ORIGINAL RESEARCH article

Front. Physiol., 26 September 2022

Sec. Gastrointestinal Sciences

Volume 13 - 2022 | https://doi.org/10.3389/fphys.2022.1010586

The ghrelin system follows a precise post-natal development in mini-pigs that is not impacted by dietary medium chain fatty-acids

  • 1. Institut Numecan, INRAE, INSERM, Univ Rennes, Saint-Gilles-Rennes, France

  • 2. Institut Agro, Rennes, France

Abstract

The ghrelin-ghrelin receptor (GHSR1) system is one of the most important mechanisms regulating food intake and energy balance. To be fully active, ghrelin is acylated with medium-chain fatty acids (MCFA) through the ghrelin-O-acetyl transferase (GOAT). Several studies reported an impact of dietary MCFA on ghrelin acylation in adults. Our study aimed at describing early post-natal development of the ghrelin system in mini-pigs as a model of human neonates and evaluating the impact of dietary MCFA. Suckled mini-pigs were sacrificed at post-natal day (PND) 0, 2, 5, and 10 or at adult stage. In parallel, other mini-pigs were fed from birth to PND10 a standard or a dairy lipid-enriched formula with increased MCFA concentration (DL-IF). Plasma ghrelin transiently peaked at PND2, with no variation of the acylated fraction except in adults where it was greater than during the neonatal period. Levels of mRNA coding pre-proghrelin (GHRL) and GOAT in the antrum did not vary during the post-natal period but dropped in adults. Levels of antral pcsk1/3 (cleaving GHRL into ghrelin) mRNA decreased significantly with age and was negatively correlated with plasma acylated, but not total, ghrelin. Hypothalamic ghsr1 mRNA did not vary in neonates but increased in adults. The DL-IF formula enriched antral tissue with MCFA but did not impact the ghrelin system. In conclusion, the ghrelin maturation enzyme PCSK1/3 gene expression exhibited post-natal modifications parallel to transient variations in circulating plasma ghrelin level in suckling piglets but dietary MCFA did not impact this post-natal development.

Introduction

Ghrelin is a 28 amino acid peptide with pleiotropic effects. This hormone displays potent orexigenic and adipogenic activities (Tschƶp et al., 2000), anti-apoptotic effects, especially in the pancreas (Wang et al., 2010), anti-depressant effects in adults () and promotes sleep (). Ghrelin is mainly produced in the stomach and results from preproghrelin maturation within gastric enteroendocrine cells. The cleavage from the precursor form to ghrelin is catalyzed by the convertase 3 (PCSK1/3). Ghrelin can then be acylated by medium chain fatty acids (MCFA), mainly octanoic acid (caprylic acid, C8:0) but also hexanoic acid (caproic acid, C6:0) and decanoic acid (capric acid, C10:0) as revealed by dietary supplementation experiments in mice () and structure-activity analysis (). This acylation reaction is mediated by the ghrelin-O-acyltransferase (GOAT) (; Yang et al., 2008). In the plasma, both acylated and non-acylated ghrelin circulate but only the acylated form is recognized in the central nervous system, where it activates the growth hormone secretagogue receptor (GHSR1a) to exert its biological effects (). Ghrelin action upon food intake and energy metabolism regulation can also be mediated by the vagus nerve, as recently reviewed by

The post-natal development of the ghrelin system in humans is not fully described yet. Ghrelin is present at birth since immuno-reactive (IR) non acylated–ghrelin cells have been observed in the fetal stomach, duodenum, pancreas, and lung from the 10thĀ week of gestation in humans (Volante et al., 2002). Moreover, ghrelin has been detected in the cord blood at birth (). Several clinical studies indicate that ghrelin plasma level increases after birth, peaking during the first 2Ā years of life (; , ), then decreasing until adulthood (Whatmore et al., 2003; Wilasco et al., 2012). Interestingly, the decrease in plasma ghrelin after 2Ā years of age was mainly attributed to the non-acylated form but not the acylated one (Wilasco et al., 2012). A post-natal increase in plasma and stomach ghrelin levels (both total and acylated forms) during neonatal life was also observed in mice (; ). This post-natal increase in ghrelin plasma paralleled the increase in preproghrelin gene (ghrl) expression in the stomach until weaning at post-natal day (PND) 21. Yet, ghrl mRNA levels decreased afterwards in adult mice while ghrelin plasma levels remained stable (). In rats, the density of ghrelin–IR and ghrl mRNA containing cells increases with post-natal age, even after weaning and up to 8Ā weeks of age ().

Whether plasma ghrelin variation during the neonatal period is important for the infant development is not fully understood. In preterm infants, one study reported that ghrelin secretion was not different before and after a meal in 4d-old neonates (). Likewise, cord blood ghrelin levels did not correlate with total milk intake during the first 7Ā days of life in bottle-fed neonates (). Thus, the classical ā€œhunger hormoneā€ role of ghrelin might not be fully functional during the first days of post-natal life (). Interestingly, established in mice that ghrelin signaling exerts an organizational effect on neural projections from the hypothalamus during early post-natal development, thus not only playing a role as central nervous system signal but also in neural development

Considering the role of the establishment of eating behavior regulatory pathways in infancy on later risk of obesity and associated disease development (), there is a need for a better understanding of the mechanisms and factors influencing the post-natal development of the ghrelin system. Among influencing factors, perinatal diet may be at play. Indeed, several studies reported lower levels of plasma ghrelin in breast-fed compared to bottle-fed infants (; ), although discrepancies exist (). Animal models also indicate that perinatal diet during gestation and/or lactation can modify the ghrelin system during the neonatal period or later in life, either at the plasma (; ; ; ; ; ; ; ; ; ) or the central level (Yousheng ; ; ; ; ; ). Yet, the impact of perinatal diet at the stomach level has been less described (; ; ). Several data also suggest that dietary C8:0 and GOAT activity regulate acylated ghrelin production, circulating concentration and functions in rats (), although this has been recently challenged (). Increased circulating acylated ghrelin after orally ingested MCFA has also been observed in other species like chicken (Yamato et al., 2005) and fishes (), suggesting a conserved mechanism. Dietary MCFA can be absorbed in the stomach (; , ) and could participate in ghrelin acylation (), although endogenous MCFA production through β-oxidation of long chain fatty acids also contribute to ghrelin acylation Milk is the unique source of nutrients for the neonate. Interestingly, breast-milk is rich in MCFA (), implying that neonates receive a fair amount of MCFA during the neonatal period compared to other periods of life. We hypothesized that dietary MCFA during the neonatal period play a role in the development of the ghrelin system. Our objective was therefore to first thoroughly study the post-natal development of the different components of the ghrelin system in suckling animals and second, to evaluate the effect of dietary MCFA on the ghrelin system using infant formulas with low and high levels of MCFA. We chose to use piglets, an animal model close to humans in terms of neonatal development and gastro-intestinal physiology () to conduct this study. Although ghrelin acylation by dietary MCFA has not been formally demonstrated in pig so far, the conservation of the ghrelin structure, and especially that of the acyl-modification regions, among vertebrate species () was a strong argument to use this model.

