ORIGINAL RESEARCH article

Front. Physiol., 26 February 2019

Sec. Avian Physiology

Volume 10 - 2019 | https://doi.org/10.3389/fphys.2019.00126

Gene Expression Essential for Myostatin Signaling and Skeletal Muscle Development Is Associated With Divergent Feed Efficiency in Pedigree Male Broilers

  • 1. Department of Poultry Science, Center of Excellence for Poultry Science, University of Arkansas, Fayetteville, AR, United States

  • 2. Adisseo USA, Alpharetta, GA, United States

Abstract

Background: Feed efficiency (FE, gain to feed) is an important genetic trait as 70% of the cost of raising animals is due to feed costs. The objective of this study was to determine mRNA expression of genes involved in muscle development and hypertrophy, and the insulin receptor-signaling pathway in breast muscle associated with the phenotypic expression of FE.

Methods: Breast muscle samples were obtained from Pedigree Male (PedM) broilers (8 to 10 week old) that had been individually phenotyped for FE between 6 and 7 week of age. The high FE group gained more weight but consumed the same amount of feed compared to the low FE group. Total RNA was extracted from breast muscle (n = 6 per group) and mRNA expression of target genes was determined by real-time quantitative PCR.

Results: Targeted gene expression analysis in breast muscle of the high FE phenotype revealed that muscle development may be fostered in the high FE PedM phenotype by down-regulation several components of the myostatin signaling pathway genes combined with upregulation of genes that enhance muscle formation and growth. There was also evidence of genetic architecture that would foster muscle protein synthesis in the high FE phenotype. A clear indication of differences in insulin signaling between high and low FE phenotypes was not apparent in this study.

Conclusion: These findings indicate that a gene expression architecture is present in breast muscle of PedM broilers exhibiting high FE that would support enhanced muscle development-differentiation as well as protein synthesis compared to PedM broilers exhibiting low FE.

Introduction

Feed efficiency (FE) is one of the most important genetic traits in animal production since feed costs roughly 70% of the total cost required to bring an animal to market weight (Willems et al., 2013). In a Pedigree Male (PedM) broiler FE model, animals with Low FE exhibited higher mitochondrial reactive oxygen species (ROS) production and higher oxidative stress compared to those with high FE (; ). Although ROS causes oxidation at high levels, low levels of mitochondrial ROS are important in signal transduction and control various physiological processes affecting cell growth and proliferation (; ). Therefore, we hypothesized that inherent gene expression in the low FE phenotype was modulated by mitochondrial ROS production (; ).

To develop a comprehensive understanding of the cellular basis of FE, global gene and protein expression studies have been conducted on breast muscle obtained from PedM broilers exhibiting high and low FE phenotypes (, ; ). These studies have provided insight into fundamental mechanisms of FE in muscle but have also provided certain paradoxical findings. For example, despite clear enrichment of cytoskeletal or muscle fiber gene expression occurring in the low FE phenotype (; ), myostatin (MSTN), that inhibits muscle development (; ; ), was up-regulated in breast muscle of low FE PedM broilers (). The expression of adenosine monophosphate-activated protein kinase 1 (AMPK), a sensor of energetic status in the cell, was elevated in a cDNA microarray in muscle of the high FE PedM phenotype (). When phosphorylated, AMPK activates energy production pathways (e.g., glycolysis, lipolysis, oxidative phosphorylation) and inhibits energy-consuming pathways (e.g., lipogenesis, protein synthesis) (; ). Thus, increased AMPK activity in the high FE phenotype could inhibit protein synthesis and would appear to run counter to the fact that these animals gained more body weight that would require increased protein synthesis to support tissue accretion in comparison to the low FE PedM phenotype (; ). Therefore, the objective of this study was to conduct targeted analysis of genes involved in muscle development, protein synthesis, and energy metabolism; particularly with genes associated with the myostatin and insulin signaling pathways in breast muscle obtained from PedM broilers exhibiting a high or low FE phenotype.

Materials and Methods

Ethics Statement

This study was conducted in accordance with the recommendations in the guide for the care and use of laboratory animals of the National Institutes of Health. All procedures for animal care were reviewed and approved by the University of Arkansas Institutional Animal Care and Use Committee (IACUC: Protocol #14012).

Tissues-Animals

Breast muscle samples analyzed in the present study were obtained from PedM broilers during an earlier study () that had been individually phenotyped for FE as previously described (). Briefly, FE (amount of body weight gain/amount of feed consumed) was determined between 6 and 7 week of age on a group of 100 PedM broilers housed in individual cages (51 cm × 51 cm × 61 cm) at thermoneutral temperatures. Birds were provided access to feed (corn-soybean based diet; 20.5% protein and 3,280 kcal/kg) and water ad libitum during and after the week of FE phenotyping. From the initial group of 100, birds with the highest and lowest FE were selected. Feed efficiencies for the low- and high-FE groups (n = 6 per group) were 0.46 + 0.01 and 0.65 + 0.01, respectively. In the high FE group, greater efficiency was attained by greater weight gain without a difference in feed intake during the week of phenotyping. The difference in mean FE (0.19) between the groups is identical to that reported in our initial investigation (). The birds were then transported from the commercial breeding farm where FE phenotyping took place to the University of Arkansas and placed in cages under similar conditions. Following a 4 day acclimation period, birds were humanely euthanized, breast muscle tissue (Pectoralis major) was quickly excised and flash frozen in liquid nitrogen, and stored at −80°C. Tissue samples were obtained from these birds between 8 and 10 weeks of age associated with mitochondrial function (proton leak kinetic studies) (). We have verified tissue sample quality in previous transcriptomic and proteomic studies (, ; ).

