Abstract
Odorant binding proteins (OBPs) enriched in the sensillum lymph are instrumental in facilitating the transfer of odorous molecules to the responsive receptors. In Orthopteran locust species, an in-depth understanding of this important soluble protein family is still elusive. In a previous study, we have demonstrated that the repertoire of locust OBPs can be divided into four major clades (I–IV) on the phylogenetic scale and for representatives of subfamily I-A and II-A a distinct sensilla-specific expression pattern was determined. In this study, by focusing on a representative locust species, the desert locust Schistocerca gregaria, we have explored the antennal topographic expression for representative OBPs of other subfamilies. First, subtypes of subfamily III-A and III-B were exclusively found in sensilla chaetica. Then, a similar expression pattern in this sensillum type was observed for subfamily I-B subtypes, but with a distinct OBP that was expressed in sensilla coeloconica additionally. Moreover, the atypical OBP subtype from subfamily IV-A was expressed in a subpopulation of sensilla coeloconica. Last, the plus-C type-B OBP subtype from subfamily IV-B seems to be associated with all four antennal sensillum types. These results profile diversified sensilla-specific expression patterns of the desert locust OBPs from different subfamilies and complex co-localization phenotypes of distinct OBP subtypes in defined sensilla, which provide informative clues concerning their possible functional mode as well as a potential interplay among OBP partners within a sensillum.
Introduction
Insects utilize hair-like cuticle appendages, so called sensilla, to receive environmental olfactory signals (; ; ). Hydrophobic odorous molecules have to travel through the aqueous sensillum lymph before reaching the receptors residing in the chemosensory membrane of olfactory neurons in the antennae (; ; ). This passage is supposed to be facilitated by odorant binding proteins (OBPs) in the sensillum lymph, an important soluble protein family that is capable to accommodate and transfer odorant molecules (; , ; ). OBPs are short polypeptides of approximately 110–200 amino acids that fold into a globular shape forming an interior binding cavity, where the interaction with odorous molecules takes place (; ). The sequence of classic OBPs is characterized by six conserved cysteine (C) residues, a hall mark of classic OBPs; plus-C or minus-C OBPs are categorized with more or less than six conserved C-residues (; ; ; ). OBPs are produced by auxiliary cells which envelope the sensory neurons by their extended processes. The enrichment of OBPs in the sensillum types that respond to olfactory cues has been reported for many insect species (, ). Beyond the olfactory sensilla, OBP expression has also been found in the sensilla that are seemingly dedicated to gustatory cues (; ). Incidentally, besides the sensilla-specific expression in the chemosensory organs, like the antennae, OBPs are also expressed in other tissues of which the functional connotations seem to be less associated with chemical communication ().
Schistocerca gregaria, the desert locust, represents a model organism of the Orthopteran order, which emerged much earlier than the Lepidopteran and Dipteran orders on the evolutionary scale (; ). Locusts are characterized by a hemimetabolous life circle and a population density dependent behavioral plasticity, which involves the perception of behavioral relevant semiochemicals (; ; ; ). For locust species an in-depth understanding of the OBP family from either molecular or cellular perspective is still elusive (; ; ; ; ). Previously, we have conducted a comprehensive sequence analysis of the OBP families from Schistocerca gregaria and three other locust species which classifies locust OBPs into several categories, e.g., classic, plus-C type-A, plus-C type-B, minus-C and atypical OBPs. Based on the phylogenetic relationship locust OBPs reside within four major phylogenetic clades. Concentrating on the two OBP subfamilies I-A and II-A, which comprise the classic OBP subtypes, we have found a characteristic sensilla-specific expression pattern for the desert locust OBP representatives in the antennae (). In the present study, we set out to explore the antennal topographic expression of desert locust OBPs from the remaining subfamilies on the phylogenetic tree.
Materials and Methods
Animals and Tissue Collection
The desert locust Schistocerca gregaria reared on the gregarious phase were purchased from Bugs-International GmbH (Irsingen/Unterfeld, Germany). Antennae of adult male and adult female were dissected using autoclaved surgical scissors and were immediately frozen in liquid nitrogen. Tissues were stored at -70°C before subsequent RNA extraction.
RNA Extraction and Reverse Transcription PCR (RT-PCR)
Total RNA was extracted from the frozen tissues using TRIzol reagent (Invitrogen) following the protocol recommended by the manufacturer. The poly (A)+ RNA was purified from 100 μg of total RNA using oligo (dT)25 magnetic dynabeads (Invitrogen) conforming to the recommendation of the supplier. The generated mRNA was reverse transcribed to cDNA in a total volume of 20 μl employing SuperScriptTM III Reverse Transcriptase (Invitrogen). PCR conditions used in RT-PCR experiments were: 94°C for 1 min 40 s, then 20 cycles with 94°C for 30 s, 60°C for 30 s and 72°C for 2 min, with a reduction in the annealing temperature by 0.5°C per cycle, which was followed by a further cycles (20 times) on the condition of the last cycling step (annealing temperature was 50°C) and a final extension step for 7 min at 72°C. The sense (s) and antisense (as) primer pairs used for amplification of the desert locust OBP coding sequences were:
OBP2 s, atggccagccattgccacgccacc
OBP2 as, ttctccggatttcctaaactccgc
OBP3 s, atgctgctggcagcccccgcaaagg
OBP3 as, ctttttcctgatcaagcatccacc
OBP4 s, cctgtggcgacacttggtggccg
OBP4 as, gcctttagccatcatcccctt
OBP7 s, cgatgtgcttcgtcggtgggtgat
OBP7 as, acgtcgttctcgtcggactctgga
OBP8 s, agactcgccaacccgccaca
OBP8 as, ttctgacggggcgtgtggga
OBP9 s, gccacagtccggtgcagcat
OBP9 as, aatctggtcgctgacgcact
OBP12 s, acaactcttgcagccatgaagtgg
OBP12 as, tccacttcttgttcccatactggt
OBP13 s, gagctgaggtaatgaagagggtca
OBP13 as, cctgcacattcagatccaagcagc
The primer pairs against other desert locust OBP subtypes were given in ().