Materials and methods

Animal experiment

Animal procedures were performed in accordance with French law and approved by the ComitĆ© Rennais d’Ethique en ExpĆ©rimentation Animale and by the MinistĆØre de l’Enseignement SupĆ©rieur et de la Recherche (APAFiS#11014-2017080512029744 v2). Two animal experiments were conducted separately: the first one investigated the evolution of ghrelin-related parameters in suckled mini-pigs and adult ones at different ages while the second one investigated the impact of dietary MCFA on ghrelin-related parameters at one post-natal age (PND 10). In the first experiment, Yucatan suckling mini-pigs from the UnitĆ© Experimentale Physiologie et PhĆ©notypage Porcins (UE3P INRAE, Saint-Gilles) were sacrificed at PND 0, 2, 5, and 10. Thirty-five piglets (18 males and 17 females) were selected at birth based on their birth weight (0.791 ± 0.024Ā kg) and weighed daily. At PND0, piglets were sacrificed within their first 12Ā h of life and were allowed to suckle colostrum. At PND2, 5, and 10 (corresponding to 10Ā days, 1 and 2Ā months of age in Humans according to , piglets were separated from the sow after suckling, kept in a warm environment and sacrificed after 1Ā h. Six adult mini-pigs (14–16Ā months of age, 2 females and 4 males) were sacrificed after an overnight fast. In the second experiment, sixteen other mini-pigs (7 males and 9 females, birth weight 0.784 ± 0.026Ā kg, n = 5 for IF and n = 11 for DL-IF) were fed two different formulas (IF 118Ā kcal/100Ā ml and DL-IF 120Ā kcal/100Ā ml, Table 1 for fatty acid composition) from birth to PND10 in 10 meals per day using automated milk replacer feeders as previously described (; ). Since passive immunity is normally acquired through colostrum and could not be acquired in these animals, we supplemented them with immunoglobulins (Ig) for 48Ā h. Immediately after birth and within the next 24Ā h later, piglets were force-fed with 10Ā ml of an Ig solution (0.09Ā g/ml). Immunoglobulins were further added to the formulas for 48Ā h (19Ā g Ig/L). The amount of formula provided to piglets was based on their body weight (346Ā kcal/kg body weight 0.75), corresponding to ad libitum feeding since an average 3% refusal was recorded every day. Daily formula intake was not different between the two groups (IF: 224 ± 14Ā ml/d and DL-IF: 217 ± 14Ā ml/d, p > 0.05). Final body weight at PND10 was not different between groups (IF: 1.01 ± 0.03Ā kg and DL-IF: 1.01 ± 0.06 kg, p > 0.05). At PND10, piglets were sacrificed 1Ā h after their last meal.

TABLE 1

IFDL-IF
C6:00.030.6
C8:00.020.5
C10:00.021.2
C12:00.11.6
C14:00.45.6
C14:1 n-50.00.5
C15:00.00.5
C16:031.920.6
C16:1 n-90.00.1
C16:1 n-70.090.9
C18:04.15.9
C18:1 n-946.744.2
C18:1 n-71.81.7
C18:2 n-613.314.7
C18:3 n-60.00.0
C18:3 n-31.01.2
C20:00.20.1
C20:1 n-90.20.2
C20:2 n-60.00.0
C20:4 n-60.00.0
C22:6 n-30.00.0

Fatty acid composition (% of total fatty acid) of infant formula (IF) and infant formula formulated with dairy lipids (DL-IF).

Sacrifice was performed by exsanguination after electronarcosis. Blood was sampled at exsanguination and immediately placed in EDTA K3 15% and aprotinin 250KIU tubes and kept on ice until centrifugation, which was performed within 30Ā min. Plasma was obtained by centrifugation (2500g, 10Ā min, 4°C) and further acidified by adding freshly prepared diluted (at 10Ā mg/ml) PMSF solution (10 µl of PMSF solution/ml plasma) and HCl 1N (50 μl/ml plasma) for acylated ghrelin analysis whereas total ghrelin was assayed in non-acidified plasma. Both acidified and non-acidified plasmas were stored at āˆ’80°C until analysis. The stomach was dissected and kept at 4°C during the whole sampling procedure. The gastric content was removed and a 1–2Ā g sample immediately frozen in liquid nitrogen and stored at āˆ’80°C for further fatty acid composition analysis. Gastric tissue was rinsed with ice-cold PBS. A 100Ā mg antral segment was placed in RNA-later at 4°C for 24Ā h then at āˆ’20°C for further qPCR analysis. A 200Ā mg segment was flash-frozen in liquid nitrogen and stored at āˆ’80°C for fatty acid composition analysis. A 5-cm2 antral segment was placed in 4% buffered paraformaldehyde at room temperature for 24Ā h, rinsed twice in 70% ethanol 1Ā h-bath and kept in 70% ethanol at 4°C until processing in paraffin blocks, in which 7 µm sections were made. The whole hypothalamus was dissected and immediately flash-frozen and kept at āˆ’80°C until qPCR.

Plasma ghrelin analysis

Total and acylated ghrelin plasma levels were analyzed using Human RIA kits (GHRT-89HK and GHRA-88HK respectively, Merck KGaA, Darmstadt, Germany) validated for pigs (Woliński et al., 2014).

Immuno-histochemistry

After rehydration, the sections were incubated in Tris-EDTA (pH 7.4) for 1Ā h at 95°C to retrieve antigenicity. After rinsing 3 times for 5Ā min with PBS, non-specific staining was blocked with a commercial blocking solution (10% goat serum, Tyramide SuperBoostā„¢ kit, ref B40923, Thermo Fischer Scientific, Waltham, MA, United States) and sections were exposed for 1.5Ā h to a rabbit anti-acylated ghrelin antibody (1:50, ref GHS11-A, Alpha Diagnostic, San Antonio, Texas, United States) at room temperature. They were then rinsed 3 times (5Ā min) in PBS and the signal was amplified using the Tyramide SuperBoostā„¢ kit following the manufacturer instructions. Sections were washed again with PBS and cover-slipped with Fluoroshield mounting medium (ref 104139, Abcam, Cambridge, United Kingdom). They were then examined with a fluorescence microscope (Eclipse E400, Nikon Instruments France, Champigny-Sur-Marne, France) attached to a digital camera (Digital Still DXM 1200, Nikon Instruments France). The whole section of the tissue was scanned using digital slide scanner (Nanozoomer 2.0-RS, Hamamatsu Photonics France SARL, Massy, France). Recorded files were analysed using the software ImageJ (https://rsb.info.nih.gov/ij/) for automatic determination of the number of ghrelin-labelled cells per area of mucosa.

qPCR

qPCR on antral tissue and hypothalamus was performed as already described (; ). For hypothalamus, 100Ā mg of homogenate of the whole hypothalamus was used for RNA extraction. Primers used are described in Table 2. For each gene in the antrum, transcript level was normalized to the geometric mean transcript level of 2 reference genes (b2m, coding beta2 microglobulin protein and rplp, coding ribosomal protein, lateral stalk subunit P1). In the hypothalamus, pgk1 (coding phosphoglycerate kinase 1) reference gene was used. The 2-ΔΔCt method was used and results are expressed as fold-change (FC) compared to PND 0 or the IF-fed group.

TABLE 2

ForwardReverseAccession numberEfficiency (%)
GhrlCaa​gaa​gcc​agc​agc​caa​acgaa​gcc​agg​tga​gcc​ctt​agNM_213807.298.1
GoatCtg​ggc​tct​tca​aac​tca​ccgtc​tgc​atc​agg​gac​aaa​acNM_001190423.1102.1
pcsk1/3aca​ggg​gag​aca​agg​aaa​ggtga​tgg​aga​tgg​tgt​aga​tgcNM_214038.1103.6
ghsr1acagggaccagaaccacaaaag​agg​aca​aag​gac​acg​agNM_214180.195.6
b2maaa​cgg​aaa​gcc​aaa​tta​ccatc​cac​agc​gtt​agg​agt​gaNM_21397897.5
Rplpcct​ttc​ctc​agc​tgc​cca​ctacgt​gca​aaa​tga​ggg​cag​agNM_001129964.298.8
pgk1aga​taa​cga​aca​acc​aga​ggtgt​cag​gca​tag​gga​tac​cNM_001099932.2102.0

Primer sequences.