RNA Isolation and Quantitative Real-Time PCR

The integrity of mRNA samples were verified by agarose gel electrophoresis by the presence of three clear and discrete bands representing 5S, 18S, and 28S ribosomal subunits. This assessment was made in the present study as well as in previous transcriptomic studies (; ). Total RNA was extracted by TRIzol reagent (Life Technologies, Thermo Fisher Scientific, Carlsbad, CA, United States) according to the manufacturer’s recommendations, DNase-treated, and reverse-transcribed (Quanta Biosciences, Gaithersburg, MD, United States). The RNA isolated in the present study were from tissue maintained at −80°C and not previously thawed. The concentration, purity, and quality of RNA in the present study were determined for each sample using a Take 3 microvolume plate and a Synergy HT multimode microplate reader (BioTek, Winooski, VT, United States). The reverse-transcription (RT) products (cDNAs) were amplified by real-time quantitative PCR (7500 real-time PCR system, Applied Biosystems, Thermo Fisher Scientific, Foster City, CA, United States) with Power SYBR Green Master Mix (Applied Biosystems). Oligonucleotide primers used in this study, summarized in Table 1, include: chicken activin receptor types IIA and IIB (ActRIIA and ActRIIB), activin-like kinases 4 and 5 (ALK4 and ALK5), AMP-activated protein kinase alpha subunits 1 and 2 (AMPKα1 and AMPKα2), caveolin-3 (CAV-3), creatine kinase muscle isoform (CKM), follistatin (FSTN), glucose transporter 8 (GLUT-8), heat shock 70 kDa protein (HSP70), insulin degrading enzyme (IDE), insulin-like growth factor 1 (IGF-1), insulin-like growth factor-binding protein 3 (IGFBP-3), insulin receptor (IR), insulin receptor substrate 1 (IRS-1), mitogen-activated protein kinases 1, 2, 4, and 6 (MAP2K1, MAP2K2, MAP2K4, and MAP2K6), mitogen-activated protein kinase 7 (MAP3K7), myostatin (MSTN), mechanistic target of rapamycin (mTOR), myogenin (MYOG), myozenin 2 (MYOZ-2), neutrophil cytosolic factor 2 (NCF2), 70 kDa ribosomal protein S6 kinase (P70S6K), cAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A), regulatory-associated protein of mTOR (RAPTOR), SHC-transforming protein 1 (SHC-1), mothers against decapentaplegic homologs 2 and 3 (SMAD2 and SMAD3), and the housekeeping gene ribosomal 18S.

Table 1

Gene symbolGene nameAccession numberPrimer sequence (5′ → 3′)OrientationProduct size (bp)
ActRIIAActivinNM_205367.1GCCATCTCACACAGGGACATForward146
receptor IIATACCTTCGTGTGCCAACCTGReverse
ActRIIBActivinNM_204317.1CGTGACCATCGAAGAGTGCTForward130
receptor IIBCACGATGGAGACAAGGCAGTReverse
ALK4Activin-likeXM_001231300.3CCGCTACACGGTGACCATAGForward107
kinase 4TCCCAGGCTTTCCCTGAGTAReverse
ALK5Actvin-likeNM_204246.1GGCAGAGCTGTGAGGCATTAForward73
kinase 5CTAGCAGCTCCGTTGGCATAReverse
AMPKα1AMP activatedNM_001039603.1CCACCCCTGTACCGGAAATAForward68
kinase a 1GGAAGCGAGTGCCAGAGTTCReverse
AMPKα2AMP activatedNM_001039605.1TGTAAGCATGGACGTGTTGAAGAForward62
kinase a 2GCGGAGAGAATCTGCTGGAAReverse
CAV-3Caveolin-3NM_204370.2CGTTGTAAAGGTGGATTTCGAGGForward110
ACCAGTACTTGCTGACGGTGReverse
CK(m)Creatine kinaseNM_205507.1TGGGTTACATCCTGACGTGCForward101
(muscle isoform)CTCCTCGAATTTGGGGTGCTReverse
FSTNFollistatinNM_205200.1CCCGGGCATGCTCGTAForward60
TGCGCTGTGTGATCTTCCATReverse
GLUT-8GlucoseNM_204375.1GGCATCGTGGTTTGGGTCTAForward73
transporter-8ATCCACAAGGTAGCCTCCCAReverse
HSP-70Heat shockJO2579GGGAGAGGGTTGGGCTAGAGForward55
protein 70TTGCCTCCTGCCCAATCAReverse
IDEInsulin degradingXM_421686.5GCCCATTTGCTTACGTGGATForward77
enzymeGTTGAGGGAGTCTTTGAGTAGTTCAAReverse
IGF-1Insulin-likeNM_001004384.2GCTGCCGGCCCAGAAForward56
growth factor 1ACGAACTGAAGAGCATCAACCAReverse
IGFBP-3IGF-1NM_001101034.1ATCAGGCCATCCCAAGCTTForward59
binding proteinGATGTGCTGTGGAGGCAAATTReverse
IRS-1Insulin receptorNM_005544.2GCGCAAGGTGGGCTACCTForward64
substrate 1CGCGCGCAGTACGAAGAReverse
MAP2K6Mitogen activatedXM_003642348.2TGTCTCAGTCGAGAGGCAAAForward105
kinase 6TGGAGTCTAGATCCCTGGGTReverse
MAP3K7Mitogen activatedXM_004940375.1CCTGATGATGCAGGTAAGACCAForward107
protein kinase 7TCTTTGGAGTTCGGGCATGGReverse
MSTNMyostatinNM_001001461.1ATGCAGATCGCGGTTGATCForward59
GCGTTCTCTGTGGGCTGACTReverse
mTORMechanistic targetXM_417614.5CATGTCAGGCACTGTGTCTATTCTCForward77
of rapamycinCTTTCGCCCTTGTTTCTTCACTReverse
MYOGMyogeninNM_204184.1GGAGAAGCGGAGGCTGAAGForward62
GCAGAGTGCTGCGTTTCAGAReverse
MYOZ2MyozeninNM_001277827.1CAACACTCAGCAACAGAGGCForward120
GTATGGGCTCTCCACGATTTCTReverse
NCF2NeutrophilXM_004943279.1TCTTTGCTTGCGAGGTGGTForward111
cytosolic factor 2TTTCTGGTGTCTTGGGCCTGReverse
P70S6K70 kDa ribosomalNM_001109771.2GTCAGACATCACTTGGGTAGAGAAAGForward60
Protein S6 kinaseACGCCCTCGCCCTTGTReverse
PRKAR1AcAMP dependentNM_001007845.1GTGGGAGCGCCTTACTGTAGForward119
kinase IaCAGCTGTGCCCTCCAAGATAReverse
RAPTORRegulatory proteinXM_004946275.1GGCTACGAGCTCTGGATCTGForward70
of mTORTGACATGACAAGCTAACTGCCReverse
SHC-1SHC-transformingNM_001293280.1CTGCTCAAGCAGGAAGAGAGAAAForward110
protein 1GCGTGTCTTGTCCACGTTCTReverse
SMAD2Mothers againstNM_204561.1TGAGTATAGGCGGCAGACCGForward107
decapentaplegic homolog 2AAGGGGAGCCCATCTGAGTCReverse
SMAD3Mothers againstNM_204475.1CCCACCGTTGGACGATTACAForward99
decaplegic homolog 3GGAGGAGGTGTCTCTGGGATReverse
18SAF173612TCCCCTCCCGTTACTTGGATForward60
GCGCTCGTCGGCATGTAReverse

Oligonucleotide for quantitative reverse transcription polymerase chain reaction (qRT-PCR) primers.

Statistical Analysis

Comparison of mean expression values for qRT-PCR between the high and low FE groups were made using Student’s t-test. Differences were considered statistically significant at P < 0.05 with qualified significance provided for P-values greater than 0.05 but less than 0.10. Binomial distribution analysis was used as previously described to assess differences in the number of genes associated with eukaryotic initiation and translation factors involved in protein synthesis of unreported data (see Table 2) contained in a transcriptomic dataset (). Briefly, the numbers of molecules in which average values were numerically higher (H) or lower (L) in breast muscle of the high FE compared to the low FE PedM phenotype were determined and used in the exact binomial distribution analysis test offered in the 2010 version of Microsoft ExcelTM. There was no cutoff based on significant or fold difference in expression for a given transcript involved in the bionomial distribution analysis that was conducted.

Table 2

MSymbolEntrez gene name
−0.67EEF1A1Eukaryotic translation elongation factor 1 alpha 1
−0.18EIF6Eukaryotic translation initiation factor 6
−0.17EIF4A2Eukaryotic translation initiation factor 4A2
−0.15EIF2AK2Eukaryotic translation initiation factor 2 alpha kinase 2
−0.11EIF2AK3Eukaryotic translation initiation factor 2 alpha kinase 3
−0.10EIF3HEukaryotic translation initiation factor 3 subunit H
−0.07EIF3EEukaryotic translation initiation factor 3 subunit E
−0.07EIF3MEukaryotic translation initiation factor 3 subunit M
−0.05EIF2AK1Eukaryotic translation initiation factor 2 alpha kinase 1
−0.05EIF4HEukaryotic translation initiation factor 4H
−0.04EIF3LEukaryotic translation initiation factor 3 subunit L
−0.03EIF4A3Eukaryotic translation initiation factor 4A3
−0.01EIF4ENIF1Eukaryotic translation initiation factor 4E nuclear import factor 1
0.00EIF2S3Eukaryotic translation initiation factor 2 subunit gamma
0.00EIF3AEukaryotic translation initiation factor 3 subunit A
0.02EEF1AKMT1Eukaryotic translation elongation factor 1 alpha lysine methyltransferase 1
0.04EEF2Eukaryotic translation elongation factor 2
0.05EEF1A1Eukaryotic translation elongation factor 1 alpha 1
0.05EIF2B5Eukaryotic translation initiation factor 2B subunit epsilon
0.05EIF4EEukaryotic translation initiation factor4E
0.06EIF3IEukaryotic translation initiation factor 3 subunit I
0.06EIF4G2Eukaryotic translation initiation factor 4 gamma 2
0.06EIF5A2Eukaryotic translation initiation factor 5A2
0.07EIF2B1Eukaryotic translation initiation factor 2B subunit alpha
0.08EIF4E3Eukaryotic translation initiation factor 4E family member 3
0.10EIF1BEukaryotic translation initiation factor 1B
0.10EIF3BEukaryotic translation initiation factor 3 subunit B
0.11EIF2DEukaryotic translation initiation factor 2D
0.11EIF3FEukaryotic translation initiation factor 3 subunit F
0.12CTIFCap binding complex dependent translation initiation factor
0.12EIF4E2Eukaryotic translation initiation factor 4E family member 2
0.14EIF2AK4Eukaryotic translation initiation factor 2 alpha kinase 4
0.14HBS1LHBS1 like translational GTPase
0.17EIF4G3Eukaryotic translation initiation factor 4 gamma 3
0.17TPT1Tumor protein, translationally-controlled 1
0.18EIF1AYEukaryotic translation initiation factor 1A, Y-linked
0.19EIF1Eukaryotic translation initiation factor 1
0.19EIF3DEukaryotic translation initiation factor 3 subunit D
0.21EIF2B2Eukaryotic translation initiation factor 2B subunit beta
0.21EIF4G1Eukaryotic translation initiation factor 4 gamma 1
0.22EEF1DEukaryotic translation elongation factor 1 delta
0.22EIF2B3Eukaryotic translation initiation factor 2B subunit gamma
0.23MTO1Mitochondrial tRNA translation optimization 1
0.24EIF2B1Eukaryotic translation initiation factor 2B subunit alpha
0.24EIF5Eukaryotic translation initiation factor 5
0.25EIF2B4Eukaryotic translation initiation factor 2B subunit delta
0.26TMA16Translation machinery associated 16 homolog
0.28EIF2AEukaryotic translation initiation factor 2A
0.28EIF2S1Eukaryotic translation initiation factor 2 subunit alpha
0.28EIF5BEukaryotic translation initiation factor 5B
0.29EEF1B2Eukaryotic translation elongation factor 1 beta 2
0.32EIF3JEukaryotic translation initiation factor 3 subunit J
0.33MTIF2Mitochondrial translational initiation factor 2
0.41EIF4EBP1Eukaryotic translation initiation factor 4E binding protein 1
0.43MTIF3Mitochondrial translational initiation factor 3
0.45MTRF1Mitochondrial translational release factor 1
0.61MSS51MSS51 mitochondrial translational activator
0.66MTRF1LMitochondrial translational release factor 1 like

Expression of eukaryotic translation elongation and initiation factors list obtained from an RNAseq dataset of breast muscle tissue (from ) showing log2 high feed efficiency – log2 low feed efficiency (M), the gene symbol and the gene name.

A negative or positive M-value indicates expression was numerically lower or higher in the high feed efficiency phenotype compared to the low feed efficiency phenotype. Of the 56 sequences that were detected, 13 were lower (negative M-value) in the high feed efficiency phenotype and 43 were higher (positive M-value) in the high FE compared to the low FE phenotype. The skew in the high FE phenotype was significant (binomial P-value = 0.0002).

Results and Discussion

The major goal of this study was to conduct targeted gene expression analysis using qRT-PCR to extend the understanding of fundamental mechanisms of FE in breast muscle of PedM broilers exhibiting high and low FE phenotypes. Following a brief overview of the tissues analyzed in this study, the discussion below will be directed to results obtained in the following areas: (a) muscle development and myostatin signaling, (b) energy-nutrient sensing, (c) protein synthesis, and (d) insulin signaling.

Tissues

The tissues analyzed in the present study have been stored at −80°F since they were collected during experiments examining proton leak kinetics in PedM broilers exhibiting high and low FE phenotypes () and have been intensively examined in transcriptomic studies (; , ) and in proteomic studies (). These analyses, from the same set of animals, have afforded an in-depth and unique examination of molecular expression associated with the phenotypic expression of FE.

Long-term storage of frozen tissue can result in deterioration in quality of RNA and proteins. However, as indicated above, the quality of RNA that was isolated in the present study remained high as it did in previous transcriptomic studies. Protein quality was sufficient to conduct shotgun proteomics on this set of tissues () but an inability to detect phosphorylated proteins (unpublished observations), and potentially other post-translational modifications, is unfortunate and necessitates the reliance of software such as Ingenuity Pathway Analysis (IPA) (Qiagen, Valencia, CA, United States) to make predictions of activation or inhibition of upstream molecules based on the expression of downstream molecules in the global gene and protein expression datasets (, ; , ).

Muscle Development and Myostatin Signaling

The mRNA expression of MYOG, MAP2K6, MAP3K7, HSP70, and NCF2, genes that promote muscle development and differentiation, were higher in high FE compared to low FE PedM broilers (Figure 1). While MYOG is a key regulatory transcription factor involved in muscle development during myogenesis (Weintraub et al., 1991; Ohkawa et al., 2007; ), there are also reports of a role of MYOG playing important roles in muscle biology after myogenesis has been completed. For example, a positive relationship between increased breast muscle weight and increased mRNA levels of MYOG in 38 d old broilers has been reported (Xiao et al., 2017). Myogenin directs satellite cell activity during muscle regeneration (Zammit, 2017) and MYOG levels increase in human skeletal muscle following denervation (). Myogenin was also instrumental in sustaining mitochondrial activity in exhaustive exercise in mice (). In this regard, increased MYOG expression might be a contributing factor to enhanced mitochondrial function in the high FE PedM phenotype compared to the low FE phenotype (). Thus, although MYOG is primarily considered as a promoter of myogenesis, MYOG may also be important in energetics and maintenance of fully developed muscle. Increased MYOG mRNA expression could therefore be hypothesized to play a role in the phenotypic expression of FE. Myozenin (Myoz-2) encodes a protein associated with actin and myosin found on the z-line in skeletal muscle that is part of the contractile apparatus (Takada et al., 2001). Although Myoz-2 expression was down-regulated in breast muscle of the high FE PedM broiler phenotype in a recent transcriptomic study conducted on the same set of tissues (), Myoz-2 was not differentially expressed in the present study (Figure 1B).

FIGURE 1

Expression of two mitogen activated kinase enzymes, MAP2K6 and MAP3K7 involved in muscle development and response to environmental stress (see review by ), were elevated in the high FE phenotype (Figure 1C,D). Specifically, MAP2K6 activates p38 MAP kinase and plays an important part in its signal transduction pathway (Raingeaud et al., 1996) whereas MAP3K7 is involved in activation of nuclear factor kappa β (NFκB) in addition to other MAP kinases (). While there were no differences in mRNA expression of MAP2K1, MAP2K2, and MAP2K4, MAP4K4 was predicted to be inhibited in the low FE phenotype in a proteomic study ().

The mRNA expression of CAV-3 was downregulated in the high FE phenotype (Figure 1E). CAV-3 is a member of the caveolin family, and serves as the muscle-specific isoform of the caveolin protein (). Mutations and expression differences of CAV-3 can result in certain muscle myopathies (Woodman et al., 2004). Caveolae are sub-cellular structures that function in cell signaling by aiding internalization of hormonal signals after the hormone binds to the target receptor on the cell surface. Zhu et al. (2006) indicated that CAV-3 expression was upregulated during muscle hyperplasia when compared to expression levels during hypertrophy in pigs and hypothesized that CAV-3 might be used as a genetic marker for meat production in swine. Altered CAV-3 expression may be detrimental to muscle development as both increased or decreased CAV-3 expression made mouse muscle cells more susceptible to oxidative stress and decreased survival through PI(3)K/Akt signaling (Smythe and Rando, 2006). Thus, the up regulation of CAV-3 in the low FE phenotype compared to the low FE phenotype would potentially enhance muscle development but might have contributed to higher oxidative stress observed in the low FE PedM broiler phenotype (). Since the expression of CAV-1 protein is involved in insulin signaling (see below) and was elevated in the high FE breast muscle (), it is not clear what role the CAV1 and CAV3 genes are contributing to the PedM broiler FE model in the present study.

Heat shock protein 70 kDa (HSP70) mRNA expression was elevated in the high FE breast muscle (Figure 1F). This upregulation could have a positive effect in muscle as HSP70 maintains muscle fiber integrity and enhances muscle regeneration and recovery from damage (Senf, 2013). In mitochondria, HSP70 is also responsible for correct folding and assembly of nuclear-encoded proteins targeted for import into the mitochondria where they assemble with mitochondrial DNA encoded proteins as components of the mitochondrial electron transport chain (Truscott et al., 2003) and an important chaperone for mitochondrial DNA-encoded proteins (). Previously, we reported that HSP90 gene expression was elevated in muscle of the low FE phenotype and hypothesized this elevation was a response to higher oxidative stress in these animals (), whereas HSPB2 (heat shock p27 kDa protein 2) protein expression was elevated in the high FE breast muscle (). Thus, there appears to be distinct differences in expression of different members of the family of heat shock proteins in the high and low FE phenotypes.

Neutrophil cytosolic factor 2 (NCF2) encodes a subunit of NADPH/NADH oxidase and is a critical component of NADPH oxidase 2 (NOX2) (). NCF2 was elevated in high FE breast muscle in the present study (Figure 1G) which concurs with findings in commercial broilers (Zhou et al., 2015). NOX2 generates superoxide in the sarcoplasmic reticulum and is a major source of oxidative stress in muscle (; ). NADPH oxidase also functions in the generation of superoxide in neutrophils during phagocytosis. NOX2 is a downstream target of nuclear factor erythroid 2-like 2 (NFE2L2) that coordinates antioxidant response to oxidative stress by activating expression of genes that contain an antioxidant response element in their promoter regions (e.g., , ). From downstream target expression analysis, NFE2L2 was predicted to be activated in animals with high FE (Zhou et al., 2015; ). Zhou et al. (2015) hypothesized that the increased expression of NCF2 was associated with muscle remodeling and hypertrophy in the high FE commercial broiler. Thus, the elevation of NCF2 could have a positive effect on muscle development in the high FE phenotype.

In the MSTN signaling pathway, MSTN binds to its receptors, ActIIA or ActIIB that activate ALK4 and ALK5 that in turn phosphorylate Smad 2 and 3 that translocate to the nucleus to initiate changes in transcription of downstream genes; FSTN functions to inhibit and limit MSTN activity (; ). In the present study, expression of the inhibitory gene MSTN (a member of the TGF-β family), one of its receptors (ActRIIB), and two transcription factors of MSTN signaling, SMAD2 and SMAD3, were upregulated in the low FE compared to high FE breast muscle but there were no differences in FSTN, the ActRIIA, ALK4 and ALK5 expression (Figure 2). Since we only examined mRNA expression, we can only assess expression of transcripts and not protein expression or post-translations modifications such as phosphorylation in the MSTN signaling pathway as well as other genes and pathways outlined below. In a microarray study (; ), data analyzed by IPA software predicted that several target molecules and mechanisms may contribute to differences in muscle growth, development, and differentiation between the high and low FE phenotype. Myostatin was downregulated in the high FE phenotype (). Myostatin is a member of the TGF-β family of molecules and is a strong negative regulator of skeletal muscle growth (), and differentiation and proliferation of turkey satellite cells (). The expression of the MSTN antagonist, FSTN, was not different between the two phenotypes (Figure 2B). Studies investigating the relationship between MSTN and growth performance in broilers show that MSTN is a polymorphic gene in which different alleles of the gene can affect performance (; Ye et al., 2007; ). Thus, differences in FE in the PedM broiler line in this study could be due in part to different haplotypes of the MSTN gene. Figure 3 (adapted from ), summarizes the initial steps in the MSTN signaling pathway in the present study that would potentially exert a negative effect on muscle hypertrophy and differentiation in the low FE phenotype.

FIGURE 2

FIGURE 3

.

Energy Sensing

Activation of 5′ AMP activated kinase (AMPK) occurs via phosphorylation and allosteric modification by 5′-AMP in response to an increase in the cellular AMP:ATP ratio (). This produces a cellular response in which energy-consuming reactions are inhibited and energy-producing reactions are enhanced. Both isoforms of the catalytic subunit of 5′ AMP activated protein kinase (AMPKα1 and AMPKα2) were upregulated in the high FE phenotype (Figure 4A,B) which verifies the previous results (). AMPKa was also predicted to be activated in the high FE PedM phenotype in a proteomics study conducted on the same muscle samples () and both AMPKa 1 and AMPKa 2 were predicted to be activated in an RNAseq study (unpublished observations). AMPK expression increases in response to low energy levels that increases ATP production by stimulating mitochondrial biogenesis and oxidative phosphorylation, glycolysis and lipolysis, and inhibiting fatty acid synthesis, protein synthesis, and gluconeogenesis that consume ATP (Zhou et al., 2001; ; ).

FIGURE 4

Interestingly, creatine kinase (muscle isoform, CK-M) gene expression was elevated in the high FE phenotype (Figure 4C) and concurs with CK-M expression in a transcriptomic study (). Although the brain isoform of CK (CK-B) was elevated in the high FE PedM phenotype, CK-M protein was higher in the low FE phenotype (; ). The reason for this discrepancy is not apparent but gene and protein expression often do not go hand in hand. Nonetheless, increased expression of several proteins suggests that high FE phenotype PedM broiler breast muscle may have enhanced capabilities for mitochondrial oxidative phosphorylation as well as the ability to shuttle creatine and phosphorylated creatine in and out of mitochondria ().

Protein Synthesis

When active, the mTORC1 complex functions to promote cell growth by increasing protein synthesis and lipid metabolism, inhibiting autophagy, and also modulates the transcription of several genes (). In a cDNA microarray study, mTORC1 expression was higher in the high FE phenotype (). Two major components of mTORC1 complex are mTOR and regulatory associated protein of mTOR (RAPTOR) (). In the present study, RAPTOR was upregulated (P < 0.05) in the high FE birds (Figure 4D) and the mTOR was moderately upregulated (P < 0.07) in the low FE birds (Figure 4E,F). The increase in RAPTOR gene expression could have a positive effect on protein synthesis (). In humans, mTOR expression is dysregulated during disease states such as cancer, diabetes, and heart disease () that all have a commonality of increased mitochondrial ROS production. Thus, elevated mitochondrial ROS reported in low FE PedM broilers () might explain the upregulation of mTOR and p70S6k seen in the low FE phenotype. This observation may also hold true for PRKAR1A and GLUT-8, two other members of the insulin signaling pathway that were upregulated in the low FE phenotype (see below). The moderate decrease in mTOR expression in this study contrasts with a significant elevation in mTOR expression observed in high FE PedM broilers (Piekarski-Welsher et al., 2018). We do not have an explanation for this discrepancy between these studies at this time. As indicated previously, we did not assess protein expression in the present study and so do not know if there were differences between FE phentoypes in the phosphorylated (active) form of mTOR in the present study.

Key downstream targets of mTORC1 involved in enhancing protein synthesis are p70S6k and eukaryotic translation initiation factor 4E (EIF4E). The expression of p70S6k, which is activated by insulin and refeeding (), was higher in the low FE birds (P < 0.08) (Figure 4F). Examination of unreported RNAseq transcriptomic data conducted on the same set of muscle tissue (from ) revealed a significant skew (binomial P-value = 0.0002) favoring greater abundance of eukaryotic initiation, elongation, and translation genes with numerically higher expression in the high FE compared to the low FE PedM phenotype (Table 2). This finding, combined with enrichment of ribosomal machinery (), indicates that protein synthesis infrastructure is enhanced in the high FE phenotype.

Insulin Signaling

The results of targeted mRNA expression of genes associated with insulin signaling are presented in Figure 5. Insulin signaling and its pleiotropic effects on gene expression and muscle development in chickens is not as thoroughly understood and differs in certain ways when compared to mammals (). Unlike mammals, in chicken muscle only SHC-1 (not IRS-1) is activated by changes in nutritional status, suggesting that chickens have a tissue-specific regulation of insulin signaling that is yet to be fully understood (,). Although there was no difference in insulin receptor gene expression (Figure 5A), insulin-like substrate 1 (IRS-1) was upregulated in the high FE birds (Figure 5B), which concurs with the predicted activation of IRS-1 and insulin like growth factor receptor 1 in . Additionally, insulin signaling requires insulin receptor endocytosis and is particularly dependent on CAV-1 (). CAV-1 protein expression was ninefold higher in the high FE compared to low FE breast muscle () and could be instrumental in facilitating insulin signaling in the high FE PedM broiler.

FIGURE 5

It has been suggested that p70S6k is involved in a negative feedback that inhibits IRS-1 activation by phosphorylating its serine residues (). Since p70S6k was marginally upregulated (P < 0.08) in the Low FE phenotype in the current study, it may be inhibiting IRS-1 activity, and thus increased SHC-1 expression (Figure 5C) would help maintain the insulin signaling pathway in low FE. Both IRS-1 and SHC-1 are activated by tyrosine phosphorylation activity mediated by phophoinositide-3 kinase (PI3K) when insulin binds to the insulin receptor. We did report an elevation in PI3K expression in the high FE phenotype in a cDNA microarray study () that could be hypothesized to activate both IRS1 and SHC-1.

Insulin degrading enzyme plays a role in insulin signaling and insulin activity (; ). In addition, a mitochondrial form of IDE is capable of cleaving mitochondrial leader signals of nuclear DNA-encoded mitochondrial proteins (), thus making the enzyme important in mitochondrial function. Although there was no difference in mRNA expression of IDE in the present study (data not shown), IDE protein expression was upregulated in the high PedM broiler phenotype ().

The upregulation of anti-proliferative IGFBP-3 in the low FE phenotype (Figure 5D) concurs with Zhou et al. (2015). IGFBP3 may modulate the interaction of insulin like growth factor (IGF) in the extracellular matrix (Stewart and Rotwein, 1996). Spangenburg et al. (2003) reported that IGFBP3 (both gene and protein) was present in rat soleus muscle (Type 1 muscle fiber) but not in Type I and II muscle fibers in gastrocnemius muscle. IGFBP3 was reported to play a role in differentiation in human myoblasts ().

Along with stimulating mitochondrial biogenesis, AMPK increases expression of glucose transporter 4 (GLUT 4), glucose transport and fatty acid oxidation in skeletal muscle in mammals (e.g., ; Smith et al., 2005). Thus, it is somewhat surprising that with the up-regulation of AMPKα1 and AMPKα2 (Figure 4A,B), that both glucose transporter (GLUT 8) and PRKAR1A (Protein Kinase cAMP-dependent type 1 regulatory subunit alpha) were down regulated in the high FE phenotype (Figure 5E,F). High circulating levels of glucose down-regulate GLUT4 expression in many tissues ranging from muscle to white blood cells in mammals (e.g., ; ; ). Thus, the high FE phenotype may have higher circulating levels of glucose compared to the low FE phenotype. PRKAR1A is the main component of PKA that regulates most serine-threonine kinase activity in response to increases in c-AMP including lipolysis (see review ) which is enhanced by AMPK. Thus, additional research is warranted to understand the link between increased AMPK expression and down-regulation of in the high FE phenotype.

Summary

A mechanistic picture of gene expression data in this study is depicted in Figure 6. Muscle development in the high FE PedM phenotype would be fostered by a combination of; (a) down regulation of expression of MSTN, Smad2 and Smad3 in the myostatin signaling pathway combined with down regulation of CAV3 and IGFBP3, and (b) up regulation of HSP70, NCF2, MYOG, Map2k7, and Map2k6. Synthesis of breast muscle proteins could be enhanced in the high FE phenotype by increased expression of RAPTOR in the mTORC1 complex and increased abundance of genes associated with the eukaryotic translation and initiation complex. The expression of mTORC1 was also reported to be upregulated in the high FE phenotype in a previous study (). Potential negative effects on protein synthesis activities by moderate down-regulation of mTOR and p70S6K could be offset by the enhanced ribosomal assembly and protein translation infrastructure reported previously (). Protein scaffolding and assembly of nuclear DNA encoded proteins that are imported into the mitochondria would be enhanced by increased HSP70 expression in the high FE phenotype. Although protein synthesis might be inhibited by increased expression of AMPK (which responds to energy demand signals such as an increase in the AMP:ATP ratio) in the high FE phenotype, we hypothesize that AMPK-mediated stimulation of peroxisome proliferator activated receptor gamma coactivator 1 alpha (PGC-1α), along with enhanced CKM and energetic infrastructure in the high FE phenotype (), would provide sufficient ATP to support protein synthesis in the high FE phenotype. Expression of AMPK is well-known to be part of an energy sensing system that responds to increased energy demand signals such as an increase in the AMP:ATP ratio that activates PGC-1α in muscle cells (e.g., ). In turn, PGC-1α has been given the title of master regulator of mitochondrial biogenesis by Nisoli et al. (2003) and therefore instrumental in increasing energy production through increased mitochondrial oxidative phosphorylation to meet increased energy demand in the cell.

FIGURE 6

). Increased CK-M combined with energetic infrastructure and proteins associated with creatine kinase shuttle expression () could provide ATP needed for enhanced protein synthesis in high FE breast muscle. Aspects that are not clear in this study are the potential negative effect of AMPK on protein synthesis and downregulation of the Glut 8 receptor in the high FE phenotype.

There are at least two inconsistencies in this study that need to be pointed out. As indicated previously, AMPK expression is elevated in response to energy demand that would increase energy generating pathways (such as lipolysis and glycolysis) and mitochondrial oxidative phosphorylation (through mitochondrial biogenesis as mentioned previously). Thus, the down regulation of GLUT 8 (P < 0.05) and PRKAR1A (P = 0.08) that are important genes in glycolysis and lipolysis, respectively, is puzzling. This apparent discrepancy could be due in part because this study focused on gene expression and did not entail targeted protein expression. For example, insulin signaling was predicted to be activated in the high FE phenotype in a proteomics study () whereas gene expression analysis in this study did not reveal a clear indication of enhanced insulin signaling in the present study.

Statements

Ethics statement

This study was conducted in accordance with the recommendations in the guide for the care and use of laboratory animals of the National Institutes of Health. All procedures for animal care were reviewed and approved by the University of Arkansas Institutional Animal Care and Use Committee (IACUC: Protocol #14012).

Author contributions

KL, BK, SD, and WB designed and/or conducted the studies. This manuscript is part of KL Ph.D. Dissertation. The analysis of data was carried out by the same authors with A-PW. The paper was written through contributions and critical review by all authors.

Funding

This work was supported by USDA-NIFA (#2013-01953), Arkansas Biosciences Institute (Little Rock, AR, United States) and the Agricultural Experiment Station (University of Arkansas).

Conflict of interest

AP-W is employed by Adisseo USA, Alpharetta, GA, United States. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

Summary

Keywords

feed efficiency, muscle development, myostatin signaling, pedigree male broilers, gene expression

Citation

Lassiter K, Kong BC, Piekarski-Welsher A, Dridi S and Bottje WG (2019) Gene Expression Essential for Myostatin Signaling and Skeletal Muscle Development Is Associated With Divergent Feed Efficiency in Pedigree Male Broilers. Front. Physiol. 10:126. doi: 10.3389/fphys.2019.00126

Received

29 November 2018

Accepted

31 January 2019

Published

26 February 2019

Volume

10 - 2019

Edited by

Krystyna Pierzchala-Koziec, University of Agriculture of Krakow, Poland

Reviewed by

Daniel Lee Clark, The Ohio State University, United States; Paweł Tomasz Maćkowiak, Poznań University of Life Sciences, Poland

Updates

Copyright

*Correspondence: Walter Gay Bottje,

This article was submitted to Avian Physiology, a section of the journal Frontiers in Physiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics