCURY LNA and stem-loop miRNA TaqMan® assays, targeted to the 21 nt miR-222-3p isoform (Figure 2E). This analysis revealed that the 4A-modified approach was the most specific toward the 21 nt isoform (Figure 2E).
FIGURE 2
4A-Modification Decreases Off-Target Amplification of Long-IsomiRs
To broaden our observations, we next assessed the capacity of 4A-polyadenylation RT-qPCR to decrease amplification of longer RNAs, relying on miR-221-3p 23 nt and a set of unrelated 5 additional 25 or 27 nt long RNA sequences (Figures 3A–F and Table 2). In all cases, amplification of longer sequences by the short forward primer was at least nearly as efficient as with that of the long primer. However, 4A-modified short forward primers had a significantly decreased capacity to amplify the longer sequences, averaging a 90% decrease across these 6 RNAs (Figure 3G).
FIGURE 3
4A-Modification and Sequence-Specific Amplification
Directly owing to the miRNA sequence they match, the design of forward miRNA primers used in polyadenylation-based RT-qPCRs limits their specificity of amplification. While using backbone modifications such as LNA can help circumvent this, we wanted to assess here how designing shorter forward primers would impact on their specificity toward closely related sequences. For this purpose we compared the amplification of two 27 nt RNA sequences with central 2 nt mismatches (“CAC” > “AAA”), by 22 nt primers with and without the 4A-modification (Figure 4). While the longer forward primers amplified both related sequences with little discrimination, shortening the primer to 22 nt enhanced the specificity to the target RNA, probably due to a lower Tm and a greater impact of mismatches on duplex formation. The impact of shortening was most pronounced for the amplification of the “AAA” mutant, in line with this concept (Figure 4, see RNA#7-MIS amplification with F7-22). Critically, the 4A-modification potentiated even further the selectivity of the 22 nt primers (as seen with F7MIS-22-A amplification of RNA#7, compared to F7MIS-22), indicating that it did not compromise specificity of amplification.
FIGURE 4
Validation of 4A-Modification in Biological Samples
Relying on small RNA-Seq analyses, we have recently discovered that stimulation of human fibroblasts by interferon (IFN)-β promoted a change in the stoichiometry of miR-221-3p, miR-222-3p and miR-199a-5p isomiRs, leading to decreased levels of isoforms greater than 23/24 nt, while 20-22 nt isoforms where rather induced, with an overall decrease of miR-221-3p miR-222-3p and miR-199a-5p total abundance () (Figure 5). Critically in these samples, the abundance of the 20–22 isoforms was about one order of magnitude lower than that of >22 nt isoforms () (Figures 5A,C,E). As such, off-target amplification of the more abundant >22 nt isoforms of these miRNAs by polyadenylation RT-qPCR would be expected to mask changes specific to the 20–22 nt isoforms upon IFN-β stimulation in human fibroblasts. Relying on total RNA from IFN-β stimulated fibroblast, we first compared the amplification of 4A-modifed primers targeting miR-222-3p 21 to 24 nt, to that of unmodified primers. In line with synthetic RNA amplification, the unmodified F222-24 primer revealed a strong decrease of the isoforms amplified upon IFN-β stimulation, matching the strong decrease observed for miR-222-3p isoforms >23 nt (Figures 5A,B). Conversely, the unmodified F222-21 primer failed to reflect the increase of miR-222-3p 21/22 nt observed, and rather reflected the global decrease seen across the more abundant isoforms (Figures 5A,B). The 4A-modifed 21-23 nt primers increased specificity toward the shorter isoforms of miR-222-3p which were not significantly decreased by IFN-β, while the 4A-modifed 24 nt primer displayed a significant decrease of it targets. We note that F222-23-4A amplification was rather reduced by IFN-β, in line with the fact that this primer also amplifies the very abundant 24-25 miR-222-3p isoforms (Figure 2D), which are greatly reduced upon stimulation (Figures 5A,B). Importantly in these samples, amplification with F222-24 was more efficient at detecting the IFN-β-driven decrease than its 4A-modified counterpart, probably owing to the enhanced off-target amplification of isoforms shorter than 24 nt by F222-24-4A (as suggested in Figure 2). 4A-modifed 20 nt primers increased specificity toward the shorter isoforms of miR-221-3p and miR-199a-5p which were not significantly decreased by IFN-β (Figures 5D,F), therefore aligning with our RNA-Seq studies (Figures 5C,E). Critically, we have also demonstrated that the effect of IFN-β was not limited to human fibroblasts and could be recapitulated in mouse bone marrow derived macrophages (BMDMs) treated with LPS or IFN-β () (LPS driving production of IFN-β in this system). As such, miR-221-3p targeted RNA-Seq of BMDMs treated with LPS mirrored the observations from the human fibroblasts (miR-221-3p 21 nt was increased while miR-221-3p 23 nt was decreased) (Figure 5G). The 4A-modified 20 nt miR-221-3p primer demonstrated a significant increase of expression upon IFN-β treatment, otherwise not detected with the unmodified F221-20 primer (which rather reflected the overall global miR-221-3p concentration, mostly unchanged by the treatment) (Figures 5G,H). These results collectively suggest that the 4A-modification can be used to distinguish changes in long and short isoforms levels due to stimulation, by polyadenylation RT-qPCR.