Fatty acid analysis

Solvents were purchased from Sigma-Aldrich (Saint-Quentin Fallavier, France) or Thermo Fisher Scientific (Elancourt, France). Lipids from antrum and gastric content were extracted using a mixture of dimethoxymethane/methanol (4:1 v/v) after homogenization with an Ultra-Turrax (). Heptanoic acid (C7:0) and heptadecanoic acid (C17:0) were added as internal standards in order to quantify C8:0 and C10:0 or longer chain fatty acids, respectively. The total lipid extracts were deposited on silica-impregnated plates and solvents were slowly air-dried at room temperature to ensure the recovery of volatile short and medium chain fatty acids (). The silica-collected lipids were then saponified for 30Ā min at 70°C with 1Ā ml of 0.5Ā M NaOH in methanol and methylated for 30Ā min at 70°C with 1Ā ml boron trifluoride (14% in methanol). Fatty acid methyl esters (FAMEs) were extracted by adding 0.5Ā ml hexane and 6Ā ml NaCl 0.9% (in deionized water). The hexane phase was directly analyzed by gas chromatography coupled to mass spectrometry using an Agilent Technologies 7890N gas chromatograph (Bios Analytic, Toulouse, France) with a bonded silica capillary column (60Ā m Ɨ 0.25Ā mm; BPX 70, SGE, Villeneuve-St-Georges, France), with a polar stationary phase of 70% cyanopropylpolysilphenylene-siloxane (0.25Ā mm film thickness). Helium was used as carrier gas (average velocity 36Ā cm/s). Injection volumes were from 0.1 to 2 µl depending on the tissue, in splitless mode at 250°C. The oven temperature program started at 45°C for 3Ā min. Then, the temperature ramped firstly at 10°C/min to 150°C, then at 4°C/min to 260 C and was held at 260°C for 2Ā min. Mass detection data were obtained in full scan mode with a mass range of m/z 50–550 atomic mass unit. The National Institute of Standards and Technology database (version 2.01) was used for FAMEs identification. Peak integration was performed with MassHunter Workstation Software Qualitative Analysis Version B.07.00 (Agilent Technologies) () and results were expressed as % of total fatty acids or as mg/g of tissue after calculation with reference to the internal standards.

Statistical analysis

Data are presented as means ± sem. Data were analyzed using one-way ANOVA followed by Tukey test when appropriate to test differences between the 5 ages (PND0, 2, 5, 10, and adults) or t-test to test differences between dietary groups (IF versus DL-IF). Differences were considered significant for p ≤ 0.05.

Results

Post-natal development of the ghrelin system

To describe the post-natal development of the ghrelin system in mini-pigs, we first measured mRNA level of ghrl in the antrum of suckling mini-pigs from PND0 to PND10 and in adult mini-pigs. During the first 10Ā days of life, ghrl level did not vary (p > 0.05). However, a dramatic decrease of ghrl mRNA level was noted between the neonatal and the adult life (p < 0.0001, Figure 1A). At the proteic level, the density of acylated ghrelin-immuno-reactive (IR) cells in the antrum did not vary during the neonatal period (PND0 to PND10) and was not different from that of adult mini-pigs (p > 0.05, Figure 1B and Supplementary Figure 1). We next measured total and acylated plasma ghrelin levels, 1Ā h after the last suckling episode for neonates and after an overnight fast in adult mini-pigs. Total plasma ghrelin was greater at PND2 compared to PND0 and 10 (p = 0.02 and p = 0.008, respectively, Figure 1C). Acylated ghrelin plasma levels did not vary during the PND0-PND10 period but was greater in adult mini-pigs compared to neonates (p < 0.0001 for all comparisons to adults, Figure 1D). Consequently, the acylated-to-total ghrelin ratio in the plasma significantly increased with age (PND2 vs. PND10, p = 0.0002, PND2 vs. A, p < 0.0001, PND10 vs. A p = 0.04, Figure 1E). Finally, at the hypothalamus level, we measured ghrelin receptor (ghsr1a) mRNA levels, which did not vary during the neonatal period but was greater in adult mini-pigs compared to neonates at 0 and 5Ā days of age (p = 0.02 and 0.008, respectively, Figure 1F).

FIGURE 1

To further explore the ghrelin system, we evaluated the mRNA levels of genes encoding enzymes involved in ghrelin maturation, i.e., the prohormone convertase 1/3 (pcsk1/3) responsible for the proteolytic cleavage of pre-proghrelin to ghrelin and GOAT (goat) which then catalyzes the acylation of ghrelin. The level of pcsk1/3 mRNA decreased by 50% between PND0 and PND2 (p < 0.0001, Figure 2A) then increased until PND10 (PND2 vs. PND10, p = 0.05, Figure 2A). It then decreased sharply between PND10 and adult mini-pigs (PND10 vs. A, p < 0.0001, Figure 2A). The level of goat mRNA did not vary significantly in the antrum from PND0 to PND10 but was lower in adult compared to PND10 mini-pigs (p = 0.05, Figure 2B). Interestingly, the level of plasma acylated ghrelin correlated negatively with pcsk1/3 (Figure 2C) and ghrl (Figure 2D) mRNA levels in the antrum, but not with goat mRNA level (data not shown). Noteworthy, these significant correlations were mainly driven by adult data since it was no more significant when only the neonatal period was considered (data not shown).

FIGURE 2

Effect of dietary MCFA on ghrelin system

Since acyl modification of ghrelin is essential for its function, with octanoylation being the most common one, and since maternal milk is source of MCFA, we sought to evaluate if dietary MCFA played a role in the post-natal development of the ghrelin system.

We first analyzed the fatty acid composition of gastric content in a subset of neonatal piglets (n = 4 per age group) at different time-points as a proxy of sow milk composition to investigate the evolution with age of dietary MCFA intake in sow-fed piglets. All the fatty acids concentrations increased with age in the gastric content (Table 3). This included C8:0 and C10:0, whose concentration within the gastric content increased by 3.9- and 16.9-fold, respectively, between PND0 and PND10 (Table 3). We next evaluated antrum fatty acid composition to assess if the changes in gastric content MCFA composition resulted in significant changes at the antral tissue level. However, during the neonatal period, no variation in fatty acid concentration was observed in the antrum, except for C15:0 whose concentration decreased with age (Table 4). During the neonatal period (PND 0–10), C10:0 quantity in the antrum was negatively correlated to the acylated-to-total ghrelin ratio and goat mRNA level (r = āˆ’0.497, p = 0.05 and r = āˆ’0.504, p = 0.047, respectively).

TABLE 3

PND0PND2PND5PND10Age effect
C8:037 ± 16 a43 ± 20 ab111 ± 38 ab144 ± 22 b0.03
C10:054 ± 16 a280 ± 106 a930 ± 87 b913 ± 120 b<0.0001
C12:056 ± 10 a278 ± 77 b628 ± 19 c625 ± 42 c<0.0001
C14:0753 ± 178 a4958 ± 1052 b8380 ± 233 c7808 ± 635 c<0.0001
C14:1 n-516 ± 5 a216 ± 69 a521 ± 65 b484 ± 73 b0.0002
C15:098 ± 27 a407 ± 56 c302 ± 36 bc210 ± 21 b0.0005
C16:08731 ± 1787 a46322 ± 7208 b65709 ± 2371 c56678 ± 4631 bc<0.0001
C16:1 n-9368 ± 53 a1447 ± 126 b1467 ± 218 b1156 ± 124 b0.0005
C16:1 n-71023 ± 222 a11913 ± 2659 b20886 ± 1581 c17734 ± 2039 bc<0.0001
C17:0248 ± 65 a975 ± 143 c683 ± 65 bc532 ± 46 ab0.0007
C18:02013 ± 324 a9952 ± 870 b10111 ± 876 b9543 ± 834 b<0.0001
C18:1 n-98322 ± 1053 a52164 ± 3357 b73897 ± 3021 b58894 ± 2557 b0.004
C18:1 n-7841 ± 95 a4696 ± 447 b6581 ± 755 b5197 ± 1649 b0.006
C18:2 n-66701 ± 1314 a28487 ± 3357 b29243 ± 3021 b28188 ± 2557 b0.0001
C18:3 n-3561 ± 113 a3060 ± 501 b3673 ± 358 b3616 ± 393 b0.0002
C20:058 ± 10 a289 ± 31 b312 ± 27 b295 ± 29 b<0.0001
C20:1 n-969 ± 9 a455 ± 48 ab681 ± 103 b682 ± 234 b0.02
C20:2 n-685 ± 28 a493 ± 29 b522 ± 89 b693 ± 60 b<0.0001
C20:3 n-678 ± 19220 ± 59256 ± 46252 ± 50n.s.
C20:4 n-6285 ± 51 a1212 ± 95 b1329 ± 153 b955 ± 205 b0.0008
C22:030 ± 8 a158 ± 23 b148 ± 13 b151 ± 18 b0.0003

Fatty acid composition (µg/g) of gastric content of suckled piglets.

Data are means +/āˆ’ sem. Means with different letters are significantly different (p ≤ 0.05, One-way ANOVA followed by Tukey test, n = 4 per group). n.s.: not significant.

TABLE 4

PND0PND2PND5PND10Age effect
C8:033 ± 1246 ± 1616 ± 623 ± 3n.s.
C10:039 ± 1261 ± 1726 ± 833 ± 6n.s.
C12:0194 ± 52269 ± 79108 ± 33140 ± 16n.s.
C14:0205 ± 27460 ± 131193 ± 51356 ± 169n.s.
C14:1 n-59 ± 230 ± 913 ± 526 ± 10n.s.
C15:053 ± 9 a56 ± 11 a16 ± 6 b19 ± 5 b0.005
C16:02492 ± 3444586 ± 10352291 ± 6054245 ± 1668n.s.
C16:1 n-9164 ± 23195 ± 2876 ± 20133 ± 52n.s.
C16:1 n-7327 ± 52850 ± 286398 ± 107860 ± 502n.s.
C17:0233 ± 53276 ± 11075 ± 13100 ± 17n.s.
C18:01287 ± 2251744 ± 3071100 ± 3931924 ± 611n.s.
C18:1 n-92371 ± 4452296 ± 9321077 ± 647951 ± 2293n.s.
C18:1 n-71033 ± 97638 ± 116356 ± 110716 ± 289n.s.
C18:2 n-61033 ± 2922296 ± 5951077 ± 305951 ± 344n.s.
C18:3 n-623 ± 645 ± 1711 ± 220 ± 9n.s.
C18:3 n-359 ± 23161 ± 5460 ± 17136 ± 82n.s.
C20:021 ± 530 ± 612 ± 421 ± 8n.s.
C20:1 n-922 ± 635 ± 1125 ± 952 ± 27n.s.
C20:2 n-618 ± 754 ± 1528 ± 1146 ± 22n.s.
C20:3 n-650 ± 1261 ± 2241 ± 1762 ± 9n.s.
C20:4 n-6993 ± 2011069 ± 274713 ± 286894 ± 52n.s.
C20:5 n-314 ± 425 ± 1015 ± 621 ± 2n.s.
C22:4 n-6128 ± 30150 ± 43105 ± 54130 ± 13n.s.
C22:5 n-663 ± 1633 ± 1121 ± 1327 ± 4n.s.
C22:5 n-344 ± 892 ± 2971 ± 34102 ± 16n.s.

Fatty acid composition (µg/g) of antrum during the neonatal period.

Data are means +/āˆ’ sem. Means with different letters are significantly different (p ≤ 0.05, One-way ANOVA followed by Tukey test, n = 4 per group). n.s.: not significant.

We next assessed if the level of dietary MCFA in the neonatal diet could impact the development of the ghrelin system. We used two infant formulas, one formulated with plant and dairy lipids (DL-IF), providing MCFA and one formulated uniquely with plant lipids, thus with very low level of MCFA (Table 1). We fed mini-pigs for 10Ā days with these two formulas before evaluating their ghrelin system. Feeding IF or DL-IF for 10Ā days resulted in a significant difference in antrum MCFA content (p = 0.004, Figure 3A). Despite this difference, the ghrelin system of piglets was poorly affected. Total, acylated and acylated-to-total plasma ghrelin was similar between IF-fed and DL-IF fed piglets (Figures 3B–D). Levels of ghrl (Figure 3F), pcsk1/3 (Figure 3G) and goat (Figure 3H) mRNA in the antrum and of ghsr1a mRNA in the hypothalamus (Figure 3I) did not vary with diet. However, the density of acylated ghrelin-IR cells in the antrum was greater in piglets fed IF compared to DL-IF (p = 0.01, Figure 3E and Supplementary Figure 1).

FIGURE 3

Discussion

Our study in an animal model close to humans in terms of gastro-intestinal physiology and eating behavior () shows changes in plasma ghrelin levels during the early neonatal period and compared to adulthood: plasma total ghrelin peaked at PND2 but was stable thereafter while plasma acylated ghrelin did not vary during the neonatal period but was greater in adult mini-pigs that in neonatal ones. In two studies using the same animal model, plasma total ghrelin did not significantly change with post-natal age (between PND 0 and 28 (Willemen et al., 2013) or PND 1 and 7 (Woliński et al., 2014). However, in both studies, blood sampling was performed 30–35Ā min after suckling while we waited 1Ā h, which might account for the difference in the post-natal kinetic although it remains unclear if ghrelin level correlates with fasting time in neonates (; ). Our data follow the same pattern than what has been described in humans, although with a different kinetic probably due to inter-species differences. Indeed, several studies in humans reported an increase in plasma total ghrelin during the first neonatal months with a peak likely occurring around 24–30 months of age (; , ; Yokota et al., 2005) followed by a decrease in children and teenagers (Whatmore et al., 2003; ; Yokota et al., 2005; Wilasco et al., 2012). Conversely, data on the change with age of acylated ghrelin in plasma are scarcer and less consistent, probably due to major differences in study protocols: in two studies, acylated ghrelin plasma level did not vary between birth and 1-week of life (Yokota et al., 2005) or between 0 and >60Ā months of age (Wilasco et al., 2012) but a third study indicated an increase in acylated ghrelin plasma level between 3 and 6Ā months of age (). Later in life, one study reported a greater level of acylated ghrelin in children plasma (average age 8Ā years) compared to neonate one (cord blood samples) (), as observed in our study.

The changes in plasma acylated ghrelin did not correlate with the density of acylated ghrelin IR cells in the stomach but correlated negatively with ghrl and pcsk1/3 expression at the gastric level. Total ghrelin plasma level did not correlate with any of the gene expression studied in the antrum. Importantly, we studied gene transcript level and not protein expression (or activity where appropriate) at the gastric level, which constitutes a limitation of our study. A recent study in older piglets described an increase in ghrl but no variation of goat or pcsk1/3 expressions between PND 14 and 42 (Trevisi et al., 2021). However, timepoints at younger ages as well as corresponding plasma ghrelin levels like in our study were not reported. In mouse models, discrepancies between ghrelin-related gene expression and plasma ghrelin level variations with post-natal age have also been documented (; ). Noteworthy, plasma ghrelin concentration depends on ghrelin secretion from stomach to plasma, as well as ghrelin clearance, which are regulated by many factors (fatty acid responsive receptor GPR120, acyl-protein thioesterase 1 activity in the plasma, ghrelin reactive immunoglobulins) (). Thus, a direct correlation between gene expressions and plasma levels is difficult to establish. Another factor possibly influencing plasma total or acylated ghrelin during the neonatal period is milk ghrelin content. In humans, an increase in ghrelin level between colostrum, transient and mature milk has been observed (). In pig, only one study evaluated milk ghrelin level during the first week of lactation. No variation in milk ghrelin level was observed. Yet, a strong positive correlation between colostrum and piglet plasma total ghrelin levels was observed at PND 1 but not with milk at later time points (PND 2 and 7) (Woliński et al., 2014), suggesting the development of the piglet own ghrelin system after PND 2 and independency from milk ghrelin in plasma ghrelin levels. Yet a role of milk ghrelin in intestinal development has been suggested based on the observation of increased intestinal epithelial cell proliferation in piglets orally supplemented with ghrelin every 8Ā h from birth to PND 6 (). However, since sow milk ghrelin level does not vary with lactation stage (Woliński et al., 2014), we could speculate that the ghrelin transient peak we observed in plasma at PND 2 is involved in the increase in crypt depth and villus length observed between PND 2 and 7 in piglets (). Noteworthy, in our study, plasma total, but not acylated, ghrelin did not vary during the neonatal period. Unfortunately, the acylation state of the exogenous ghrelin administrated to piglets was not reported in the study by Slupecka et al. Therefore, the physiological consequences of the age-related differences in plasma acylated versus non-acylated ghrelin reported in our study on the gastro-intestinal tract warrant further investigations.

The ghrelin system involves ghrelin secretion and circulation and its receptor at the central level. To our knowledge, our study is the first one that evaluated the post-natal expression of the ghrelin receptor (gshr1a) at the hypothalamic level in the porcine model. Only data in mice were available so far: no changes were observed between PND 6 and adult life, except for a significant decrease at PND14 (; ). Mice, like rats, are altricial species and as such, considered immature at birth compared to humans or pigs. Transcriptome correlations combining all somatic organs in different species revealed that the immediate post-natal period in mice (from birth to PND14) is analogous to the third trimester of gestation in humans (). On the other hand, gut maturation is achieved during the post-natal period, before the weaning transition occurring at PND21-28 in pigs, closely to the timing of infant gut maturation (). Getting data in pigs is therefore valuable as a proxy of the human situation. An increase in ghsr mRNA level was observed between the neonatal piglets and adult pigs. We have to acknowledge that adult pigs were sampled after an overnight fast while piglets were fasted only 1Ā h. Whether gshr mRNA level is sensitive to the length of the fasting period remains to be evaluated. During the neonatal period, no variation of gshr expression was observed. However, we did not evaluate ghrelin sensitivity in our piglet model, either through eating behavior tests or neuronal response (neuronal firing, activation of intra-cellular signaling, etc.) to ghrelin exogenous injection. This was beyond the scope of the study but such studies would be important to evaluate the actual role of ghrelin as eating behavior regulator and/or as hypothalamic neuronal development player as demonstrated in mice (). Interestingly, the daily suckling frequency in piglets follows an exponential curve with a sharp increase of the number of suckling bouts after PND 2 until PND 8, where the maximum number is reached, and a decrease thereafter (). The involvement of the progressive increase of the plasma acylated to total ghrelin ratio we observed from PND 2 to 10 in this suckling pattern warrants further investigations.

Another factor that could influence ghrelin system post-natal evolution is the neonatal diet. Several reports indicated that the maternal diet during both gestation and lactation can affect plasma ghrelin levels (; ), gene expression at the gastric level () or even ghrelin receptor expression and/or sensitivity to ghrelin at the central level (). Data testing the impact of nutrition after birth attest that this period is a window of nutritional modulation of the ghrelin system. Indeed, ghrelin plasma level is greater in formula-fed than breast-fed infants (; ), although one study contradicted these results (). In animal models, only neonatal overnutrition obtained by manipulating litter size has been studied so far: it reduced plasma acylated and total ghrelin levels (), increased acylated ghrelin gastric tissue content () as well as goat mRNA levels () while at the central level, it reduced hypothalamic ghsr mRNA level and ghrelin sensitivity during the neonatal period in mouse models (). In our study, we evaluated the role of dietary MCFA on the neonatal development of the ghrelin system. MCFA levels in the antrum did not vary with post-natal age despite changes in MCFA content of gastric contents in suckling piglets. Nonetheless, C10:0 level in the antrum was negatively correlated to acylated-to-total ghrelin ratio in the plasma and to goat mRNA expression. Thus, considering that MCFA is provided by breast-milk during the neonatal period, we sought to evaluate if the level of dietary MCFA impact the ghrelin system development and would be an important factor to consider when formulating milk substitutes for neonates. Our DL-IF formulated with plant and dairy lipids had higher levels of MCFA compared to IF (C6:0 + C8:0 + C10:0 = 2.3% of total fatty acids vs. 0.07% in IF) and compared to gastric contents of suckled piglets (0.07, 0.08, 0.23, and 0.23% of total fatty acids at PND0, 2, 5, and 10, respectively). DL-IF feeding resulted in increased levels of C8:0 and C10:0 in the antrum (x 2.7), while feeding the IF formula resulted in levels similar to that of suckling piglets of the same age. However, despite this increase in C8:0 and C10:0 in the antrum of DL-IF piglets, few differences were observed in the ghrelin system between IF and DL-IF fed piglets. Only the density of acylated ghrelin-IR cells was reduced in DL-IF fed piglets. This 53% decrease in the density of acylated ghrelin-IR cells in the stomach is in line with the 33% decrease in total ghrelin-IR cells observed in rats fed a diet containing 8% (total fatty acids) of C8:0 during 3Ā weeks, although in the same study, ghrl expression was greatly reduced unlike in our (). The low impact of dietary MCFA in our study while some effects of dietary C8:0 have been reported might be attributed to the relatively low level of supplementation in our study. Indeed, the effects of dietary C8:0 on the ghrelin system was observed in animal models with diets containing C8:0 levels greater than 8% of fatty acids (; ; ) while our DL-IF contained only 2.3% of MCFA, mainly provided by C10:0 (1.2%) while C8:0 accounted for 0.5% of total fatty acids. Sow milk contains 0.25% of MCFA (sow milk sampled at PND 21, Rioux, personal communication). Our DL-IF already provided 10 times more MCFA than the physiological level of suckled piglets and we did not want to go beyond this level. Another point to consider is that formula-fed piglets were sampled in a fed state (1Ā h after their last meal), which might have dampened MCFA effect. A positive impact of dietary MCFA on plasma acylated ghrelin level was observed in the fasted state in chicken (Yamato et al., 2005), while in mice not controlled for their feeding state, no effect of MCFA on circulating ghrelin level was observed (). However, studying food-deprived piglets would have been non-physiological since piglets are barely fasted as they usually suckle more than 30 times per day (). Lastly, we studied only one timepoint (PND10) to evaluate the impact of dietary MCFA on the ghrelin system; some earlier effects could have been missed.