Synthesis of Riboprobes for in Situ Hybridization
PCR products of the desert locust OBP coding sequences were sequenced and then cloned into pGEM-T vectors (Invitrogen) for the subsequent in vitro transcription. The linearized pGEM-T vectors consisting of desert locust OBP coding sequences were utilized to synthesize both sense and antisense riboprobes labeled with digoxigenin (Dig) or biotin (Bio) using the T7/SP6 RNA transcription system (Roche, Germany). The synthesis procedure stringently followed the protocol provided by the manufacturer.
In Situ Hybridization
Antennae of adult Schistocerca gregaria were dissected and embedded in Tissue-Tek O.C.T. Compound (Sakura Finetek Europe, Netherlands). Cryosections with a 12 μm-thickness were thaw mounted on SuperFrost Plus slides (Menzel-Gläser, Braunschweig, Germany) at -21°C (Jung CM300 cryostat). RNA In situ hybridization was performed as previously reported (; ; , ). In brief, the cryosections were firstly fixed (4% paraformaldehyde in 0.1 M NaHCO3, pH 9.5) at 4°C for 22 min, followed by a series of treatments at room temperature: a wash for 1 min in PBS (phosphate buffered saline = 0.85% NaCl, 1.4 mM KH2PO4, 8 mM Na2HPO4, pH 7.1), an incubation for 10 min in 0.2 M HCl, another wash for 1 min in PBS, an incubation for 10 min in acetylation solution (0.25% acetic anhydride freshly added in 0.1 M triethanolamine) and washes for three times in PBS (3 min each). Afterward, the sections were pre-hybridized for 1 h at 60°C bathed in hybridization buffer (50% formamide, 5x SSC, 50 μg/ml heparin, and 0.1% Tween-20). A volume of 150 μl hybridization solution containing experiment riboprobes in hybridization buffer was evenly applied onto the tissue section. A coverslip was placed on top and slides were incubated in a moister box at 60°C overnight (18–20 h). After hybridization, slides were washed twice for 30 min in 0.1x SSC at 60°C, then each slide was treated with 1 ml 1% blocking reagent (Roche) for 35 min at room temperature.
Visualization of Dig-labeled riboprobe hybridizations was achieved by using an anti-Dig alkaline phosphatase (AP) conjugated antibody (1:500, Roche) and NBT/BCIP as substrates. Antennal sections were analyzed on a Zeiss Axioskope2 microscope (Zeiss, Oberkochen, Germany) equipped with Axiovision software. For two-color fluorescent in situ hybridization visualization of hybridized riboprobes was performed by using an anti-Dig AP-conjugated antibody in combination with HNPP/Fast Red (Roche) for Dig-labeled probes and an streptavidin horse radish peroxidase-conjugate together with fluorescein-tyramides as substrate (TSA kit, Perkin Elmer, Waltham, MA, United States) for biotin-labeled probes. Tissue sections in two-color FISH experiments were analyzed with a Zeiss LSM510 Meta laser scanning microscope (Zeiss, Oberkochen, Germany), and the acquired confocal images stacks were processed by ZEN 2009 software. The images presented in this paper integrate the projections of a series of optical planes selected from continuous confocal image stacks. For clear data presentation, images were only adjusted in brightness and contrast. It is noted that the images obtained via the two-color FISH approach always contained the cuticle unspecifically stained, most likely due to the intrinsic fluorescence. To clarify the specific fluorescent labeling, a dashed line was added to indicate the interface between the cuticle and the cellular layers. Antennal sections of both male and female were analyzed under the same experimental conditions and were tested with each generated riboprobes. There were no discernible gender dependent differences regarding to the labeling intensity as well as the labeling pattern. Therefore, only the images acquired from male antenna sections were presented in this paper.
Results
Topographic Expression Patterns of OBP Subtypes From Clade I and III
A previously performed phylogenetic analysis of OBPs from four locust species revealed that the locust OBP family can be divided into four major clades consisting of three conserved subfamilies. For the two subfamilies I-A and II-A, which both comprise classic OBP subtypes, we found that the representative I-A subtypes are expressed in sensilla basiconica and sensilla trichodea, whereas the representative II-A subtypes are expressed in sensilla coeloconica (). In this study, we concentrated on the conserved subfamily III-A, which includes the plus-C type-A OBP subtypes that share only low sequence identities with the classic OBP subtypes. In order to explore their sensilla-specific expression pattern, we adopted the strategy of mRNA in situ hybridization and assessed the expression of OBP4, a representative subtype of subfamily III-A, in the four morphologically distinguishable types of antennal sensilla. The results of these approaches revealed a discernible labeling of OBP4 expressing cells in sensilla chaetica; no labeling was visible in any of the other three sensillum types (Figure 1A). Apart from the subfamily III-A, clade III also comprises subfamily III-B, which includes the classic OBP subtype OBP8 and its orthologs. Analysis of the expression pattern revealed that OBP8-positive cells were also exclusively enriched in sensilla chaetica, thus resembling the plus-C type-A subtype OBP4 (Figure 1A). Together, these results imply that OBP subtypes of the clade III are specifically expressed in sensilla chaetica and thus deviate from the distribution of OBP subtypes from subfamilies I-A and II-A ().
FIGURE 1
In view of a clade-specific spatial expression pattern as seen for clade III (see above) it is interesting to note that clade I comprises, besides the conserved subfamily I-A, the more divergent subfamily I-B (Supplementary Figure S1). Since representatives of subfamily I-A were found to be restricted to sensilla basiconica and trichodea (Figure 1B) (), the question arises, whether OBPs of subfamily I-B may also be expressed in the same sensillum types. To scrutinize this notion, we have analyzed OBP2 and OBP7, the two subtypes in subfamily I-B. The results are depicted in Figure 1B and indicate that labeling for OBP2 and OBP7 was neither found in sensilla basiconica nor in sensilla trichodea; however, the labeling was present in sensilla chaetica and for OBP2 the labeled cells were concomitantly visible in sensilla coeloconica (Figure 1B). These data indicate that the topographic distribution of subfamily I-B OBPs clearly deviate from that of their counterparts of subfamily I-A and demonstrate that there is no clade-specific spatial expression pattern for members of clade I.
Previous anatomical studies have shown that sensilla chaetica are highly enriched at the tip of the antennae, a region with relatively few of the other three sensillum types (). This spatial segregation of sensilla chaetica allows a more detailed analysis of the four identified OBP subtypes in this sensillum type. As shown in Figure 1C, numerous labeled cells were visualized using the probes for OBP4 (subfamily III-A), OBP8 (subfamily III-B) as well as OBP2 and OBP7 (subfamily I-B). In contrast, with the riboprobes for OBP subtypes that are specifically expressed in other sensillum types, such as OBP5 (subfamily I-A) and OBP11 (subfamily II-A), no discernible labeling was found at the antennal tip (Figure 1C).
Co-localization of OBP Subtypes From Different Subfamilies in Sensilla Chaetica
Since the four OBP subtypes reside in two different phylogenetic clades, we ask whether the different OBP subtypes are present in the same set of cells or in distinct cell populations of sensilla chaetica. To approach this question, we have generated either DIG- or BIO-labeled riboprobes for each OBP subtype and by means of two-color FISH analysis we have visualized the relative topographic localization of the labeled cells (Figure 2). In a first step, we have analyzed the subtypes from the same phylogenetic clade. For the two subtypes from clade III, OBP4 and OBP8, a widely overlapped labeling was found indicating that they were co-localized in the same set of cells in many, if not all, inspected sensilla chaetica (Figure 2A). Analysis for the two subtypes from subfamily I-B, OBP2 and OBP7, also revealed a largely overlapped labeling (Figure 2A). These results suggest that within clade III and subfamily I-B OBP subtypes are generally expressed in the same set of cells in sensilla chaetica. In a next step, we explored whether OBP subtypes from different clades may either be expressed in the same or a different set of cells. For the member of subfamily III-A (OBP4) and the members of subfamily I-B (OBP2 and OBP7) a largely overlapping labeling was observed (Figure 2B). However, for the member of subfamily III-B (OBP8) and the members of subfamily I-B (OBP2 and OBP7) no labeling overlap was found (Figure 2C). While labeling for OBP2 and OBP8 was found in different sets of cells of the same sensillum chaeticum, interestingly, OBP7 seemed to be present in the cells of distinct sensilla chaetica which differ from sensilla with OBP8-positive cells (Figure 2C). These results emphasize the complex co-localization relationship among OBP2, OBP4, and OBP8. The notion that OBP4 and OBP8 may be separately expressed in a subset of sensilla chaetica was confirmed upon a comprehensive inspection of the labeling for OBP4 and OBP8 (Supplementary Figure S2), indicating a broader expression scope for OBP4 in certain sensilla chaetica. In sum, the results indicate that sensilla chaetica express OBP subtypes from more than one phylogenetic clade, and co-localization of the OBP subtypes in distinct sensilla subtypes occurs in a combinatorial mode.
FIGURE 2
OBP2, Member of Subfamily I-B, Is Expressed in Sensilla Coeloconica and Chaetica
The results depicted in Figure 1 indicate that OBP2, a subtype of subfamily I-B, may not only be expressed in sensilla chaetica (see above) but also in sensilla coeloconica. To substantiate the observation that OBP2 is in fact expressed in sensilla coeloconica, we utilized IR8a, the co-receptor of divergent IRs (; ), as a specific marker of sensory neurons housed in sensilla coeloconica. The results of double labeling experiments indicate that labeled OBP2 cells are tightly surrounding IR8a-positive cells in sensilla coeloconica (Figure 3). Given that in sensilla coeloconica OBP subtypes of subfamily II-A are specifically expressed, the question arises as to whether OBP2, a member of subfamily I-B, may be co-expressed with OBP subtypes of subfamily II-A. As representatives for subfamily II-A OBP10 and OBP14 were investigated. The results depicted in Figure 3 indicate that the labeling for OBP2 indeed overlapped with that for the subfamily II-A representatives, indicating that in a set of sensilla coeloconica OBP subtypes from subfamily I-B and subfamily II-A coexist. Furthermore, the results confirm that OBP2 is in fact present in the two types of sensilla, sensilla coeloconica and sensilla chaetica.
FIGURE 3
Topographic Expression Pattern of an Atypical OBP Subtype From Subfamily IV-A
The atypical OBP subtypes converge onto the subfamily IV-A (Supplementary Figure S1) and are characterized by an extraordinary long span between C1 and C2 in comparison to the classic OBP subtypes (). This unique feature has raised the question whether atypical OBP subtypes may be expressed in specific sensillum types and/or in distinct cell populations. To approach this question, we have analyzed the expression pattern of OBP12, a subtype of subfamily IV-A. The results of labeling experiments are depicted in Figure 4A and indicate that OBP12 expressing cells were exclusively located in sensilla coeloconica. The sensilla specificity was subsequently confirmed by demonstrating the co-localization of OBP12 expressing cells and IR8a-positive cells in one sensillum coeloconicum (Figure 4A). Since OBPs of subfamily II-A are specifically expressed in sensilla coeloconica, we explored whether OBP12 may be co-localized with OBPs of subfamily II-A. Intriguingly, we found that the labeling for OBP12 cells did not overlap with the cells positive for OBP10 or OBP14 (Figure 4B), suggesting that OBP12 is expressed in a distinct subset of sensilla coeloconica.
FIGURE 4
It is yet unclear how many IR8a-positive neurons are surrounded by the auxiliary cells that express OBPs of subfamily II-A. To scrutinize this notion, double labeling experiments were performed with a probe for IR8a and a mix of riboprobes for OBP10, OBP11 and OBP14, which represent the three ortholog groups in subfamily II-A (Supplementary Figure S1). The results depicted in Figure 4C indicate that a considerable portion of IR8a-positive cells are engulfed by cells expressing OBPs of subfamily II-A (ovals in dash line). The remaining fraction of IR8a neurons seems to express non-II-A OBP subtypes, possibly OBP12. Together the results indicate that the atypical OBP subtype OBP12 is expressed in a segregated population of sensilla coeloconica.
Topographic Expression and Sensillum-Association of a Plus-C Type-B OBP Subtype
We have previously distinguished two categories of the plus-C OBPs based on the distinct conserved-C-patterns (). While the type-A OBP subtypes are grouped into the subfamily III-A, the type-B OBP subtypes are grouped into the subfamily IV-B (Supplementary Figure S1). Whereas type-A OBPs are expressed in sensilla chaetica (Figure 1), the expression pattern of type-B OBP subtypes is unclear. It is possible that the type-B OBPs share the sensilla specificity either with their close relatives in subfamily IV-A, e.g., OBP12, or with their type-A counterparts in subfamily III-A, e.g., OBP4. To approach this question, we have used a specific riboprobe for OBP9, a representative plus-C type-B subtype and assessed series of horizontal sections through the antennae. Upon an inspection of a deep anatomical plane close to the antennal nerve bundle, we found labeled structures for OBP9 which seemed to be less associated with a specific sensillum type, as typically found for the other OBP subtypes (Figures 1, 3, 4). Nevertheless, labeled cell bodies seemed to extend cytoplasmic processes which enclosed sensory neurons (Figure 5A). Interestingly, when we inspected an anatomical plane located closer to the cuticle, a more intense labeling was observed and a distinct nest-like labeling pattern for OBP9 emerged (Figure 5B).
FIGURE 5
The notion that OBP9 labeling seems to be associated with multiple sensillum types was scrutinized by analyzing a possible co-localization of OBP9 labeling with markers for distinct neuron types. In a first approach, Orco, the obligate co-receptor of ORs, was used to label the multiple sensory neurons in sensilla basiconica (). It was found that OBP9 cells tightly surrounded the Orco-positive neuron clusters (Figure 6). Similarly, OR3 was used as a marker for sensilla trichodea and IR8a was used as a marker for sensilla coeloconica; it was observed that OBP9 labeling engulfed OR3- and IR8a- expressing neurons (Figure 6). OBP8 is considered to be specific for sensilla chaetica (Figure 1) and the results of double labeling experiments with OBP9 and OBP8 clearly indicated a co-localization (Figure 6). Together, these results indicate an association of the plus-C type-B OBP9 with all four antennal sensillum types.
FIGURE 6
Discussion
Insects have evolved sensilla that are diversified in the external morphology as well as in the repertoire of molecular elements to act as versatile communication channels for environmental chemical signals (; ; ). OBPs are considered to play an important role toward this task due to their capacity to accommodate and transfer odorous molecules. The present study, in conjunction with our previous work (), has concentrated on this important class of soluble proteins in the locust species Schistocerca gregaria, trying to decipher the principles how the multiple OBP subtypes are allocated among and within different sensillum types present on the locust antennae. The findings of this study revealed that subtypes of the desert locust OBP family display a diversified sensilla-specific expression profile and a complex co-localization phenotype in defined sensilla (Figure 7). Uncovering the sensillar and cellular organization pattern of distinct locust OBP subtypes may allow a first glimpse on their putative functional role as well as their potential interplay with distinct co-partners.
FIGURE 7
Our results indicate that several OBP subtypes from two phylogenetic clades are expressed in sensilla chaetica (Figure 1). A plus-C type-A subtype together with three classic subtypes were found to be co-expressed in a set of sensilla chaetica (Figure 2); this scenario is reminiscent of what was previously reported for sensilla trichodea of Anopheles gambiae (). Sensilla chaetica are characterized by distinct structural features, such as a thick and poreless cuticle wall, an apical pore and relatively few dendrites (; Zhou et al., 2009); consequently, sensilla chaetica are considered as relevant for the reception of gustatory tastants rather than odorants. For the fruit fly this view was supported by extracellular recordings, calcium imaging and behavioral assays (; ; ). This view may also hold true for sensilla chaetica in locusts which are enriched on the tip of the antennae and palps (; ) and are proposed with a receptive role of contact stimuli (, ; ). Thus, the presence of four OBP subtypes in sensilla chaetica on the tip of the antennae (Figure 1) suggests that these OBPs may be tuned to mediate the reception of gustatory stimuli. This view would be analogous to the finding for Drosophila melanogaster where OBP subtypes expressed in gustatory sensilla are involved in the reception of tastants (). This is further supported by a recent study demonstrating that knock-down of a sensilla chaetica-specific OBP subtype in Locusta migratoria caused a reduced neuronal response to chemical stimuli (). This finding further supports the notion that OBPs are intimately involved in detecting chemical compounds via sensilla chaetica. Intriguingly, it has been reported that the sensilla chaetica of locust, as well as contact sensilla of other insect species, have a sensillum lymph cavity which is separated into an inner and outer compartment (; ; Zhou et al., 2009). In a recent study, the labeling for an OBP subtype in Locusta migratoria was mainly observed in the non-innervated outer lumen, but not in the inner sensillum lymph which baths the chemosensory dendrites (); this observation has led to speculations of how the cognitive ligands may reach the chemosensory dendrites. The discovery that four distinct OBP subtypes are expressed in this sensillum type (Figures 1, 2) opens the door for revisiting this aspect in more detail.
Distinct OBP subtypes from three phylogenetic clades were found to be expressed in sensilla coeloconica (Figures 1, 3, 4) (). Whereas OBP representatives from subfamily II-A (Figure 4) together with OBP2 (Supplementary Figure S3) were found in the majority of this sensillum type, the atypical OBP subtype OBP12 from subfamily IV-A was present in a subpopulation of sensilla coeloconica. This observation seems to coincide with a previous finding that apart from a receptive role for leaf odors and organic acids (), a subset of sensilla coeloconica in locusts appears to be responsive to hygro- or thermo- stimuli (). Such a functional versatility of this sensillum type may be based on distinct sets of cells equipped with specific receptors in combination with appropriate co-partners, e.g., OBP12. Remarkably, the atypical OBP subtype OBP12 belongs to the OBP gene family OBP59a, which is conserved in many insect species, except in Hymenoptera (). For Drosophila melanogaster it has recently been shown that OBP59a is specifically expressed in sensilla coeloconica (), similar to its counterpart in the desert locust (Figure 4).
An unexpected finding of this study is the expression of OBP2 in two types of sensilla, sensilla coeloconica and sensilla chaetica (Figures 1, 3). The two types of sensilla differ markedly in their external morphology and their functional implications(; ; ; ). On the other hand, in both sensillum types some common chemosensory genes are expressed, most notably the ionotropic receptor type IR25a, one of the co-receptors of divergent IRs (; ). Exploring the functional mode of IR25a in Drosophila melanogaster has recently uncovered a multidimensional role for this receptor type () and it is conceivable that such a versatile function may also be assigned to the OBPs. In fact, it has been proposed that OBPs may be involved in quite different functions (, , ). In this regard, the observation that OBP2 is always accompanied by a set of other OBP subtypes in a sensillum (Figures 2, 3) may indicate that OBP2 operates in concert with other OBPs to fulfill the distinct functions conferred to the two types of sensilla.
One of the novel finding of this study was the discovery that the plus-C type-B subtype OBP9 is associated with the four antennal sensillum types. Although the functional implication of such a broad sensillum-association is unknown, one could imagine that OBP9, as an ubiquitous OBP, may contribute a general component for the interplay of co-localized OBP partners. Indeed, an interaction of OBP subtypes has been documented in mosquito species and the OBP complex showed a broader ligand spectrum (). This aspect may be of particular interest in view of the finding that in locust sensilla basiconica, with a large set of OR subtypes (; ), only a small set of OBPs is expressed (Figure 7). However, it can also not be excluded that OBP9 may be involved in quite different functions. In this context, it is interesting to note that in cockroach and honeybee, the chemosensory proteins, another important class of small soluble proteins, are involved in regulating tissue regeneration and embryonic development (; ; ). Given such a broad sensillum-association, OBP9 may be involved in some general processes, such as development and/or survival of the auxiliary cells.
Statements
Author contributions
HB, JK, XJ, and PP: current study conception. XJ and MR: experiments conduction and the data acquisition. HB, JK, XJ, and PP: results interpretation. XJ and PP: preliminary manuscript composition. HB and JK: refinement and approval of final manuscript.
Funding
XJ was funded by a grant from China Scholarship Council (CSC) with the grant number 201406350032.
Acknowledgments
We thank Heidrun Froß for her excellent technical assistance. We also thank Prof. Jörg Strotmann and Dr. Patricia Widmayer for their constructive suggestions to improve the manuscript.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphys.2018.00417/full#supplementary-material
FIGURE S1Classification of different subfamilies of locust OBPs. The phylogenetic tree shown was adapted from a previous study analyzing phylogenetic relationship of OBP families from four locust species (). The branches colored in red, green, blue, and magenta represent the clade I, II, III, and IV, respectively. The classification of the subfamily I-A, II-A, and III-A was based on emergence of a higher bootstrap values on the inner divergent nodes, while other subfamilies were categorized by the emerging topologies. The subtypes belonging to desert locust OBPs were colored and denoted accordingly.
FIGURE S2A subset of sensilla chaetica selectively express OBP4 but not OBP8. Cells expressing the respective genes were visualized by using antisense riboprobes specifically targeting OBP4 and OBP8 and by means of two-color FISH. The position of cell clusters visualized by the DIG-labeled OBP4 probe (red) was delineated by dashed lines and is indicated in the images showing the OBP8 labeling and the merge of red and green fluorescence channels, respectively. Notably, no OBP8 labeling was detected. The interface between the cuticle and cellular layer is depicted by a white dashed line. Ch, sensilla chaetica; Ba, sensilla basiconica. Scale bar, 20 μm.
FIGURE S3OBP2 and OBP12 are expressed in different cells in sensilla coeloconica (co). Specific antisense riboprobes against OBP2 and OBP12 were used to visualize the expressing cells by means of two-color FISH. The interface between the cuticle and the cellular layer is depicted by a white dashed line. Scale bar, 20 μm.
References
1
AbuinL.BargetonB.UlbrichM. H.IsacoffE. Y.KellenbergerS.BentonR. (2011). Functional architecture of olfactory ionotropic glutamate receptors.Neuron6944–60. 10.1016/j.neuron.2010.11.042
2
AltnerH.RoutilC.LoftusR. (1981). The structure of bimodal chemo-, thermo-, and hygroreceptive sensilla on the antenna of Locusta migratoria.Cell Tissue Res.215289–308. 10.1007/BF00239116
3
BanL.ScaloniA.D’AmbrosioC.ZhangL.YahnY.PelosiP. (2003). Biochemical characterization and bacterial expression of an odorant-binding protein from Locusta migratoria.Cell. Mol. Life Sci.60390–400. 10.1007/s000180300032
4
BlaneyW. M. (1974). Electrophysiological responses of the terminal sensilla on the maxillary palps of Locusta migratoria (L.) to some electrolytes and non-electrolytes.J. Exp. Biol.60275–293.
5
BlaneyW. M. (1975). Behavioural and electrophysiological studies of taste discrimination by the maxillary palps of larvae of Locusta migratoria (L.).J. Exp. Biol.62555–569.
6
BlaneyW. M.ChapmanR. F. (1969). The fine structure of the terminal sensilla on the maxillary palps of Schistocerca gregaria (Forskål) (Orthoptera, Acrididae).Z. Zellforsch Mikrosk. Anat.9974–97. 10.1007/BF00338799
7
ChenY.AmreinH. (2017). Ionotropic receptors mediate Drosophila oviposition preference through sour gustatory receptor neurons.Curr. Biol.272741–2750.e4. 10.1016/j.cub.2017.08.003
8
ChengD.LuY.ZengL.LiangG.HeX. (2015). Si-CSP9 regulates the integument and moulting process of larvae in the red imported fire ant, Solenopsis invicta.Sci. Rep.5:9245. 10.1038/srep09245
9
ForetS.MaleszkaR. (2006). Function and evolution of a gene family encoding odorant binding-like proteins in a social insect, the honey bee (Apis mellifera).Genome Res.161404–1413. 10.1101/gr.5075706
10
GalindoK.SmithD. P. (2001). A large family of divergent Drosophila odorant-binding proteins expressed in gustatory and olfactory sensilla.Genetics1591059–1072.
11
GuoM.KriegerJ.Große-WildeE.MißbachC.ZhangL.BreerH. (2013). Variant ionotropic receptors are expressed in olfactory sensory neurons of coeloconic sensilla on the antenna of the desert locust (Schistocerca gregaria).Int. J. Biol. Sci.101–14. 10.7150/ijbs.7624
12
GuoW.WangX.MaZ.XueL.HanJ.YuD.et al (2011). CSP and takeout genes modulate the switch between attraction and repulsion during behavioral phase change in the migratory locust.PLoS Genet.7:e1001291. 10.1371/journal.pgen.1001291
13
HanssonB. S.StensmyrM. C. (2011). Evolution of insect olfaction.Neuron72698–711. 10.1016/j.neuron.2011.11.003
14
HassanaliA.NjagiP. G. N.BashirM. O. (2005). Chemical ecology of locust and related acridids.Annu. Rev. Entomol.50223–245. 10.1146/annurev.ento.50.071803.130345
15
JeongY. T.ShimJ.OhS. R.YoonH. I.KimC. H.MoonS. J.et al (2013). An odorant-binding protein required for suppression of sweet taste by bitter chemicals.Neuron79725–737. 10.1016/j.neuron.2013.06.025
16
JiangQ. Y.WangW. X.ZhangZ.ZhangL. (2009). Binding specificity of locust odorant binding protein and its key binding site for initial recognition of alcohols.Insect Biochem. Mol. Biol.39440–447. 10.1016/j.ibmb.2009.04.004
17
JiangX.KriegerJ.BreerH.PregitzerP. (2017). Distinct subfamilies of odorant binding proteins in locust (Orthoptera, Acrididae): molecular evolution, structural variation, and sensilla-specific expression.Front. Physiol.8:734. 10.3389/fphys.2017.00734
18
JiangX.PregitzerP.Grosse-WildeE.BreerH.KriegerJ. (2016). Identification and characterization of two “sensory neuron membrane proteins” (SNMPs) of the desert locust, Schistocerca gregaria (Orthoptera: Acrididae).J. Insect Sci.16:33. 10.1093/jisesa/iew015
19
JinX.BrandazzaA.NavarriniA.BanL.ZhangS.SteinbrechtR. A.et al (2005). Expression and immunolocalisation of odorant-binding and chemosensory proteins in locusts.Cell. Mol. Life Sci.621156–1166. 10.1007/s00018-005-5014-6
20
JosephR. M.CarlsonJ. R. (2015). Drosophila chemoreceptors: a molecular interface between the chemical world and the brain.Trends Genet.31683–695. 10.1016/j.tig.2015.09.005
21
LarterN. K.SunJ. S.CarlsonJ. R. (2016). Organization and function of Drosophila odorant binding proteins.eLife5:e20242. 10.7554/eLife.20242
22
LealW. S. (2013). Odorant reception in insects: roles of receptors, binding proteins, and degrading enzymes.Annu. Rev. Entomol.58373–391. 10.1146/annurev-ento-120811-153635
23
MaleszkaJ.ForêtS.SaintR.MaleszkaR. (2007). RNAi-induced phenotypes suggest a novel role for a chemosensory protein CSP5 in the development of embryonic integument in the honeybee (Apis mellifera).Dev. Genes Evol.217189–196. 10.1007/s00427-006-0127-y
24
MontellC. (2009). A taste of the Drosophila gustatory receptors.Curr. Opin. Neurobiol.19345–353. 10.1016/j.conb.2009.07.001
25
NomuraA.KawasakiK.KuboT.NatoriS. (1992). Purification and localization of p10, a novel protein that increases in nymphal regenerating legs of Periplaneta americana (American cockroach).Int. J. Dev. Biol.36391–398. 10.1387/IJDB.1445782
26
OchiengS. A.HallbergE.HanssonB. S. (1998). Fine structure and distribution of antennal sensilla of the desert locust, Schistocerca gregaria (Orthoptera: Acrididae).Cell Tissue Res.291525–536. 10.1007/s004410051022
27
OchiengS. A.HanssonB. S. (1999). Responses of olfactory receptor neurones to behaviourally important odours in gregarious and solitarious desert locust, Schistocerca gregaria.Physiol. Entomol.2428–36. 10.1046/j.1365-3032.1999.00107.x
28
PelosiP.IovinellaI.FelicioliA.DaniF. R. (2014). Soluble proteins of chemical communication: an overview across arthropods.Front. Physiol.5:320. 10.3389/fphys.2014.00320
29
PelosiP.IovinellaI.ZhuJ.WangG.DaniF. R. (2017). Beyond chemoreception: diverse tasks of soluble olfactory proteins in insects.Biol. Rev.93184–200. 10.1111/brv.12339
30
PelosiP.ZhouJ. J.BanL. P.CalvelloM. (2006). Soluble proteins in insect chemical communication.Cell. Mol. Life Sci.631658–1676. 10.1007/s00018-005-5607-0
31
PenerM. P.YerushalmiY. (1998). The physiology of locust phase polymorphism: an update.J. Insect Physiol.44365–377. 10.1016/S0022-1910(97)00169-8
32
PregitzerP.JiangX.Grosse-WildeE.BreerH.KriegerJ.FleischerJ. (2017). In search for pheromone receptors: certain members of the odorant receptor family in the desert locust Schistocerca gregaria (Orthoptera: Acrididae) are co-expressed with SNMP1.Int. J. Biol. Sci.13911–922. 10.7150/ijbs.18402
33
QiaoH.HeX.SchymuraD.BanL.FieldL.DaniF. R.et al (2011). Cooperative interactions between odorant-binding proteins of Anopheles gambiae.Cell. Mol. Life Sci.681799–1813. 10.1007/s00018-010-0539-8
34
RimalS.LeeY. (2018). The multidimensional ionotropic receptors of Drosophila melanogaster.Insect Mol. Biol.271–7. 10.1111/imb.12347
35
RytzR.CrosetV.BentonR. (2013). Ionotropic receptors (IRs): chemosensory ionotropic glutamate receptors in Drosophila and beyond.Insect Biochem. Mol. Biol.43888–897. 10.1016/j.ibmb.2013.02.007
36
SainiR. K.RaiM. M.HassanaliA.WawiyeJ.OdongoH. (1995). Semiochemicals from froth of egg pods attract ovipositing female Schistocerca gregaria.J. Insect Physiol.41711–716. 10.1016/0022-1910(95)00016-N
37
SandlerB. H.NikonovaL.LealW. S.ClardyJ. (2000). Sexual attraction in the silkworm moth: structure of the pheromone-binding-protein-bombykol complex.Chem. Biol.7143–151. 10.1016/S1074-5521(00)00078-8
38
SchultzeA.PregitzerP.WalterM. F.WoodsD. F.MarinottiO.BreerH.et al (2013). The co-expression pattern of odorant binding proteins and olfactory receptors identify distinct trichoid sensilla on the antenna of the malaria mosquito Anopheles gambiae.PLoS One8:e69412. 10.1371/journal.pone.0069412
39
ScottK. (2018). Gustatory processing in Drosophila melanogaster.Annu. Rev. Entomol.6315–30. 10.1146/annurev-ento-020117-043331
40
ShanbhagS. R.Hekmat-ScafeD.KimM. S.ParkS. K.CarlsonJ. R.PikielnyC.et al (2001). Expression mosaic of odorant-binding proteins in Drosophila olfactory organs.Microsc. Res. Tech.55297–306. 10.1002/jemt.1179
41
SteinbrechtR. A. (1996). Structure and function of insect olfactory sensilla.Ciba Found. Symp.200158–174. 10.1002/9780470514948.ch13
42
SuhE.BohbotJ. D.ZwiebelL. J. (2014). Peripheral olfactory signaling in insects.Curr. Opin. Insect Sci.686–92. 10.1016/j.cois.2014.10.006
43
TegoniM.CampanacciV.CambillauC. (2004). Structural aspects of sexual attraction and chemical communication in insects.Trends Biochem. Sci.29257–264. 10.1016/j.tibs.2004.03.003
44
VieiraF. G.RozasJ. (2011). Comparative genomics of the odorant-binding and chemosensory protein gene families across the Arthropoda: origin and evolutionary history of the chemosensory system.Genome Biol. Evol.3476–490. 10.1093/gbe/evr033
45
VogtR. G.CallahanF. E.RogersM. E.DickensJ. C. (1999). Odorant binding protein diversity and distribution among the insect orders, as indicated by LAP, an OBP-related protein of the true bug Lygus lineolaris (Hemiptera, heteroptera).Chem. Senses24481–495. 10.1093/chemse/24.5.481
46
VogtR. G.Große-WildeE.ZhouJ. J. (2015). The Lepidoptera odorant binding protein gene family: gene gain and loss within the GOBP/PBP complex of moths and butterflies.Insect Biochem. Mol. Biol.62142–153. 10.1016/j.ibmb.2015.03.003
47
VogtR. G.RiddifordL. M. (1981). Pheromone binding and inactivation by moth antennae.Nature293161–163. 10.1038/293161a0
48
WangX.KangL. (2014). Molecular mechanisms of phase change in locusts.Annu. Rev. Entomol.59225–244. 10.1146/annurev-ento-011613-162019
49
WangZ.YangP.ChenD.JiangF.LiY.WangX.et al (2015). Identification and functional analysis of olfactory receptor family reveal unusual characteristics of the olfactory system in the migratory locust.Cell. Mol. Life Sci.724429–4443. 10.1007/s00018-015-2009-9
50
WheelerW. C.WhitingM.WheelerQ. D.CarpenterJ. M. (2001). The phylogeny of the extant Hexapod orders.Cladistics17113–169. 10.1111/j.1096-0031.2001.tb00115.x
51
XuP. X.ZwiebelL. J.SmithD. P. (2003). Identification of a distinct family of genes encoding atypical odorant-binding proteins in the malaria vector mosquito, Anopheles gambiae.Insect Mol. Biol.12549–560. 10.1046/j.1365-2583.2003.00440.x
52
XuY. L.HeP.ZhangL.FangS. Q.DongS. L.ZhangY. J.et al (2009). Large-scale identification of odorant-binding proteins and chemosensory proteins from expressed sequence tags in insects.BMC Genomics10:632. 10.1186/1471-2164-10-632
53
YangY.KriegerJ.ZhangL.BreerH. (2012). The olfactory co-receptor Orco from the migratory locust (Locusta migratoria) and the desert locust (Schistocerca gregaria): identification and expression pattern.Int. J. Biol. Sci.8159–170. 10.7150/ijbs.8.159
54
YuF.ZhangS.ZhangL.PelosiP. (2009). Intriguing similarities between two novel odorant-binding proteins of locusts.Biochem. Biophys. Res. Commun.385369–374. 10.1016/j.bbrc.2009.05.074
55
ZhangL.LiH.ZhangL. (2017). Two olfactory pathways to detect aldehydes on locust mouthpart.Int. J. Biol. Sci.13759–771. 10.7150/ijbs.19820
56
ZhouJ. J.HuangW.ZhangG. A.PickettJ. A.FieldL. M. (2004). ‘Plus-C’ odorant-binding protein genes in two Drosophila species and the malaria mosquito Anopheles gambiae.Gene327117–129. 10.1016/j.gene.2003.11.007
57
ZhouS. H.ZhangS. G.ZhangL. (2009). The chemosensilla on tarsi of locusta migratoria (Orthoptera: Acrididae): distribution, ultrastructure, expression of chemosensory proteins.J. Morphol.2701356–1363. 10.1002/jmor.10763
Summary
Keywords
locust, Schistocerca gregaria, odorant binding protein, sensilla, topographic expression
Citation
Jiang X, Ryl M, Krieger J, Breer H and Pregitzer P (2018) Odorant Binding Proteins of the Desert Locust Schistocerca gregaria (Orthoptera, Acrididae): Topographic Expression Patterns in the Antennae. Front. Physiol. 9:417. doi: 10.3389/fphys.2018.00417
Received
28 February 2018
Accepted
04 April 2018
Published
17 April 2018
Volume
9 - 2018
Edited by
Shuang-Lin Dong, Nanjing Agricultural University, China
Reviewed by
Paolo Pelosi, Università degli Studi di Pisa, Italy; Jin Zhang, Max Planck Institute for Chemical Ecology (MPG), Germany
Updates
Copyright
© 2018 Jiang, Ryl, Krieger, Breer and Pregitzer.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Xingcong Jiang, jiangxingcong@126.com Pablo Pregitzer, p_pregitzer@uni-hohenheim.de
This article was submitted to Invertebrate Physiology, a section of the journal Frontiers in Physiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.