FIGURE 5
Discussion
Over the past decade, many approaches have been developed to detect miRNAs by RT-qPCR (
In this work, we investigated the capacity of polyadenylation RT-qPCR relying on DNA primers to distinguish between 3′-end isoforms of a same miRNA family. Our analysis of synthetic miR-222-3p isoforms varying between 21 and 25 nt demonstrated that forward primers targeted toward shorter isoforms could also amplify longer ones, underlining that short forward primers have the advantage of amplifying the full spectrum of a family’s 3′-end isoforms. Critically, Taqman stem-loop and miRCURY LNA miRNA assays also displayed a lack of specificity toward the 21 nt isoform of miR-222-3p. This was surprising for the latter technology, also based on polyadenylation RT-qPCR, given that the reverse primer used encompasses the junction between the polyadenylated tail and the 3′-end of the miRNA targeted.
In addition, primers targeted to long isomiRs failed to detect isomiRs lacking 2 or more 3′-end nucleotides. A similar observation has been made by us and others with Taqman stem-loop RT-qPCR and linker-adapter RT-qPCR (
Critically, we establish that addition of 2 or more adenosine residues at the 3′-end of the forward primer targeted to short miRNA isoforms (20–21 nt), significantly decreases amplification of >2 nt longer variants (as seen with miR-221-3p and miR-222-3p). This 4A-modification approach was much more specific toward shorter isoforms than Taqman stem-loop and miRCURY LNA miRNA assays, in addition to being very inexpensive. Combined with primers targeted to isoforms >22 nt, this 4A-modification allowed us to validate selective changes in isoform profiles previously measured by RNA-Seq, in human and mouse cells (
This strategy can readily be applied with commercial polyadenylation RT-qPCR kits relying on user-designed forward primers, such as the miR-X or the qScript kits, and custom enzymatic mixes relying on polyadenylase tailing (
Conclusion
We show that the method described here helps confer selectivity of RT-qPCR detection to isomiRs of varying 3′-end length. We demonstrate its capacity to distinguish between two 3′-end isomiR species, as long as these differ in length by 3 or more nucleotides. Our studies and those of others indicate that such length variation can be induced by cell-stimulation, and bacterial infections (
Statements
Author contributions
CN helped design, performed, and analyzed all the experiments, and helped write the manuscript. GP helped with experimental design, performed cell culture studies, and helped write the manuscript. MB helped with the design and synthesis of all synthetic RNAs. MG conceived and coordinated the study, designed and analyzed the experiments, and wrote the manuscript. All authors reviewed the results and approved the final version of the manuscript.
Funding
This work was funded in part by the Australian Research Council (140100594 Future Fellowship to MG); the Canadian Fonds de recherche du Québec – Santé (35071 FRSQ Fellowship to GP); and the Victorian Government’s Operational Infrastructure Support Program.
Acknowledgments
The authors thank V. Hornung for the human fibroblast cells, T. Beilharz for help with the targeted RNA-Seq, K. Pillman for help with bioinformatics analyses of small RNA-Seq, and A. Pate for help with the editing of this paper. They acknowledge the Monash Health Translation Precinct Research Platforms for access to the RT-qPCR instruments.
Conflict of interest
MB is employed by Integrated DNA Technologies, Inc., (IDT) which offers reagents for sale similar to some of the compounds described in the manuscript. IDT is, however, not a publicly traded company and the author does not personally own any shares/equity in IDT. The other authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
References
1
AndrovicP.ValihrachL.EllingJ.SjobackR.KubistaM. (2017). Two-tailed RT-qPCR: a novel method for highly accurate miRNA quantification.Nucleic Acids Res.45:e144. 10.1093/nar/gkx588
2
BenesV.CollierP.KordesC.StolteJ.RauschT.MuckentalerM. U.et al (2015). Identification of cytokine-induced modulation of microRNA expression and secretion as measured by a novel microRNA specific qPCR assay.Sci. Rep.5:11590. 10.1038/srep11590
3
FerrandJ.GantierM. P. (2016). Assessing the inhibitory activity of oligonucleotides on TLR7 sensing.Methods Mol. Biol.139079–90. 10.1007/978-1-4939-3335-8_5
4
GalardiS.MercatelliN.FaraceM. G.CiafreS. A. (2011). NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells.Nucleic Acids Res.393892–3902. 10.1093/nar/gkr006
5
GantierM. P.StundenH. J.MccoyC. E.BehlkeM. A.WangD.Kaparakis-LiaskosM.et al (2012). A miR-19 regulon that controls NF-kappaB signaling.Nucleic Acids Res.408048–8058. 10.1093/nar/gks521
6
GarofaloM.Di LevaG.RomanoG.NuovoG.SuhS. S.NgankeuA.et al (2009). miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation.Cancer Cell16498–509. 10.1016/j.ccr.2009.10.014
7
HaM.KimV. N. (2014). Regulation of microRNA biogenesis.Nat. Rev. Mol. Cell Biol.15509–524. 10.1038/nrm3838
8
HarrisonP. F.PowellD. R.ClancyJ. L.PreissT.BoagP. R.TravenA.et al (2015). PAT-seq: a method to study the integration of 3′-UTR dynamics with gene expression in the eukaryotic transcriptome.RNA211502–1510. 10.1261/rna.048355.114
9
JinJ.VaudS.ZhelkovskyA. M.PosfaiJ.McreynoldsL. A. (2016). Sensitive and specific miRNA detection method using SplintR ligase.Nucleic Acids Res.44:e116. 10.1093/nar/gkw399
10
JuzenasS.VenkateshG.HubenthalM.HoeppnerM. P.DuZ. G.PaulsenM.et al (2017). A comprehensive, cell specific microRNA catalogue of human peripheral blood.Nucleic Acids Res.459290–9301. 10.1093/nar/gkx706
11
KaraliM.PersicoM.MutarelliM.CarissimoA.PizzoM.Singh MarwahV.et al (2016). High-resolution analysis of the human retina miRNome reveals isomiR variations and novel microRNAs.Nucleic Acids Res.441525–1540. 10.1093/nar/gkw039
12
Le CarreJ.LamonS.LegerB. (2014). Validation of a multiplex reverse transcription and pre-amplification method using TaqMan((R)) MicroRNA assays.Front. Genet.5:413. 10.3389/fgene.2014.00413
13
LeeH. Y.ZhouK.SmithA. M.NolandC. L.DoudnaJ. A. (2013). Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing.Nucleic Acids Res.416568–6576. 10.1093/nar/gkt361
14
LiuS.SunX.WangM.HouY.ZhanY.JiangY.et al (2014). A microRNA 221- and 222-mediated feedback loop maintains constitutive activation of NFkappaB and STAT3 in colorectal cancer cells.Gastroenterology147847.e11—859. e811. 10.1053/j.gastro.2014.06.006
15
MageeR.TelonisA. G.CherlinT.RigoutsosI.LondinE. (2017). Assessment of isomiR discrimination using commercial qPCR methods.Noncoding RNA3:18. 10.3390/ncrna3020018
16
MeloS. A.MoutinhoC.RoperoS.CalinG. A.RossiS.SpizzoR.et al (2010). A genetic defect in exportin-5 traps precursor microRNAs in the nucleus of cancer cells.Cancer Cell18303–315. 10.1016/j.ccr.2010.09.007
17
MestdaghP.FeysT.BernardN.GuentherS.ChenC.SpelemanF.et al (2008). High-throughput stem-loop RT-qPCR miRNA expression profiling using minute amounts of input RNA.Nucleic Acids Res.36:e143. 10.1093/nar/gkn725
18
MestdaghP.HartmannN.BaeriswylL.AndreasenD.BernardN.ChenC.et al (2014). Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.Nat. Methods11809–815. 10.1038/nmeth.3014
19
NeilsenC. T.GoodallG. J.BrackenC. P. (2012). IsomiRs–the overlooked repertoire in the dynamic microRNAome.Trends Genet.28544–549. 10.1016/j.tig.2012.07.005
20
NejadC.PillmanK. A.SiddleK. J.PépinG.ÄnköM. L.MccoyC. E.et al (2018). miR-222 isoforms are differentially regulated by type-I interferon.RNA.10.1261/rna.064550.117 [Epub ahead of print].
21
NiuY.ZhangL.QiuH.WuY.WangZ.ZaiY.et al (2015). An improved method for detecting circulating microRNAs with S-Poly(T) pPlus real-time PCR.Sci. Rep.5:15100. 10.1038/srep15100
22
OliveV.BennettM. J.WalkerJ. C.MaC.JiangI.Cordon-CardoC.et al (2009). miR-19 is a key oncogenic component of mir-17-92.Genes Dev.232839–2849. 10.1101/gad.1861409
23
SchambergerA.OrbanT. I. (2014). 3′ IsomiR species and DNA contamination influence reliable quantification of microRNAs by stem-loop quantitative PCR.PLOS ONE9:e106315. 10.1371/journal.pone.0106315
24
ShigematsuM.HondaS.KirinoY. (2018). Dumbbell-PCR for discriminative quantification of a small RNA variant.Methods Mol. Biol.168065–73. 10.1007/978-1-4939-7339-2_4
25
SiddleK. J.TailleuxL.DeschampsM.LohY. H.DeluenC.GicquelB.et al (2015). Bbacterial infection drives the expression dynamics of microRNAs and their isomiRs.PLOS Genet11:e1005064. 10.1371/journal.pgen.1005064
26
SimsekM.AdnanH. (2000). Effect of single mismatches at 3′-end of primers on polymerase chain reaction.J. Sci. Res. Med. Sci.211–14.
27
StifterS. A.GouldJ. A.ManganN. E.ReidH. H.RossjohnJ.HertzogP. J.et al (2014). Purification and biological characterization of soluble, recombinant mouse IFNbeta expressed in insect cells.Protein Expr. Purif.947–14. 10.1016/j.pep.2013.10.019
28
TanG. C.ChanE.MolnarA.SarkarR.AlexievaD.IsaI. M.et al (2014). 5′ isomiR variation is of functional and evolutionary importance.Nucleic Acids Res.429424–9435. 10.1093/nar/gku656
29
TelonisA. G.MageeR.LoherP.ChervonevaI.LondinE.RigoutsosI. (2017). Knowledge about the presence or absence of miRNA isoforms (isomiRs) can successfully discriminate amongst 32 TCGA cancer types.Nucleic Acids Res.452973–2985. 10.1093/nar/gkx082
30
TreiberT.TreiberN.PlessmannU.HarlanderS.DaissJ. L.EichnerN.et al (2017). A compendium of RNA-Binding proteins that regulate MicroRNA biogenesis.Mol. Cell.66270.e13—284. e213. 10.1016/j.molcel.2017.03.014
31
WuD.HuY.TongS.WilliamsB. R.SmythG. K.GantierM. P. (2013). The use of miRNA microarrays for the analysis of cancer samples with global miRNA decrease.RNA19876–888. 10.1261/rna.035055.112
32
WuH.NeilsonJ. R.KumarP.ManochaM.ShankarP.SharpP. A.et al (2007). miRNA profiling of naive, effector and memory CD8 T cells.PLOS ONE2:e1020. 10.1371/journal.pone.0001020
33
YuF.PillmanK. A.NeilsenC. T.ToubiaJ.LawrenceD. M.TsykinA.et al (2017). Naturally existing isoforms of miR-222 have distinct functions.Nucleic Acids Res.4511371–11385. 10.1093/nar/gkx788
Summary
Keywords
microRNA isoforms, isomiR, polyadenylation, RT-qPCR, selective amplification
Citation
Nejad C, Pépin G, Behlke MA and Gantier MP (2018) Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms. Front. Genet. 9:11. doi: 10.3389/fgene.2018.00011
Received
26 October 2017
Accepted
09 January 2018
Published
24 January 2018
Volume
9 - 2018
Edited by
Seyed Javad Mowla, Tarbiat Modares University, Iran
Reviewed by
Geraldo Aleixo Passos, University of São Paulo, Brazil; Eric Londin, Thomas Jefferson University, United States
Updates

Check for updates
Copyright
© 2018 Nejad, Pépin, Behlke and Gantier.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Michael P. Gantier, michael.gantier@hudson.org.au
This article was submitted to RNA, a section of the journal Frontiers in Genetics
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.