In conclusion, our data provide evidences that the ghrelin system display a precise post-natal development in piglets that resembles what has been observed in humans at the plasma level. Interestingly, acylated ghrelin plasma level, which is important for ghrelin biological effects at the central level correlated to ghrl and pcsk1/3 but not goat mRNA level in the stomach. Likewise, the acylated-to-ratio level also correlated to C10:0 (but not C8:0) antral content. Yet, modulating MCFA level through the diet only had limited effect of the ghrelin system.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Materials, further inquiries can be directed to the corresponding author.

Ethics statement

The animal study was reviewed and approved by ComitƩ Rennais d'Ethique en ExpƩrimentation Animale.

Author contributions

GB, IL, SB: designed and directed the project, carried out the experiment, drafted the manuscript and designed the figures, AC, VRo, RJ, ML, DC: carried out the experiment and performed the analysis, reviewed the manuscript, VRi: drafted the manuscript and designed the figures.

Funding

This study was funded by internal funds.

Acknowledgments

Authors would like to thank Francis LE GOUEVEC and Mickaƫl GENISSEL for taking care of the animals, as well as Gwenaelle RANDUINEAU for developing the ghrelin immune-histochemistry protocol and Lactalis for providing the infant formulas.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphys.2022.1010586/full#supplementary-material

References

  • 1

    AhmedT. B.EggesbĆøM.CriswellR.UhlO.DemmelmairH.KoletzkoB. (2021). Total fatty acid and polar lipid species composition of human milk. Nutrients14, 158. 10.3390/nu14010158

  • 2

    ArnaudA. P.RomeV.RichardM.FormalM.David-Le GallS.BoudryG. (2020). Post-natal co-development of the microbiota and gut barrier function follows different paths in the small and large intestine in piglets. FASEB J.34, 1430–1446. 10.1096/fj.201902514R

  • 3

    BelloneS.BaldelliR.RadettiG.RapaA.VivenzaD.PetriA.et al (2006). Ghrelin secretion in preterm neonates progressively increases and is refractory to the inhibitory effect of food intake. J. Clin. Endocrinol. Metab.91, 1929–1933. 10.1210/jc.2005-2185

  • 4

    BelloneS.ProdamF.SavastioS.AvanzoD.PaganiA.TrovatoL.et al (2012). Acylated/unacylated ghrelin ratio in cord blood: Correlation with anthropometric and metabolic parameters and pediatric lifespan comparison. Eur. J. Endocrinol.166, 115–120. 10.1530/EJE-11-0346

  • 5

    BelloneS.RapaA.VivenzaD.VercellottiA.PetriA.RadettiG.et al (2004). Circulating ghrelin levels in the newborn are positively associated with gestational age. Clin. Endocrinol.60, 613–617. 10.1111/j.1365-2265.2004.02014.x

  • 6

    Cardoso-MoreiraM.HalbertJ.VallotonD.VeltenB.ChenC.ShaoY.et al (2019). Gene expression across mammalian organ development. Nature571, 505–509. 10.1038/s41586-019-1338-5

  • 7

    CarnellS.WardleJ. (2008). Appetite and adiposity in children: Evidence for a behavioral susceptibility theory of obesity. Am. J. Clin. Nutr.88, 22–29. 10.1093/ajcn/88.1.22

  • 8

    ColldenG.BallandE.ParkashJ.CaronE.LangletF.PrevotV.et al (2015). Neonatal overnutrition causes early alterations in the central response to peripheral ghrelin. Mol. Metab.4, 15–24. 10.1016/j.molmet.2014.10.003

  • 9

    DarlingJ. E.ZhaoF.LoftusR. J.PattonL. M.GibbsR. A.HouglandJ. L. (2015). Structure–activity analysis of human ghrelin O -acyltransferase reveals chemical determinants of ghrelin selectivity and acyl group recognition. Biochemistry54, 1100–1110. 10.1021/bi5010359

  • 10

    de FluiterK. S.KerkhofG. F.van BeijsterveldtI. A. L. P.BreijL. M.van Vark-van der ZeeL. C.MulderM. T.et al (2021). Appetite-regulating hormone trajectories and relationships with fat mass development in term-born infants during the first 6 months of life. Eur. J. Nutr.60, 3717–3725. 10.1007/s00394-021-02533-z

  • 11

    DesaiM.BabuJ.RossM. G. (2007). Programmed metabolic syndrome: Prenatal undernutrition and postweaning overnutrition. Am. J. Physiol. Regul. Integr. Comp. Physiol.293, R2306–R2314. 10.1152/ajpregu.00783.2006

  • 12

    DuQ.HosodaH.UmekawaT.KinouchiT.ItoN.MiyazatoM.et al (2015). Postnatal weight gain induced by overfeeding pups and maternal high-fat diet during the lactation period modulates glucose metabolism and the production of pancreatic and gastrointestinal peptides. Peptides70, 23–31. 10.1016/j.peptides.2015.05.003

  • 13

    FieldsD. A.SchneiderC. R.PavelaG. (2016). A narrative review of the associations between six bioactive components in breast milk and infant adiposity: Heterogeneity of Breast Milk. Obesity24, 1213–1221. 10.1002/oby.21519

  • 14

    Fuente-MartĆ­nE.GarcĆ­a-CĆ”ceresC.GranadoM.SĆ”nchez-GarridoM. A.Tena-SempereM.FragoL. M.et al (2012). Early postnatal overnutrition increases adipose tissue accrual in response to a sucrose-enriched diet. Am. J. Physiol. Endocrinol. Metab.302, E1586–E1598. 10.1152/ajpendo.00618.2011

  • 15

    GuillocheauE.PenhoatC.DrouinG.GodetA.CathelineD.LegrandP.et al (2020). Current intakes of trans-palmitoleic (trans-C16:1 n-7) and trans-vaccenic (trans-C18:1 n-7) acids in France are exclusively ensured by ruminant milk and ruminant meat: A market basket investigation. Food Chem. X5, 100081. 10.1016/j.fochx.2020.100081

  • 16

    GutierrezJ. A.SolenbergP. J.PerkinsD. R.WillencyJ. A.KniermanM. D.JinZ.et al (2008). Ghrelin octanoylation mediated by an orphan lipid transferase. Proc. Natl. Acad. Sci. U. S. A.105, 6320–6325. 10.1073/pnas.0800708105

  • 17

    Jahan-mihanA.SmithC. E.AndersonG. H. (2011). Effect of protein source in diets fed during gestation and lactation on food intake regulation in male offspring of Wistar rats. Am. J. Physiol. Regul. Integr. Comp. Physiol.300, R1175–R1184. 10.1152/ajpregu.00744.2010

  • 18

    Jahan-mihanA. (2019). The effect of maternal intact protein- and amino acid-based diets on development of food intake regulatory systems and body weight in dams and male offspring of wistar rats. Int. J. Mol. Sci.20, 1690. 10.3390/ijms20071690

  • 19

    JamesR. J. A.JamesA.DrewettR. F.CheethamT. D. (2007). Milk intake and feeding behavior in the first week of life and its relationship to cord blood ghrelin, leptin, and insulin concentrations. Pediatr. Res.62, 695–699. 10.1203/PDR.0b013e318159a28c

  • 20

    JiaY.NguyenT.DesaiM.RossM. G. (2008). Programmed alterations in hypothalamic neuronal orexigenic responses to ghrelin following gestational nutrient restriction. Reprod. Sci.15, 702–709. 10.1177/1933719108316982

  • 21

    KaiyaH.AndohT.IchikawaT.AmiyaN.MatsudaK.KangawaK.et al (2013). Determination of ghrelin structure in the barfin flounder (Verasper moseri) and involvement of ingested fatty acids in ghrelin acylation. Front. Endocrinol.4, 117. 10.3389/fendo.2013.00117

  • 22

    KaurH.MuhlhauslerB. S.SimP. S.-L.PageA. J.LiH.Nunez-SalcesM.et al (2020). Pregnancy, but not dietary octanoic acid supplementation, stimulates the ghrelin-pituitary growth hormone axis in mice. J. Endocrinol.245, 327–342. 10.1530/JOE-20-0072

  • 23

    KisiogluB.Nergiz-UnalR. (2020). Potential effect of maternal dietary sucrose or fructose syrup on CD36, leptin, and ghrelin-mediated fetal programming of obesity. Nutr. Neurosci.23, 210–220. 10.1080/1028415X.2018.1491151

  • 24

    KojimaM.HosodaH.DateY.NakazatoM.MatsuoH.KangawaK. (1999). Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature402, 656–660. 10.1038/45230

  • 25

    KojimaM.IdaT.SatoT. (2007). ā€œStructure of mammalian and nonmammalian ghrelins,ā€ in Vitamins & hormones (Elsevier), 31–46. 10.1016/S0083-6729(06)77003-0

  • 26

    LemaireM.DouS.CahuA.FormalM.Le NormandL.RomƩV.et al (2018). Addition of dairy lipids and probiotic Lactobacillus fermentum in infant formula programs gut microbiota and entero-insular axis in adult minipigs. Sci. Rep.8, 11656. 10.1038/s41598-018-29971-w

  • 27

    LemariƩF.BeauchampE.DayotS.DubyC.LegrandP.RiouxV. (2015). Dietary caprylic acid (C8:0) does not increase plasma acylated ghrelin but decreases plasma unacylated ghrelin in the rat. PLoS ONE10, e0133600. 10.1371/journal.pone.0133600

  • 28

    LemariĆ©F.BeauchampE.DrouinG.LegrandP.RiouxV. (2018). Dietary caprylic acid and ghrelin O-acyltransferase activity to modulate octanoylated ghrelin functions: What is new in this nutritional field?Prostagl. Leukot. Essent. Fat. Acids135, 121–127. 10.1016/j.plefa.2018.07.009

  • 29

    LemariĆ©F.CavalierJ.-F.GarciaC.BoisselF.PointV.CathelineD.et al (2016). Effect of preduodenal lipase inhibition in suckling rats on dietary octanoic acid (C8:0) gastric absorption and plasma octanoylated ghrelin concentration. Biochim. Biophys. Acta1861, 1111–1120. 10.1016/j.bbalip.2016.06.009

  • 30

    LiuY. L.YakarS.Otero-CorchonV.LowM. J.LiuJ.-L. (2002). Ghrelin gene expression is age-dependent and influenced by gender and the level of circulating IGF-I. Mol. Cell. Endocrinol.189, 97–103. 10.1016/S0303-7207(01)00742-0

  • 31

    LutterM.SakataI.Osborne-LawrenceS.RovinskyS. A.AndersonJ. G.JungS.et al (2008). The orexigenic hormone ghrelin defends against depressive symptoms of chronic stress. Nat. Neurosci.11, 752–753. 10.1038/nn.2139

  • 32

    Maldonado-RuizR.CĆ”rdenas-TuemeM.Montalvo-MartĆ­nezL.VidaltamayoR.Garza-OcaƱasL.ResĆ©ndez-PerezD.et al (2019). Priming of hypothalamic ghrelin signaling and microglia activation exacerbate feeding in rats’ offspring following maternal overnutrition. Nutrients11, 1241. 10.3390/nu11061241

  • 33

    MennesonS.MƩnicotS.Ferret-BernardS.GuƩrinS.RomƩV.Le NormandL.et al (2019). Validation of a psychosocial chronic stress model in the pig using a multidisciplinary approach at the gut-brain and behavior levels. Front. Behav. Neurosci.13, 161. 10.3389/fnbeh.2019.00161

  • 34

    MoriseA.SĆØveB.MacĆ©K.MagliolaC.Le HuĆ«rou-LuronI.LouveauI. (2009). Impact of intrauterine growth retardation and early protein intake on growth, adipose tissue, and the insulin-like growth factor system in piglets. Pediatr. Res.65, 45–50. 10.1203/PDR.0b013e318189b0b4

  • 35

    NishiY.HiejimaH.HosodaH.KaiyaH.MoriK.FukueY.et al (2005a). Ingested medium chain fatty acids are directly utilized for the acyl modification of ghrelin. Endocrinology146, 2255–2264. 10.1210/en.2004-0695

  • 36

    NishiY.HiejimaH.MifuneH.SatoT.KangawaK.KojimaM. (2005b). Developmental changes in the pattern of ghrelin’s acyl modification and the levels of acyl-modified ghrelins in murine stomach. Endocrinology146, 2709–2715. 10.1210/en.2004-0645

  • 37

    PerellóM.CornejoM. P.De FrancescoP. N.FernandezG.GautronL.ValdiviaL. S. (2022). The controversial role of the vagus nerve in mediating ghrelin’s actions: Gut feelings and beyond. IBRO Neurosci. Rep.12, 228–239. 10.1016/j.ibneur.2022.03.003

  • 38

    PerretJ. P. (1980). Gastric lipolysis of maternal milk triglycerides, and gastric absorption of medium chain fatty acids in the young rabbit (author’s transl). J. Physiol.76, 159–166.

  • 39

    PriorL. J.DavernP. J.BurkeS. L.LimK.ArmitageJ. A.HeadG. A. (2014). Exposure to a high-fat diet during development alters leptin and ghrelin sensitivity and elevates renal sympathetic nerve activity and arterial pressure in rabbits. Hypertension63, 338–345. 10.1161/HYPERTENSIONAHA.113.02498

  • 40

    PuppeB.TuchschererA. (2000). The development of suckling frequency in pigs from birth to weaning of their piglets: A sociobiological approach. Anim. Sci.71, 273–279. 10.1017/S1357729800055119

  • 41

    RossettiM. F.SchumacherR.GastiazoroM. P.LazzarinoG. P.AndreoliM. F.StokerC.et al (2020). Epigenetic dysregulation of dopaminergic system by maternal cafeteria diet during early postnatal development. Neuroscience424, 12–23. 10.1016/j.neuroscience.2019.09.016

  • 42

    RouraE.KoopmansS.-J.LallĆØsJ.-P.Le Huerou-LuronI.de JagerN.SchuurmanT.et al (2016). Critical review evaluating the pig as a model for human nutritional physiology. Nutr. Res. Rev.29, 60–90. 10.1017/S0954422416000020

  • 43

    SakataI.TanakaT.MatsubaraM.YamazakiM.TaniS.HayashiY.et al (2002). Postnatal changes in ghrelin mRNA expression and in ghrelin-producing cells in the rat stomach. J. Endocrinol.174, 463–471. 10.1677/joe.0.1740463

  • 44

    SangildP. T.ThymannT.SchmidtM.StollB.BurrinD. G.BuddingtonR. K. (2013). Invited Review: The preterm pig as a model in pediatric gastroenterology. J. Anim. Sci.91, 4713–4729. 10.2527/jas.2013-6359

  • 45

    SavinoF.FissoreM. F.GrassinoE. C.NanniG. E.OggeroR.SilvestroL. (2005). Ghrelin, leptin and IGF-I levels in breast-fed and formula-fed infants in the first years of life. Acta Paediatr.94, 531–537. 10.1111/j.1651-2227.2005.tb01934.x

  • 46

    SavinoF.GrassinoE. C.FissoreM. F.GuidiC.LiguoriS. A.SilvestroL.et al (2006). Ghrelin, motilin, insulin concentration in healthy infants in the first months of life: Relation to fasting time and anthropometry. Clin. Endocrinol. (Oxf)65, 158–162. 10.1111/j.1365-2265.2006.02561.x

  • 47

    SavinoF.LupicaM. M.LiguoriS. A.FissoreM. F.SilvestroL. (2012). Ghrelin and feeding behaviour in preterm infants. Early Hum. Dev.88 (1), S51–S55. 10.1016/j.earlhumdev.2011.12.028

  • 48

    SideratouT.AtkinsonF.CampbellG.PetoczP.Bell-AndersonK.Brand-MillerJ. (2018). Glycaemic index of maternal dietary carbohydrate differentially alters fto and lep expression in offspring in C57bl/6 mice. Nutrients10, 1342. 10.3390/nu10101342

  • 49

    SłupeckaM.RomanowiczK.WolińskiJ. (2016). Maternal high-fat diet during pregnancy and lactation influences obestatin and ghrelin concentrations in milk and plasma of wistar rat dams and their offspring. Int. J. Endocrinol.2016, 5739763–5739769. 10.1155/2016/5739763

  • 50

    SłupeckaM.WolińskiJ.PierzynowskiS. G. (2012). The effects of enteral ghrelin administration on the remodeling of the small intestinal mucosa in neonatal piglets. Regul. Pept.174, 38–45. 10.1016/j.regpep.2011.11.007

  • 51

    Soriano-GuillĆ©nL.BarriosV.ChowenJ. A.SĆ”nchezI.VilaS.QueroJ.et al (2004). Ghrelin levels from fetal life through early adulthood: Relationship with endocrine and metabolic and anthropometric measures. J. Pediatr.144, 30–35. 10.1016/j.jpeds.2003.08.050

  • 52

    SteculorumS. M.ColldenG.CoupeB.CroizierS.LockieS.AndrewsZ. B.et al (2015). Neonatal ghrelin programs development of hypothalamic feeding circuits. J. Clin. Invest.125, 846–858. 10.1172/JCI73688

  • 53

    SteigerA.DreslerM.SchüsslerP.KlugeM. (2011). Ghrelin in mental health, sleep, memory. Mol. Cell. Endocrinol.340, 88–96. 10.1016/j.mce.2011.02.013

  • 54

    SunS.CorbeelsK.DesmetL.SegersA.WangQ.Van Der SchuerenB.et al (2020). Involvement of the GHSR in the developmental programming and metabolic disturbances induced by maternal undernutrition. J. Nutr. Biochem.85, 108468. 10.1016/j.jnutbio.2020.108468

  • 55

    SzetoI. M. Y.AzizA.DasP. J.TahaA. Y.OkuboN.Reza-LopezS.et al (2008). High multivitamin intake by Wistar rats during pregnancy results in increased food intake and components of the metabolic syndrome in male offspring. Am. J. Physiol. Regul. Integr. Comp. Physiol.295, R575–R582. 10.1152/ajpregu.90354.2008

  • 56

    TrevisiP.LuiseD.CorreaF.MessoriS.MazzoniM.LallĆØsJ. P.et al (2021). Maternal antibiotic treatment affects offspring gastric sensing for umami taste and ghrelin regulation in the pig. J. Anim. Sci. Biotechnol.12, 31. 10.1186/s40104-021-00557-3

  • 57

    TschƶpM.SmileyD. L.HeimanM. L. (2000). Ghrelin induces adiposity in rodents. Nature407, 908–913. 10.1038/35038090

  • 58

    VolanteM.FulcheriE.AllƬaE.CerratoM.PucciA.PapottiM. (2002). Ghrelin expression in fetal, infant, and adult human lung. J. Histochem. Cytochem.50, 1013–1021. 10.1177/002215540205000803

  • 59

    WangW.ZhangD.ZhaoH.ChenY.LiuY.CaoC.et al (2010). Ghrelin inhibits cell apoptosis induced by lipotoxicity in pancreatic β-cell line. Regul. Pept.161, 43–50. 10.1016/j.regpep.2009.12.017

  • 60

    WhatmoreA. J.HallC. M.JonesJ.WestwoodM.ClaytonP. E. (2003). Ghrelin concentrations in healthy children and adolescents: Ghrelin concentrations in children. Clin. Endocrinol.59, 649–654. 10.1046/j.1365-2265.2003.01903.x

  • 61

    WilascoM. I. A.GoldaniH. A. S.DornellesC. T. L.MaurerR. L.KielingC. O.PorowskiM.et al (2012). Ghrelin, leptin and insulin in healthy children: Relationship with anthropometry, gender, and age distribution. Regul. Pept.173, 21–26. 10.1016/j.regpep.2011.08.013

  • 62

    WillemenS. A.De VosM.HuygelenV.FransenE.TambuyzerB. R.CasteleynC.et al (2013). Ghrelin in the gastrointestinal tract and blood circulation of perinatal low and normal weight piglets. Animal7, 1978–1984. 10.1017/S1751731113001742

  • 63

    WolińskiJ.SłupeckaM.RomanowiczK. (2014). Leptin and ghrelin levels in colostrum, milk and blood plasma of sows and pig neonates during the first week of lactation: Leptin and Ghrelin Concentration in Pigs. Animal Sci. J.85, 143–149. 10.1111/asj.12099

  • 64

    YamatoM.SakataI.WadaR.KaiyaH.SakaiT. (2005). Exogenous administration of octanoic acid accelerates octanoylated ghrelin production in the proventriculus of neonatal chicks. Biochem. Biophys. Res. Commun.333, 583–589. 10.1016/j.bbrc.2005.05.107

  • 65

    YangJ.BrownM. S.LiangG.GrishinN. V.GoldsteinJ. L. (2008). Identification of the acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide hormone. Cell132, 387–396. 10.1016/j.cell.2008.01.017

  • 66

    YokotaI.KitamuraS.HosodaH.KotaniY.KangawaK. (2005). Concentration of the n-octanoylated active form of ghrelin in fetal and neonatal circulation. Endocr. J.52, 271–276. 10.1507/endocrj.52.271

Summary

Keywords

ghrelin, ghrelin-ghrelin O-acyltransferase system, convertase 3, caprylic (C8:0) and capric acid (C10:0), neonate

Citation

Boudry G, Cahu A, RomƩ V, Janvier R, Louvois M, Catheline D, Rioux V, Le Huƫrou-Luron I and Blat S (2022) The ghrelin system follows a precise post-natal development in mini-pigs that is not impacted by dietary medium chain fatty-acids. Front. Physiol. 13:1010586. doi: 10.3389/fphys.2022.1010586

Received

03 August 2022

Accepted

14 September 2022

Published

26 September 2022

Volume

13 - 2022

Edited by

Sarah C Pearce, Agricultural Research Service (USDA), United States

Reviewed by

Takahiro Sato, Kurume University, Japan

Hiroyuki Kaiya, Grandsoul Research Institute for Immunology, Inc., Japan

Christopher M. Butt, Inotiv-Boulder formerly Bolder BioPATH, Inc., United States

Updates

Copyright

*Correspondence: Gaƫlle Boudry,

This article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics