ORIGINAL RESEARCH article

Front. Mol. Neurosci., 03 June 2025

Sec. Pain Mechanisms and Modulators

Volume 18 - 2025 | https://doi.org/10.3389/fnmol.2025.1574219

A NaV1.8FlpO mouse enabling selective intersectional targeting of low threshold C fiber mechanoreceptors and nociceptors

  • 1. Division of Cell-and Neurobiology, Department of Biomedical and Clinical Sciences, Linköping University, Linköping, Sweden

  • 2. Wallenberg Center for Molecular Medicine, Linköping University, Linköping, Sweden

Abstract

Genetic targeting of select populations of cells in the mouse nervous system is often hampered by a lack of selectivity, as candidate genes for such targeting are commonly expressed by multiple cell populations, also in the same region. Intersectional targeting using two or more genes has been enabled by the development of reporter tools dependent on more than one recombinase or gene regulator. Still, widespread adoption of intersectional tools is complicated by a scarcity of driver mice expressing recombinases other than Cre. Here we report the generation and characterization of a new driver mouse that expresses the FlpO recombinase from the endogenous locus of the Scn10a gene encoding NaV1.8, a voltage-gated sodium channel that is almost exclusively expressed in the afferent limb of the peripheral nervous system. Moreover, among sensory neurons the channel is preferentially expressed in nociceptors and in low-threshold C-fiber mechanoreceptors (C-LTMRs). The mouse showed high recombination efficiency (97%) and selectivity (93%) in dorsal root ganglia. Reporter-expressing fibers were observed in a variety of peripheral tissues, including skin, skeletal muscle, genitalia, bladder and intestines. To validate the suitability of the FlpO mouse line for intersectional targeting, we crossed it with a mouse line expressing CreERT2 from the Th (tyrosine hydroxylase) locus. This approach resulted in strikingly selective and efficient targeting of C-LTMRs, showing robust visualization of nerve endings of these fibers in skin and spinal cord at the light and electron microscopic level. Thus, the NaV1.8Flpo mouse line presented here constitutes a selective and versatile tool for intersectional genetic targeting of NaV1.8 expressing primary afferent neurons.

Introduction

Primary afferent fibers innervating skin and internal organs are pivotal for sensing the external and internal environments, thus informing behavior and homeostasis that enable the survival of the organism. Such sensory fibers include low-threshold mechanoreceptors (LTMRs) that signal innocuous mechanical stimuli, as well as nociceptors that are activated by noxious stimuli that threaten the integrity of the tissue. The last decade has seen a rapid progress in delineating primary afferent populations via transcriptomics and other means, identifying genetic markers of such populations (e.g., Kupari and Ernfors, 2023; Sharma et al., 2020; Usoskin et al., 2015; Handler and Ginty, 2021; Li et al., 2015). However, whereas in some cases this has allowed targeting of relatively homogeneous populations for functional and anatomical characterization using Cre-expressing mouse lines (Qi et al., 2024b; Li et al., 2011), such an approach is often hampered by the lack of a single genetic marker that uniquely identifies the population of interest.

C fiber low-threshold mechanoreceptors (C-LTMRs) are thought to mediate pleasant touch (Löken et al., 2009; Olausson et al., 2002; Huzard et al., 2022) but have also been suggested to have a role in pain modulation (Larsson and Nagi, 2022). However, investigation of the function of these fibers in animals has been hindered by a lack of genetic tools for selective functional manipulation. C-LTMRs express Th (encoding tyrosine hydroxylase, TH) and Slc17a8 (encoding the vesicular glutamate transporter 3, VGluT3); however, those genes are also expressed in other cells in the CNS and peripheral tissue, which complicates the use of mice expressing Cre or tamoxifen-inducible CreERT2 from the loci of either of these genes. For instance, targeting of a genetically encoded actuator protein using ThCreERT2 mice may also capture mechanosensitive Merkel cells in the skin (Hoffman et al., 2018), sympathetic nerve fibers, as well as catecholaminergic neurons in the brainstem. However, unlike those cells, C-LTMRs also express the voltage-sensitive sodium channel NaV1.8, encoded by the gene Scn10a. Thus, it may be possible to employ an intersectional targeting approach that uses ThCreERT2 driver mice together with a second driver mouse line expressing a distinct recombinase from the Scn10a locus, in combination with double recombinase dependent genetic tools. Moreover, in addition to C-LTMRs, NaV1.8 is selectively expressed in most nociceptors whereas myelinated LTMRs have little or no expression of this ion channel. A NaV1.8 driver mouse could therefore potentially be used for intersectional targeting of nociceptor subpopulations where the second genetic marker is not nociceptor-specific. We therefore generated a new mouse line that expresses FlpO recombinase from the Scn10a locus and explored its utility for targeting of NaV1.8-expressing primary afferent neurons in somatosensory and viscerosensory pathways, including intersectional selective targeting of C-LTMRs.

Materials and methods

Gene targeting

The NaV1.8FlpO knock-in mouse line was generated through homologous recombination in J1 embryonic stem cells (derived from 129S4 mice) at the Karolinska Center Transgene Technology. The Scn10a-IRES2-FlpO targeting vector (TV) was constructed using the Gibson Assembly cloning kit (New England Biolabs). The IRES2-FlpO cassette was inserted 10 base pairs downstream of the stop codon of the last NaV1.8 exon. The vector incorporated a self-excision tACE-Cre-Neo (ACN) selection cassette, similar to the design originally described by Bunting et al. (1999), but with Lox2272 flanking sites. After excision, a single lox site remained 19 base pairs downstream of the terminal exon. The plasmid containing the ACN cassette was kindly provided by Mario Capecchi (Addgene plasmid #20343; Wu et al., 2008). Homology arms for the targeting vector were amplified via PCR from mouse ES cell DNA using the following primers: Forward: CCCGTGTGCCAGGAACTGAGTC Reverse: CATCAACTCATGCTTGGATGGTGT. The vector backbone was based on the Slc1a3-CreERT2 plasmid (Addgene plasmid #129409; Kaczmarczyk et al., 2021), linearized with AscI and SmaI restriction enzymes. To enhance homologous recombination efficiency, the TV was co-electroporated with a pX330-Nav1.8 Cas9 vector containing a suitable sgRNA sequence (ATGCTGGAGTGTCTTCACTG). The pX330 backbone was a gift from Feng Zhang (Addgene plasmid #42230; Cong et al., 2013). The full sequences of both the TV and the Cas9 plasmid are available at https://tinyurl.com/Scn10a-IRES2-FlpO. Plasmid integrity was verified by restriction digest and Sanger sequencing. As a result of successful gene targeting, the Scn10a locus encoding NaV1.8 was replaced with an Scn10a-IRES2-FlpO-3’UTR cassette (Figure 1A).

Figure 1

Animals

For Flp-dependent reporter expression, NaV1.8FlpO mice were crossed with Ai65F mice (RCF-tdT; Jackson Laboratory, strain #032864) (Daigle et al., 2018). For intersectional genetic targeting of C-LTMRs, NaV1.8FlpO mice were crossed with either Ai65 mice (RCFL-tdT; Jackson Laboratory, strain #021875) (Daigle et al., 2018) or ROSA26DR-Matrix-dAPEX2 (Jackson Laboratory, strain #032764; here called APEX2 mice) (Zhang et al., 2019); the resulting offspring was further crossed with ThCreERT2 mice (Jackson Laboratory, strain #025614) (Abraira et al., 2017) to generate offspring heterozygous for NaV1.8FlpO, ThCreERT2, and reporter. ThCreERT2 mice were also crossed with singly Cre-dependent Ai14 mice (RCL-tdTomato, Jackson Laboratory, strain #007914) (Madisen et al., 2010). Mouse genotyping was performed using the following primers: wt forward, 5’-CTG AGG GTC GGC CAT TAA AAT TGA-3′; mutant forward, 5’-ACC TGA GGG TCG GCC ATT AAA ATT GA-3′; wt reverse, 5′-GAG ATT GAC CTC YGG CCT CCA AA-3′; mutant reverse, 5’CAG AGA TTG ACC TCT GGC CTC CAA A-3′. All animal experiments were approved by the Animal Ethics Committee at Linköping University (permits no. 2439–2021 and 214–2021) and performed in accordance with the EU Directive 2010/63/EU.

Behavioral assays

To assess potential effects of the modified Scn10a allele on acute nociception, 6–8 week old homozygous NaV1.8Flpo/FlpO mice (4 females, 4 males) and wildtype C57BL/6Jrj mice (4 females, 3 males) were subjected to von Frey and hot plate assays. For the von Frey assay, mice were placed in a small plexiglass cubicle (W × D × H 9 × 5 × 5 cm) with a mesh floor. After 15 min habituation, the mechanical paw withdrawal threshold was assessed using manual von Frey filaments applied to the plantar hindpaw. The mechanical von Frey threshold was determined using the simplified up-down method (Bonin et al., 2014). The hot plate assay was performed using a hot plate analgesia meter (IITC Life Science). The mouse was put on the hot plate set to a constant temperature of 50°C, and immediately removed when jumping or paw licking/flicking was observed. Each mouse underwent three trials (minimum 15 min inter-trial interval) and the average latency to nocifensive behavior calculated.

Tamoxifen injection

For ThCreERT2; NaV1.8FlpO; Ai65 and ThCreERT2; NaV1.8FlpO; APEX2 mice, tamoxifen (T5648, Sigma-Aldrich) dissolved in corn oil at a concentration of 20 mg/mL was administered at 8–10 weeks of age by a single injection (100 μL, i.p.). The mice were perfused no earlier than 2 weeks after injection.

Tissue preparation

Adult mice of either sex were anesthetized with i.p. injections of either sodium pentobarbital (100 mg/kg) or a mixture of ketamine (120 mg/kg) and dexmedetomidine (0.5 mg/kg), after which they were subjected to transcardial perfusion using 5 mL phosphate buffer (PB, 0.1 M pH 7.4) followed by 50 mL of 4% paraformaldehyde (for immunofluorescence) or 2% paraformaldehyde and 2.5% glutaraldehyde (for electron microscopy). Tissue of interest was harvested, post-fixed overnight at 4°C and then stored in 1/10 fixative or PB until further processing.

Immunofluorescence

Tissue specimens were cryoprotected in 30% sucrose, embedded in OCT, cut at 15 μm or 50 μm thickness in a cryostat and placed on glass slides. Alternatively, specimens were embedded in 4% low-melting agarose and cut on a vibrating microtome (Campden Instruments 7,000smz-2) at 50 μm thickness. Sections were incubated in phosphate-buffered saline (PBS) with 3% normal goat serum, 0.5% bovine serum albumin and 0.5% Triton X-100 (blocking solution), and then in blocking solution with primary antibodies (see Table 1) overnight at room temperature. Sections were next rinsed and incubated in secondary antibody solution (Table 2). For detection of isolectin B4 (IB4) binding sites, biotinylated IB4 (Life Technologies, I21214) was added to the primary antibody solution at 1:1,000 dilution, and streptavidin-Alexa Fluor 488 (Life Technologies, S11223) added to the secondary antibody solution at 1:500 dilution. In some cases, cell nuclei were stained using DAPI or SYTOX Deep Red (ThermoFisher Scientific, S11380). Sections were coverslipped with Prolong Diamond, Prolong Glass or SlowFade Diamond (Life Technologies) and imaged using Zeiss LSM800 (10x/0.3, 20x/0.8, 40x/1.3 and 63x/1.4 objectives), Leica Stellaris 5 (63x/1.4 objective) confocal microscopes, or Leica DMi8 epifluorescence microscope (20x/0.5 objective, for tile scans of parasagittal brain sections and spinal cord overviews).

Table 1

AntigenHost, isotypeSupplierCat #Dilution
CGRPGuinea pigSynaptic Systems4140041:1000
NFHChickenThermo Fisher ScientificPA1-100021:1000
NeuNMouse, IgG1Merck MilliporeMAB3771:1000
ParvalbuminGuinea pigSynaptic Systems1950041:500
PKCγGuinea pigFrontier InstitutePKCg-GP-Af3501:250
RFP (tdTomato)ChickenSynaptic Systems4090061:2,000
RFP (tdTomato)RabbitRockland600-401-3791:1,000
THRabbitAbcamAb1121:200
TRPV1RabbitSynaptic Systems4440331:1,000
VGluT3Guinea pigFrontier InstituteVGLUT3-GP-Af3001:500
VimentinMouse, IgG1Santa Cruzsc-62601:200

Primary antibodies.

Table 2

Host, targetFluorophoreSupplierCat #Dilution
Goat α-chicken IgY (H + L)Alexa Fluor 488Life TechnologiesA329311:500
Goat α-chicken IgY (H + L)Alexa Fluor 555Life TechnologiesA214371:500
Goat α-guinea pig IgG (H + L)Alexa Fluor 488Life TechnologiesA110731:500
Goat α-guinea pig IgG (H + L)Alexa Fluor 647Life TechnologiesA214501:500
Goat α-mouse IgG1Alexa Fluor 488Life TechnologiesA211211:500
Goat α-rabbit IgG (H + L)Alexa Fluor 488Life TechnologiesA110341:500
Goat α-rabbit IgG (H + L)Alexa Fluor Plus 555Life TechnologiesA327321:500

Secondary antibodies.

In situ hybridization

The in situ hybridization chain reaction (HCR) protocol was based on Molecular Instruments’ HCR RNA-FISH protocol for frozen fixed tissue sections. DRG cryostat sections (15 μm thickness) were incubated in probe hybridization buffer with 0.4 pmol of each probe set overnight at 37°C, after which the sections were washed using probe wash buffer and 5X SSCT (sodium chloride sodium citrate with 0.1% Tween 20). Before amplification, 6 pmol of hairpin h1 and 6 pmol of hairpin h2 were denatured (95°C for 90 s, followed by cooling at room temperature in the dark for 30 min). The sections were then incubated in amplication buffer with the h1 and h2 hairpins overnight at room temperature, and then washed in 5X SSCT to remove excess hairpins. After coverslipping with Prolong Diamond, the sections were imaged in a Zeiss LSM800 confocal microscope.

Electron microscopy

The day after perfusion fixation, thoracic spinal cord from three ThCreERT2; NaV1.8FlpO; APEX2 mice was embedded in 4% low-melting agarose, cut on a vibrating microtome into 50 μm or 150 μm transverse sections, and immediately subjected to APEX2 histochemistry. The sections were incubated in 3,3′-diaminobenzidine (DAB) without H2O2 for 30–60 min, and then in DAB with H2O2 (Vector Laboratories SK-4100) for 45–60 min. The sections were then osmicated in 1% OsO4 in 0.1 M PB, stained with 1% uranyl acetate in 70% ethanol, dehydrated in a graded series of ethanol and embedded in Durcupan. Ultrathin sections were placed on Formvar coated single-slot copper grids, counterstained with 2% aqueous uranyl acetate and 0.5% lead citrate (in some cases post-embedding counterstaining was omitted) and examined in a JEOL JEM1400 Flash transmission electron microscope at 80 kV accelerating voltage.

Image analysis

To measure the soma size of DRG neurons, complete z-stacks (16–22 optical sections at 0.53 μm separation, 24 μm pinhole) of each DRG section were obtained using a Zeiss LSM800 confocal microscope and a 20x/0.8 objective, and analyzed using Fiji. The maximal cross-sectional area of each DRG neuron in the z-stack was determined. Neurons where the largest cross-sectional area was observed in the first or last optical section of the z-stack were excluded.

Statistical analysis

All descriptive statistics and statistical tests were performed in GraphPad Prism. Parametric tests were performed only when the underlying data passed the Shapiro–Wilk normality test. All measures are given as mean ± S.E.M.

Results

Mice heterozygous or homozyogous for the Scn10a-IRES2-FlpO allele were viable, fertile and showed no overt behavioral deficits. Further, homozygous NaV1.8FlpO/FlpO mice did not show any impairment with respect to mechanical nociceptive withdrawal reflexes or heat-induced nocifensive behavior (Figure 1B). In lumbar DRGs of NaV1.8FlpO; Ai65F mice, tdTomato protein was found in numerous NeuN immunoreactive neurons. Whereas the majority of tdTomato+ neurons were small, some were medium-to-large sized (Figures 1C,D). In some immunolabeling experiments of the DRG, we noted enrichment of tdTomato immunolabeling at the plasma membrane of some neurons. This labeling pattern was only observed when using a rabbit anti-tdTomato antibody, not when using a chicken primary antibody, and was continuous with a gradient of immunolabeling into the cytosol of the neuron. Nevertheless, to rule out that this edge labeling represented tdTomato expression in satellite glial cells that surround DRG neurons, we co-immunolabeled for tdTomato and the satellite glial cell marker vimentin (Supplementary Figure S1). Indeed, no co-localization of tdTomato with vimentin was observed, confirming that tdTomato expression was restricted to neurons in the DRG. In situ hybridization showed that the vast majority (97.1 ± 1.2%) of Scn10a+ neurons expressed tdTomato protein; conversely, 93.1 ± 1.4% of tdTomato+ cells expressed Scn10a mRNA (Figures 1E,F) (here and elsewhere, mRNA is referred to by the gene name in italics, while protein names are written in regular font style). Calcitonin gene-related peptide (CGRP), IB4 binding, and TRPV1 were found in subsets of tdTomato+ neurons (Figure 2). tdTomato also showed partial overlap with neurofilament heavy chain (NFH) and its transcript Nefh, including in peripheral axons of the sciatic nerve. In the spinal cord, tdTomato+ processes, i.e., presumed central projections of NaV1.8+ primary afferent fibers, were present throughout the dorsal horn at varying densities (Figure 3). The largest density of tdTomato+ processes was found in lamina I and the dorsal half of lamina II, whereas ventral lamina II and dorsal lamina III, as outlined by the presence of PKCγ+ neurons, showed a progressively lower density of processes along the dorsoventral axis. Processes were at all spinal levels considerably sparser in ventral lamina III to lamina V, and absent from the intermediate or ventral horns. Cell bodies exhibiting tdTomato fluorescence were not observed in the spinal cord. In spinal white matter, processes were found in Lissauer’s tract as well as in the dorsal and medial parts of the dorsal funiculus. We did not attempt a comprehensive mapping of the distribution of tdTomato+ cells and processes in the brain. However, tdTomato+ structures were generally sparse (Figure 4). In the brainstem, tdTomato+ processes were found in the trigeminal spinal nucleus, as well as in the nucleus of the solitary tract. Notably, fibers were also present in the gracile nucleus (and to a lesser degree the cuneate nucleus), as well as in the principal trigeminal nucleus, the superior olivary complex, and in pontine nuclei. In the subcortical forebrain, tdTomato+ cells were noted in the anterior olfactory nucleus, the bed nucleus of the stria terminalis, the endopiriform nucleus, the septum and the nucleus of the diagonal band. In the cortex, tdTomato+ cells were generally not found; however, in frontal cortex we observed some tdTomato+ cells in layer 6b immediately superior to the corpus callosum. In addition, tdTomato+ fibers were quite abundant in layer 1a of the frontal cortex, whereas such fibers were very sparse in other cortical regions. Scattered tdTomato+ cells were found in the granule cell layer of the olfactory bulb.

Figure 2

Figure 3

Figure 4

Select peripheral organs and ganglia were surveyed for the presence of tdTomato+ nerve fibers. In glabrous skin, tdTomato+ fibers forming free epidermal nerve endings were abundant (Figure 5A). Notably, although apically directed fibers traversed dermal papillae, we observed no Meissner corpuscle-like endings, as has previously been reported in NaV1.8Cre mice (Shields et al., 2012). In hairy skin, tdTomato+ circumferential nerve endings around hair follicles were also observed in addition to free nerve endings (Figure 5B). In both glabrous and hairy skin, cutaneous tdTomato+ fibers often but not always colocalized with CGRP immunoreactivity.

Figure 5

Many cells in nodose and jugular ganglia exhibited tdTomato immunoreactivity, as did neurons in the Grüneberg ganglion, a chemo−/thermosensory ganglion in the nose (Figure 6). In skeletal muscle, sparse tdTomato+ fibers were found, while epithelia of the bladder, colon and rectum were richly innervated by tdTomato+ fibers. Similarly, tdTomato+ fibers were abundant in epithelia of both male and female genitalia. In the aortic arch, sparse tdTomato+ fibers were detected, whereas the lamina propria of the olfactory mucosa showed strong innervation by tdTomato+ fibers.

Figure 6

In order to test the utility of the NaV1.8FlpO strain for intersectional genetic targeting of primary afferent fiber populations, we crossed this line with a ThCreERT2 mouse strain and a Cre/Flp-dependent reporter line (Ai65; Figure 7A). In DRGs of these mice, 75.3 ± 1.8% of TH+ neurons showed tdTomato fluorescence, whereas 94.3 ± 1.7% of tdTomato+ cells were TH+, indicating high recombination efficiency and selectivity towards C-LTMRs among primary afferent fibers (Figure 7). Importantly, tdTomato fluorescence did not co-localize with nociceptive markers CGRP or IB4, or with the myelinated neuron marker NFH (Supplementary Figure S2). In the lumbar enlargement of the spinal cord of these mice, tdTomato+ processes were evident in a distinct band in the superficial dorsal horn. This band coincided with the dorsal part of the region occupied by neurons expressing the γ isoform of protein kinase C (PKCγ), ventral to the plexus formed by IB4 binding C-fibers (Figure 8A). Notably, tdTomato+ fibers were absent from the medial dorsal horn that receives input from hind paw glabrous skin, and co-localized with VGluT3+ structures. In ThCreERT2;NaV1.8FlpO;Ai65 mice, tdTomato fluorescence was restricted to the dorsal roots, tract of Lissauer and ventral lamina II, whereas in ThCreERT2;Ai14 mice that target tdTomato to all TH+ cells, various tdTomato+ processes were also observed throughout gray and white matter (Figure 8B). In the hairy skin of ThCreERT2; NaV1.8FlpO;Ai65 mice, tdTomato fluorescence was found selectively in lanceolate endings surrounding hair follicles, whereas in ThCreERT2;Ai14 mice tdTomato fluorescence was also observed in presumed sympathetic fibers. In the brain of ThCreERT2; NaV1.8FlpO;Ai65 mice tdTomato+ processes were restricted to the solitary tract, the nucleus of the solitary tract, and, very sparsely, trigeminal structures; other parts of the brain were completely devoid of tdTomato+ processes. By contrast, tdTomato+ fibers and cells showed the expected widespread distribution in ThCreERT2; Ai14 mice (Supplementary Figure S3). Thus, using the NaV1.8FlpO strain affords highly efficient and selective targeting of C-LTMRs while avoiding targeting of central and peripheral catecholaminergic systems.

Figure 7

Figure 8

The ultrastructure of central C-LTMR terminations is contentious, having been described as forming either type I or type II glomeruli in the spinal dorsal horn (Larsson and Broman, 2019; Salio et al., 2021). Such discrepancy could be partly attributed to differences in the markers used for C-LTMR terminals. Here we addressed this issue by creating ThCreERT2; NaV1.8FlpO; APEX2 mice, expressing APEX2 in the mitochondrial matrix of C-LTMRs in a Cre-/Flp-dependent manner highly selective for C-LTMRs. In spinal cord from these mice, terminals possessing mitochondria with APEX2 reaction product were commonly found to constitute central terminals of synaptic glomeruli in ventral lamina II (Figure 9). Often irregularly shaped, these terminals exhibited light axoplasm and loosely packed clusters of round and clear synaptic vesicles. In many cases, multiple asymmetric synapses were formed with postsynaptic dendrites. Some of these dendrites contained vesicles and thus presumably originated from inhibitory interneurons (Todd, 1996). Very occasionally, a presynaptic axon was found to form a symmetric synapse onto the central APEX2+ terminal (Figure 9B). Sometimes, the central terminal exhibited more tightly packed vesicle clusters and a scalloped shape, somewhat reminiscent of the central terminals of type I glomeruli (Figure 9C). However, the central terminals of type I glomeruli exhibited a distinctly more electron dense axoplasm and were considerably more tightly packed with vesicles which were of irregular sizes, unlike the more homogenously sized vesicles of APEX2+ terminals. Notably, type I glomeruli were almost always more dorsally located than APEX2+ terminals. Thus, C-LTMRs form type II glomeruli that are readily distinguishable from type I glomeruli formed by IB4 binding non-peptidergic C fiber nociceptors.

Figure 9

Discussion

In the present study we have generated and characterized a new knock-in mouse that expresses the recombinase FlpO from the locus of the gene Scn10a, that encodes the voltage-gated Na+ channel NaV1.8. We show that this mouse with very high efficiency and selectivity recapitulates the expression of NaV1.8 in primary afferent neurons, and can be used for intersectional targeting of primary afferent fiber populations, as exemplified here by the highly selective targeting of C-LTMRs by combining the new NaV1.8FlpO mouse, presented in this study, with a ThCreERT2 mouse and double recombinase dependent reporter tools.

NaV1.8 was first identified in neurons of DRGs (Akopian et al., 1996) and found to be broadly expressed in nociceptors (Djouhri et al., 2003). A knock-in/knock-out NaV1.8Cre mouse line was therefore developed (Stirling et al., 2005) which has since been widely used for nociceptor-specific targeting (e.g., Abrahamsen et al., 2008; Daou et al., 2013; Nassar et al., 2004; Lagerström et al., 2011). However, as NaV1.8 is broadly expressed in essentially all nociceptor populations identified, as well as in C-LTMRs (Kupari and Ernfors, 2023; Usoskin et al., 2015), unmasking the roles of these subpopulations of sensory neurons is not possible using the NaV1.8Cre mouse alone. Indeed, genetic markers are generally not selective for a single cell population but also expressed by other cell types, either in the PNS, CNS or non-neural tissue. Using NaV1.8 as one limb of an intersectional targeting approach is useful since it essentially restricts expression to primary nociceptors and C-LTMRs; another gene less specific to the PNS can then be used as a second driver of recombinase expression.

It has been reported that the previously available, widely used NaV1.8Cre mouse line exhibits Cre-dependent recombination not only in nociceptors and C-LTMRs, but also in some A fiber LTMRs, including in nerve endings within Meissner corpuscles (Shields et al., 2012). Here we did not observe any recombined fibers innervating Meissner corpuscles, suggesting that our NaV1.8FlpO mouse does not target any of the two types of rapidly adapting Aβ LTMRs that innervate Meissner corpuscles (Neubarth et al., 2020), in line with the expression of NaV1.8 mostly restricted to Piezo2-poor fibers as observed in transcriptomic studies (Sharma et al., 2020; Usoskin et al., 2015). Still, we did observe a similarly high proportion of recombined neurons that express the A fiber marker NFH as was found with the NaV1.8Cre mouse line (~40%), suggesting that a substantial fraction of fibers exhibiting recombination were myelinated. Some reporter expressing innervation was also found in the dorsal column nuclei as well as in the principal nucleus of the trigeminal nerve, which would speak for FlpO expression in myelinated LTMRs. However, although dorsal column pathways are conventionally viewed as purely involved in low-threshold mechanoreception, they have also been suggested to be involved in visceral nociception, and this could be partly mediated by direct innervation by primary afferent branches (Willis et al., 1999). Nevertheless, although FlpO-dependent recombination very closely followed the expression of the Scn10a (NaV1.8) gene, it can from the present observations not be excluded that a portion of the fibers showing such recombination were LTMRs.

We surveyed the distribution of recombined nerve fibers in a number of peripheral tissues. In nodose and jugular ganglia, many cells were tdTomato+, in line with previous reports using NaV1.8Cre mice (Gautron et al., 2011; Stirling et al., 2005), as well as with transcriptomics data (Kupari et al., 2019). Accordingly, we consistently noted extensive innervation of vagal innervation targets, including the bladder wall, intestinal mucosa, and aortic wall. Numerous tdTomato+ fibers were present in the vaginal wall, including the mucosa and lamina propria, in accordance with the dense innervation by substance P+/CGRP+ fibers previously described (Barry et al., 2017). Similarly, the external and internal prepuces of the glans penis showed dense innervation of tdTomato+ fibers in alignment with recent observations of CGRP+ and TH+ fibers in these structures (Qi et al., 2024a).

A novel finding was the presence of recombined neurons in the Grüneberg ganglion, a little-studied sensory ganglion in the distal nose. This structure, which has been implicated in the sensation of alarm pheromones and cold (Brechbühl et al., 2008; Schmid et al., 2010), has previously been reported to not show NaV1.8 immunoreactivity (Schmid et al., 2010). Thus, the tdTomato expression found here could reflect either an only weak expression of NaV1.8, or ectopic recombinase expression.

Whereas much attention has been devoted to transcriptomic and neurochemical identification of cutaneous and visceral nociceptor populations, much less is known about nociceptor populations innervating skeletal muscle or other deep somatic tissue (Mense, 2010). Here we found sparse but widespread innervation of recombined fibers in the gastrocnemius muscle, suggesting that the NaV1.8FlpO mouse can be useful for characterizing of nociceptive muscle afferent fibers.

A somewhat surprising observation was the presence in the CNS of recombined cells and processes that did not originate from primary afferent sources. The presence of NaV1.8 protein or Scn10a mRNA in the brain has not been reported in the literature; however, the Allen Brain Atlas does show expression of Scn10a mRNA in several regions where we found recombined cells, including the granule cell layer of the olfactory bulb and layer 6 in parts of the frontal cortex. Further investigation is necessary to ascertain whether the reporter expression in our mice is attributed to actual NaV1.8 expression or to ectopic recombination.

We combined the NaV1.8FlpO line with ThCreERT2 mice to test the utility of NaV1.8FlpO mice in intersectional targeting, and demonstrated that this cross enables efficient and exquisitely selective targeting of C-LTMRs in DRGs without recombination in sympathetic neurons, Merkel cells or in other populations of DRG neurons. Notably, we found very little recombination in the trigeminal system, which is in agreement with the low expression of Th observed in C-LTMRs in trigeminal ganglia (Nguyen et al., 2017). A recent study generated a TAFA4CreERT2 mouse for targeting of C-LTMRs (Zhang et al., 2024), which selectively express this chemokine (Delfini et al., 2013). However, the TAFA4CreERT2 mice also showed recombination in subsets of DRG neurons with nociceptive or myelination markers, as well as in neurons in some regions of the CNS (Zhang et al., 2024). Thus, the intersectional ThCreERT2; NaV1.8FlpO cross used here constitutes a more selective manner of targeting C-LTMRs.

While this manuscript was in preparation, the generation of another NaV1.8FlpO mouse line was reported (Malapert et al., 2024). The distribution of recombined afferent fibers in spinal cord and peripheral organs in that mouse line is consistent with our observations. Malapert et al. used other reporter mice than those used here, precluding firm comparisons regarding efficiency and selectivity towards NaV1.8 expressing DRG neurons. However, Malapert et al. reported that about 85% of Scn10a+ neurons expressed reporter (efficiency) and that 85% of reporter-positive neurons expressed Scn10a (selectivity) in their mouse line, while we observed 97% efficiency and 93% selectivity in this study. Thus, it is possible that our newly generated mouse affords somewhat higher efficiency and selectivity than the previously reported strain.

In conclusion, here we report the generation of a NaV1.8FlpO mouse line that enables a highly efficient and selective targeting of NaV1.8 expressing primary afferent neurons, as well as hitherto unrecognized small populations of such neurons in the brain. Furthermore, we show that this mouse line enables intersectional targeting of subpopulations of NaV1.8 expressing neurons such as C-LTMRs when combined with suitable Cre driver mice. We anticipate that this mouse line will be a highly useful and versatile tool for the continued exploration of murine sensory systems.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary material, further inquiries can be directed to the corresponding author.

Ethics statement

The animal study was approved by Linköpings djurförsöksetiska nämnd. The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

JC: Conceptualization, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. LK: Formal analysis, Investigation, Methodology, Validation, Writing – original draft, Writing – review & editing. WJ: Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Writing – original draft, Writing – review & editing. ML: Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing.

Funding

The author(s) declare that financial support was received for the research and/or publication of this article. This study was funded by Knut and Alice Wallenberg Foundation, project no. 2019.0047, and the Wallenberg Center for Molecular Medicine (LK and WJ).

Acknowledgments

We thank Dr. Maria Ntzouni and Dr. Vesa Loitto at the Microscopy Core Facility at the Medical Faculty, Linköping University for technical assistance.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The authors declare that no Gen AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fnmol.2025.1574219/full#supplementary-material

SUPPLEMENTARY FIGURE S1

tdTomato is not localized to satellite glial cells in DRGs of NaV1.8FlpO; Ai65F mice. Shown is an example view of tdTomato+ neurons, labeled using rabbit anti-RFP, exhibiting enrichment of labeling at the edge of the cells (indicated by arrows). Co-labeling with vimentin as a satellite glial cell marker shows that this enrichment of tdTomato labeling is restricted to neurons and does not localize to adjacent satellite glial cell. SYTOX Deep Red was used as nuclear staining. Scale bar, 10 μm. Images are from a maximum intensity projection of 5 optical sections at 0.260 μm separation acquired using a 40x/1.3 objective and 24 μm pinhole.

SUPPLEMENTARY FIGURE S2

Co-localization of tdTomato and cell markers in DRGs from ThCreERT2; NaV1.8FlpO; Ai65 mice. Shown are example L3-5 DRG sections labeled for NeuN, CGRP, IB4 binding and NFH. Note lack of co-localization of tdTomato with the nociceptive markers CGRP and IB4 binding, as well as with the A fiber marker NFH. Scale bar is 50 μm, valid for all panels. Images are single optical sections obtained using a 20x/0.8 objective with pinholes of 24 μm (top left panel), 27 μm (top right and bottom left panels), or 32 μm (bottom right panel).

SUPPLEMENTARY FIGURE S3

tdTomato+ fibers and cells in the brains of ThCreERT2; NaV1.8FlpO; Ai65 and ThCreERT2; Ai14 mice. Shown are parasagittal brain sections displaying complete lack of tdTomato fluorescence in the brain of ThCreERT2;NaV1.8FlpO;Ai65 mice except for the nucleus of the solitary tracy (Sol) and very sparse fibers in trigeminal areas (top panel), and the expected wide distribution of catecholaminergic structures in ThCreERT2; Ai14 mice (bottom panel). Scale bar is 1 mm, valid for both panels. Images are widefield tilescan micrographs obtained using a 20x/0.5 objective.

References

  • 1

    AbrahamsenB.ZhaoJ.AsanteC. O.CendanC. M.MarshS.Martinez-BarberaJ. P.et al. (2008). The cell and molecular basis of mechanical, cold, and inflammatory pain. Science321, 702705. doi: 10.1126/science.1156916

  • 2

    AbrairaV. E.KuehnE. D.ChirilaA. M.SpringelM. W.ToliverA. A.ZimmermanA. L.et al. (2017). The cellular and synaptic architecture of the mechanosensory dorsal horn. Cell168, 295310.e19. doi: 10.1016/j.cell.2016.12.010

  • 3

    AkopianA. N.SivilottiL.WoodJ. N. (1996). A tetrodotoxin-resistant voltage-gated sodium channel expressed by sensory neurons. Nature379, 257262. doi: 10.1038/379257a0

  • 4

    BarryC. M.JiE.SharmaH.BeukesL.VilimasP. I.DeGraafY. C.et al. (2017). Morphological and neurochemical differences in peptidergic nerve fibers of the mouse vagina. J. Comp. Neurol.525, 23942410. doi: 10.1002/cne.24214

  • 5

    BoninR. P.BoriesC.De KoninckY. (2014). A simplified up-down method (SUDO) for measuring mechanical nociception in rodents using von Frey filaments. Mol. Pain10, 17101726. doi: 10.1186/1744-8069-10-26

  • 6

    BrechbühlJ.KlaeyM.BroilletM.-C. (2008). Grueneberg ganglion cells mediate alarm pheromone detection in mice. Science321, 10921095. doi: 10.1126/science.1160770

  • 7

    BuntingM.BernsteinK. E.GreerJ. M.CapecchiM. R.ThomasK. R. (1999). Targeting genes for self-excision in the germ line. Genes Dev.13, 15241528. doi: 10.1101/gad.13.12.1524

  • 8

    CongL.RanF. A.CoxD.LinS.BarrettoR.HabibN.et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science339, 819823. doi: 10.1126/science.1231143

  • 9

    DaigleT. L.MadisenL.HageT. A.ValleyM. T.KnoblichU.LarsenR. S.et al. (2018). A suite of transgenic driver and reporter mouse lines with enhanced brain-cell-type targeting and functionality. Cell174, 465480.e22. doi: 10.1016/j.cell.2018.06.035

  • 10

    DaouI.TuttleA. H.LongoG.WieskopfJ. S.BoninR. P.AseA. R.et al. (2013). Remote optogenetic activation and sensitization of pain pathways in freely moving mice. J. Neurosci.33, 1863118640. doi: 10.1523/jneurosci.2424-13.2013

  • 11

    DelfiniM.-C.MantilleriA.GaillardS.HaoJ.ReyndersA.MalapertP.et al. (2013). TAFA4, a chemokine-like protein, modulates injury-induced mechanical and chemical pain hypersensitivity in mice. Cell Rep.5, 378388. doi: 10.1016/j.celrep.2013.09.013

  • 12

    DjouhriL.FangX.OkuseK.WoodJ. N.BerryC. M.LawsonS. N. (2003). The TTX-resistant Sodium Channel Nav1.8 (SNS/PN3): expression and correlation with membrane properties in rat nociceptive primary afferent neurons. J. Physiol.550, 739752. doi: 10.1113/jphysiol.2003.042127

  • 13

    GautronL.SakataI.UditS.ZigmanJ. M.WoodJ. N.ElmquistJ. K. (2011). Genetic tracing of Nav1.8-expressing vagal afferents in the mouse. J. Comp. Neurol.519, 30853101. doi: 10.1002/cne.22667

  • 14

    HandlerA.GintyD. D. (2021). The mechanosensory neurons of touch and their mechanisms of activation. Nat. Rev. Neurosci.22, 521537. doi: 10.1038/s41583-021-00489-x

  • 15

    HoffmanB. U.BabaY.GriffithT. N.MosharovE. V.WooS. H.RoybalD. D.et al. (2018). Merkel cells activate sensory neural pathways through adrenergic synapses. Neuron100, 14011413.e6. doi: 10.1016/j.neuron.2018.10.034

  • 16

    HuzardD.MartinM.MaingretF.CheminJ.JeanneteauF.MeryP. F.et al. (2022). The impact of C-tactile low-threshold mechanoreceptors on affective touch and social interactions in mice. Sci. Adv.8:eabo7566. doi: 10.1126/sciadv.abo7566

  • 17

    KaczmarczykL.ReichenbachN.BlankN.JonsonM.DittrichL.PetzoldG. C.et al. (2021). Slc1a3-2A-CreERT2 mice reveal unique features of Bergmann glia and augment a growing collection of Cre drivers and effectors in the 129S4 genetic background. Sci. Rep.11:5412. doi: 10.1038/s41598-021-84887-2

  • 18

    KupariJ.ErnforsP. (2023). Molecular taxonomy of nociceptors and pruriceptors. Pain164, 12451257. doi: 10.1097/j.pain.0000000000002831

  • 19

    KupariJ.HäringM.AgirreE.Castelo-BrancoG.ErnforsP. (2019). An atlas of vagal sensory neurons and their molecular specialization. Cell Rep.27, 25082523.e4. doi: 10.1016/j.celrep.2019.04.096

  • 20

    LagerströmM. C.RogozK.AbrahamsenB.LindA.-L.ÖlundC.SmithC.et al. (2011). A sensory subpopulation depends on vesicular glutamate transporter 2 for mechanical pain, and together with substance P, inflammatory pain. Proc. Natl. Acad. Sci.108, 57895794. doi: 10.1073/pnas.1013602108

  • 21

    LarssonM.BromanJ. (2019). Synaptic organization of VGLUT3 expressing low-threshold mechanosensitive C fiber terminals in the rodent spinal cord. eNeuro6:ENEURO.0007-19.2019. doi: 10.1523/eneuro.0007-19.2019

  • 22

    LarssonM.NagiS. S. (2022). Role of C-tactile fibers in pain modulation: animal and human perspectives. Curr. Opin. Behav. Sci.43, 138144. doi: 10.1016/j.cobeha.2021.09.005

  • 23

    LiC.-L.LiK.-C.WuD.ChenY.LuoH.ZhaoJ.-R.et al. (2015). Somatosensory neuron types identified by high-coverage single-cell RNA-sequencing and functional heterogeneity. Cell Res.26, 83102. doi: 10.1038/cr.2015.149

  • 24

    LiL.RutlinM.Abraira VictoriaE.CassidyC.KusL.GongS.et al. (2011). The functional organization of cutaneous low-threshold mechanosensory neurons. Cell147, 16151627. doi: 10.1016/j.cell.2011.11.027

  • 25

    LökenL. S.WessbergJ.MorrisonI.McGloneF.OlaussonH. (2009). Coding of pleasant touch by unmyelinated afferents in humans. Nat. Neurosci.12, 547548. doi: 10.1038/nn.2312

  • 26

    MadisenL.ZwingmanT. A.SunkinS. M.OhS. W.ZariwalaH. A.GuH.et al. (2010). A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat. Neurosci.13, 133140. doi: 10.1038/nn.2467

  • 27

    MalapertP.RobertG.BrunetE.CheminJ.BourinetE.MoqrichA. (2024). A novel Na<sub>v</sub>1.8-FLPo driver mouse for intersectional genetics to uncover the functional significance of primary sensory neuron diversity. iScience27:109396. doi: 10.1016/j.isci.2024.109396

  • 28

    MenseS. (2010). “Peripheral mechanisms of muscle pain: response behavior of muscle nociceptors and factors eliciting local muscle pain” in Muscle pain: Understanding the mechanisms. eds. MenseS.GerwinR. D. (Berlin: Springer), 49103.

  • 29

    NassarM. A.StirlingL. C.ForlaniG.BakerM. D.MatthewsE. A.DickensonA. H.et al. (2004). Nociceptor-specific gene deletion reveals a major role for Nav1.7 (PN1) in acute and inflammatory pain. Proc. Natl. Acad. Sci.101, 1270612711. doi: 10.1073/pnas.0404915101

  • 30

    NeubarthN. L.EmanuelA. J.LiuY.SpringelM. W.HandlerA.ZhangQ.et al. (2020). Meissner corpuscles and their spatially intermingled afferents underlie gentle touch perception. Science368:abb2751. doi: 10.1126/science.abb2751

  • 31

    NguyenM. Q.WuY.BonillaL. S.von BuchholtzL. J.RybaN. J. P. (2017). Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One12:e0185543. doi: 10.1371/journal.pone.0185543

  • 32

    OlaussonH.LamarreY.BacklundH.MorinC.WallinB. G.StarckG.et al. (2002). Unmyelinated tactile afferents signal touch and project to insular cortex. Nat. Neurosci.5, 900904. doi: 10.1038/nn896

  • 33

    QiL.IskolsM.GreenbergR. S.XiaoJ. Y.HandlerA.LiberlesS. D.et al. (2024a). Krause corpuscles are genital vibrotactile sensors for sexual behaviours. Nature630, 926934. doi: 10.1038/s41586-024-07528-4

  • 34

    QiL.IskolsM.ShiD.ReddyP.WalkerC.LezgiyevaK.et al. (2024b). A mouse DRG genetic toolkit reveals morphological and physiological diversity of somatosensory neuron subtypes. Cell187, 15081526.e16. doi: 10.1016/j.cell.2024.02.006

  • 35

    SalioC.AimarP.MalapertP.MoqrichA.MerighiA. (2021). Neurochemical and ultrastructural characterization of unmyelinated non-peptidergic C-nociceptors and C-low threshold mechanoreceptors projecting to lamina II of the mouse spinal cord. Cell. Mol. Neurobiol.41, 247262. doi: 10.1007/s10571-020-00847-w

  • 36

    SchmidA.PyrskiM.BielM.Leinders-ZufallT.ZufallF. (2010). Grueneberg ganglion neurons are finely tuned cold sensors. J. Neurosci.30, 75637568. doi: 10.1523/jneurosci.0608-10.2010

  • 37

    SharmaN.FlahertyK.LezgiyevaK.WagnerD. E.KleinA. M.GintyD. D. (2020). The emergence of transcriptional identity in somatosensory neurons. Nature577, 392398. doi: 10.1038/s41586-019-1900-1

  • 38

    ShieldsS. D.AhnH. S.YangY.HanC.SealR. P.WoodJ. N.et al. (2012). Nav1.8 expression is not restricted to nociceptors in mouse peripheral nervous system. Pain153, 20172030. doi: 10.1016/j.pain.2012.04.022

  • 39

    StirlingC. L.ForlaniG.BakerM. D.WoodJ. N.MatthewsE. A.DickensonA. H.et al. (2005). Nociceptor-specific gene deletion using heterozygous NaV1.8-Cre recombinase mice. Pain113, 2736. doi: 10.1016/j.pain.2004.08.015

  • 40

    ToddA. J. (1996). GABA and glycine in synaptic glomeruli of the rat spinal dorsal horn. Eur. J. Neurosci.8, 24922498. doi: 10.1111/j.1460-9568.1996.tb01543.x

  • 41

    UsoskinD.FurlanA.IslamS.AbdoH.LönnerbergP.LouD.et al. (2015). Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci.18, 145153. doi: 10.1038/nn.3881

  • 42

    WillisW. D.Al-ChaerE. D.QuastM. J.WestlundK. N. (1999). A visceral pain pathway in the dorsal column of the spinal cord. Proc. Natl. Acad. Sci.96, 76757679. doi: 10.1073/pnas.96.14.7675

  • 43

    WuS.YingG.WuQ.CapecchiM. R. (2008). A protocol for constructing gene targeting vectors: generating knockout mice for the cadherin family and beyond. Nat. Protoc.3, 10561076. doi: 10.1038/nprot.2008.70

  • 44

    ZhangQ.LeeW.-C. A.PaulD. L.GintyD. D. (2019). Multiplexed peroxidase-based electron microscopy labeling enables simultaneous visualization of multiple cell types. Nat. Neurosci.22, 828839. doi: 10.1038/s41593-019-0358-7

  • 45

    ZhangD.TurecekJ.ChoiS.DelisleM.PamplonaC. L.MeltzerS.et al. (2024). C-LTMRs evoke wet dog shakes via the spinoparabrachial pathway. Science386, 686692. doi: 10.1126/science.adq8834

Summary

Keywords

pain, nociception, somatosensory system, primary afferent fibers, spinal cord, APEX2

Citation

Chen JCY, Kaczmarczyk L, Jackson WS and Larsson M (2025) A NaV1.8FlpO mouse enabling selective intersectional targeting of low threshold C fiber mechanoreceptors and nociceptors. Front. Mol. Neurosci. 18:1574219. doi: 10.3389/fnmol.2025.1574219

Received

10 February 2025

Accepted

12 May 2025

Published

03 June 2025

Volume

18 - 2025

Edited by

Volker Eulenburg, University of Augsburg, Germany

Reviewed by

Johannes Oberwinkler, University of Marburg, Germany

Myeounghoon Cha, Soonchunhyang University, Republic of Korea

Updates

Copyright

*Correspondence: Max Larsson,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics