Loss of SPECC1L in cranial neural crest cells results in increased hedgehog signaling and frontonasal dysplasia

SPECC1L encodes a cytoskeletal scaffolding protein that interacts with filamentous actin, microtubules, and cell junctional components. In humans, autosomal dominant mutations in SPECC1L cause a syndrome characterized by craniofrontonasal anomalies including broad nasal bridge, ocular hypertelorism, prominent forehead, and cleft lip/palate. Complete loss of SPECC1L in mice on a homogeneous genetic background results in perinatal lethality, accompanied by subtle cranial differences and incompletely penetrant cleft palate. This lethality limits postnatal analysis of craniofacial development. Because cranial neural crest cells (CNCCs) contribute extensively to the formation of anterior craniofacial structures, we investigated whether disruption of SPECC1L in CNCCs contributes to the craniofrontonasal phenotypes observed in SPECC1L-related syndrome. We generated a Specc1l-floxed allele and crossed it with the Wnt1-Cre2 deleter strain, which drives Cre recombinase expression in the dorsal neuroectoderm and NCCs. Most homozygous Specc1l^ΔCNCC mutants survived postnatally and exhibited hallmark features of the human SPECC1L-related syndrome, including shortened skulls, reduced frontal bone area, nasal defects, and midface hypoplasia. The cranial mesenchyme of Specc1l^ΔCNCC mice displayed shortened primary cilia and increased Hedgehog (Hh) signaling activity at E13.5, as evidenced by enhanced GLI1 immunostaining. These defects were also observed early in E9.5 facial prominences, indicating that they may drive the adult phenotype. Collectively, Specc1l^ΔCNCC mice provide a novel model for investigating the roles of CNCCs, primary cilia, and Hh signaling in frontonasal prominence and midfacial development.

Introduction

Craniofacial development is a highly coordinated process that depends on precise growth, migration, and differentiation of progenitor cell populations within embryonic facial prominences. Central to this process are cranial neural crest cells (CNCCs), which populate the facial prominences and give rise to most cranial and frontonasal structures (Trainor, 2005; Cordero et al., 2011; Ba et al., 2024). Disruptions to this tightly regulated program often lead to craniofacial malformations, many of which stem from defects in key developmental signaling pathways. Among these, Hedgehog (Hh) signaling plays a central role in orchestrating facial morphogenesis. Excessive, insufficient, or otherwise dysregulated Hh activity can perturb the patterning and outgrowth of craniofacial structures, contributing to a broad spectrum of congenital abnormalities (Jeong et al., 2004; Xu et al., 2023). Cytoskeletal scaffolding proteins play key roles in coordinating these events, integrating mechanical structure with intracellular signaling to guide tissue organization (Bisgrove and Yost, 2006; Pollard and Cooper, 2009; Parsons et al., 2010). Among them, SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) is important for organizing the actin cytoskeleton, microtubules, and adherens junctions, thereby maintaining cellular integrity and enabling the coordinated growth required for craniofacial patterning (Saadi et al., 2011; Mehta et al., 2023; Saadi et al., 2023).

In humans, autosomal dominant mutations in SPECC1L result in a spectrum of congenital craniofacial anomalies. While SPECC1L mutations have been identified in a small group of individuals thus far (Bhoj et al., 2019; Saadi et al., 2023), these individuals commonly present with hypertelorism, broad nasal bridge, and cleft lip and/or palate, which are features consistent with frontonasal dysplasia group of disorders (Sedano and Gorlin, 1988; Farlie et al., 2016). SPECC1L-related hypertelorism syndrome is now considered as Teebi hypertelorism syndrome 1 (TBHS1) or brachycephalofrontonasal dysplasia (OMIM: 145420; ORPHA:1519), where the skull is short and wide. In addition to frontonasal dysplasia, patients can also manifest omphalocele, ear pits, uterine malformation, diaphragmatic hernia and congenital heart anomalies, including septal defects and aortic root dilation (Bhoj et al., 2015; Kruszka et al., 2015; Bhoj et al., 2019; Saadi et al., 2023).

SPECC1L cytoskeletal scaffolding protein that has been shown to associate with microtubules, filamentous actin (F-actin), membrane-bound β-catenin, and non-muscle myosin II (Saadi et al., 2011; Wilson et al., 2016; Hall et al., 2020; Goering et al., 2021). Loss of Specc1l in mice results in perinatal lethality on both C57BL/6J and FVB/NJ backgrounds (Goering et al., 2021). The homozygous null mutant embryos were frequently smaller overall and presented with subtle craniofacial anomalies. On the FVB/NJ background, the null mutants exhibited shortened primary cilia in the palate and ∼20% occurrence of cleft palate (Hufft-Martinez et al., 2025). Other Specc1l truncation and genetrap allele mutants displayed abnormally stabilized cell-cell adhesion between migratory (SOX10+) CNCCs (Wilson et al., 2016). Together, these findings indirectly suggest a role for SPECC1L in CNCC development and function.

To directly explore this role, we generated a Specc1l floxed allele and knocked out Specc1l in NCCs using the Wnt1-Cre2 driver line. Most of these conditional mutant mice survived postnatally and exhibited features consistent with the frontonasal dysplasia observed in patients with SPECC1L-related hypertelorism syndrome (Saadi et al., 2023), including altered skull length and width as well as frontal and parietal bone size. Mechanistically, cranial mesenchymal tissues from Specc1l^ΔCNCC embryos exhibited shortened primary cilia and elevated hedgehog (Hh) signaling activity, which is a critical regulator of midfacial growth (Chiang et al., 1996; Ahlgren and Bronner-Fraser, 1999; Bisgrove and Yost, 2006; Han et al., 2009; Goetz and Anderson, 2010; Briscoe and Thérond, 2013). These findings suggest a previously unrecognized role for SPECC1L in cilia-mediated developmental signaling in CNCCs.

Materials and methods

Mouse lines

The Specc1l^fl allele was generated by CRISPR/Cas9-mediated recombination of loxP sites flanking exon 4 – the largest exon in Specc1l. We inserted the 5′ and 3′ loxP sites, sequentially, in mouse E14 embryonic stem cells (CVCL_C320), using the same CRISPR guide RNAs (gRNAs) that we used previously to generate the Specc1l^ΔEx4 null allele (Goering et al., 2021). The approximate genomic positions of the two gRNAs, 5′(AAGATGATGTCCGGGTTTCAAGG) and 3′(AATGTACTGGGGCATAAG), used to generate Specc1l^ΔEx4 are depicted in Figure 1A, while exact locations were reported previously (Goering et al., 2021). Correctly targeted ES cell clones were identified by PCR and sequencing, and also checked by karyotyping. The resulting chimeric males were crossed to C57BL/6J females, and germline transmission confirmed by genotyping of offspring. The Specc1l^fl, Wnt1-Cre2, and ROSA^mT/mG reporter mice were maintained on a mixed C57BL/6J and FVB/NJ genetic background.

Figure 1

Figure 1. Generation of cranial neural crest specific Specc1l knockout. (A) Schematic representation of Specc1l locus, highlighting the exon four genomic region and the 5′ and 3′ guide RNAs (gRNAs). These gRNAs were previously used to generate the Specc1l^ΔEx4 null allele. Here, these gRNAs were used to insert loxP sites flanking exon 4. The resulting Specc1l floxed allele was crossed with Wnt1-Cre2 deleter strain to knockout Specc1l in cranial neural crest cells. Also shown are the approximate locations of the sequencing primers used for genotyping (B,C). (B) Genotyping analysis of the three alleles. Wild-type and mutant alleles were genotyped separately for ΔEx4. (C) Sequence of primer pairs used for genotyping shown in (B). Primer locations are also shown in the schematic of exon four in (A). (D–F) Gross morphology of Specc1l^ΔCNCC mice (Cre(+)) compared to control littermates (Cre(−)). Both null/flox (D) and flox/flox (E) 10-week-old mutant mice are shown with shortened frontonasal region. Also shown is an example of an 8-week-old flox/flox mutant (F) with a bent snout (arrow).

Conditional neural crest–specific deletion of Specc1l was achieved by crossing Specc1l^fl mice with Wnt1-Cre2 line (RRID:IMSR_JAX:022,501), which does not show ectopic Wnt1 expression reported in the original Wnt1-Cre allele (Lewis et al., 2013). The Wnt1-Cre2 allele was maintained on females, as Specc1l^fl/+;Wnt1-Cre2⁺, and crossed with Specc1l^fl/fl or Specc1l^fl/null males, to prevent male germline transmission that has been previously reported (Dinsmore et al., 2022). For lineage tracing, ROSA^mT/mG (RRID:IMSR_JAX:007,676) transgenic mice were used. Mice were housed in a pathogen-free facility, and all experimental procedures were conducted in accordance with protocol (IPROTO 2023-358) approved by the University of Kansas Medical Center Institutional Animal Care and Use Committee (IACUC).

Genotyping

Tail biopsies were collected at weaning, and yolk sacs were obtained at the time of embryo harvesting. Genomic DNA was extracted using DirectPCR Lysis Reagent for Mouse Tail (Viagen, 102-T) or DirectPCR Lysis Reagent for Yolk Sac (Viagen, 202-Y), following the manufacturer’s instructions. PCR was performed using EconoTaq PLUS Master Mix to genotype Specc1l floxed, null, and Cre alleles, as well as ROSA^mT/mG reporter configurations (Figure 1B), with primers listed in Figure 1C. PCR products were separated on a 1.5% agarose gel containing ethidium bromide and visualized under UV transillumination using a ChemiDoc imaging system (Bio-Rad Laboratories).

Micro-computed tomography (microCT) visualization

In accordance with approved protocol, adult mice (seven to nine weeks of age) were euthanized using carbon dioxide (CO₂) inhalation, followed by decapitation as the secondary method. Heads were then processed to remove the eyes and skin, fixed in 4% PFA, and stored until imaging. Mice were imaged at 26 μm resolution using a Skyscan 1272 microCT scanner (Bruker). All images were acquired using the same settings (70 kV, 142 uA, 0.5 mm AI filter, 1000 m exposure, 0.2° rotation step, 180° rotation, no frame averaging) for all specimens. Raw scan data were reconstructed using NRecon software (Bruker) and 3D rendered and segmented in Dragonfly (Comet Technologies Canada Inc.) and python using scikit-image and napari (van der Walt et al., 2014). Reconstruction, rendering and thresholding settings for segmentation were kept consistent between specimens. In cases where the standard threshold setting left some bones fused through tiny bridges: we masked the extra bone by using a higher threshold, separated the two objects and then expanded the extra bone by three pixels. Dragonfly was used to quantify and visualize thickness, volume and density on segmented bones. Quantitative measurements were compared using Student’s t-test with Welch’s correction.

Histology and immunofluorescence

Timed matings were performed overnight and checked for vaginal plugs the following morning. Noon on the day a plug was detected was designated as embryonic day 0.5 (E0.5). Pregnant females were euthanized using CO₂ inhalation at the specified embryonic stages. Embryos at E9.5 and E13.5 were collected and fixed overnight in 4% paraformaldehyde (PFA) at 4 °C. Samples were then cryoprotected sequentially in 15% and 30% sucrose solutions, each overnight at 4 °C, and subsequently embedded in Optimal Cutting Temperature (OCT) compound for storage at −80 °C. Prior to sectioning, samples were equilibrated at −20 °C for several hours. Frozen tissues were sectioned on a CryoStar NX50 cryostat (ThermoFisher) at 10 μm thickness and mounted onto glass slides. Sections were allowed to equilibrate to room temperature (RT) for at least 30 min and kept in PBS to prevent drying.

For immunofluorescence, sections underwent antigen retrieval in preheated sodium citrate buffer (95 °C–100 °C) for 20 min, followed by permeabilization in 0.5% Triton X-100 in PBS for 30 min. Sodium citrate buffer consisted of sodium citrate dihydrate (Sigma, #S4641), pH 6.0, and 0.05% Tween-20 (Fisher, #BP337). Blocking with 10% goat serum in PBS (Omega Scientific, DG-11) was performed at RT for 1 h. Sections were then incubated overnight at 4 °C with primary antibodies: SPECC1L N-terminus (1:250, Proteintech, 25390-1-AP), ARL13B (1:300, Proteintech, 17711-1-AP), Ki-67 (1:500, Cell Signaling, 12202), GLI1 (1:100, Cell Signaling, 2553S), GLI3 (1:100, R&D System, AF3690), Non-phospho (Active) β-catenin (1:500, Cell Signaling, 8814S), SOX10 (1:50, Proteintech, 10422-1-AP), SOX10 (1:30, Santa Cruz, sc-365692), β-catenin (1:250, Proteintech, 2677S), or E-cadherin (1:400, Cell Signaling, 14472S). Secondary antibodies and stains were incubated for an hour at RT: Goat anti-rabbit IgG (H + L) Alexa 647 (1:500, Invitrogen, A21245), Donkey anti-goat IgG (H + L) Alexa 647 (1:500, Invitrogen, A21447), Goat anti-rabbit IgG (H + L) Alexa 488 (1:500, Invitrogen, A11008), Goat anti-mouse IgG1 Alexa 488 (1:500, Invitrogen, A21121) or Acti-stain 670 phalloidin (1:200, Cytoskeleton, PHDN1-A). After washing, slides were mounted with ProLong™ Gold Antifade Mountant with DAPI (Invitrogen, P36931) and allowed to cure at RT. Note that for visualization of nuclear β-catenin, permeabilization was extended to 1 h.

Cilia length measurement

Cilia measurements were performed using images acquired using a Nikon Eclipse Ti-E microscope equipped with CSU-W1 spinning-disk confocal system and a ×60 oil-immersion objective with a numerical aperture of 1.42. Z-stacks were captured with slices taken every 0.2 μm to cover full tissue depth, with the Z-distance determined using the Nyquist function in Nikon Elements AR 6.10.01 software, and an x/y resolution of 0.16 μm/pixel. Maximum intensity projections (MIPs) were created using ImageJ software (version 1.54p) (Schindelin et al., 2012). Cilia lengths were measured following the method described previously (Jack et al., 2019). Briefly, the segmented line tool in ImageJ software was used to trace the cilium. Measurements in pixels were converted to microns using the appropriate pixel-to-micron conversion factor for the objective used. Cilia length data were analyzed and graphed using GraphPad Prism (version 10.4.1), with mean ± 95% confidence intervals represented.

Fluorescence quantification

Cell fluorescence intensity was quantified using ImageJ software (version 1.54p) (Schindelin et al., 2012). The corrected total cell fluorescence (CTCF) was calculated using the formula (Ansari et al., 2013):

CTCF = Integrated Density - (Area of selected area X Mean fluorescence of background readings).

For measurements, “Area”, “Integrated Density”, and “Mean Grey value” were selected under Set Measurements. Three background regions were measured to obtain an average background intensity. The region of interest (ROI) was then measured to obtain the integrated density value, and CTCF values were calculated accordingly. Final values were graphed using GraphPad Prism (version 10.4.1), with data represented as the mean ± standard deviation (SD).

Results

Frontonasal dysplasia upon loss of Specc1l in cranial neural crest cells

We previously reported a Specc1l null allele where we used CRISPR-Cas9 technology involving two guide RNAs (gRNAs) to delete exon four (Figure 1A, Specc1l^ΔEx4 or Specc1l^null) (Goering et al., 2021). To generate a conditional allele, we used the same gRNAs to insert loxP elements flanking exon four (Figure 1A, Specc1l^fl). The genotyping strategy for the null and floxed alleles (Figures 1B,C) is described in the materials and methods section. The Wnt1-Cre2 allele was maintained on females to avoid known aberrant expression in the male germline, which can lead to unintended recombination in non-neural crest cells (Dinsmore et al., 2022). To assess the role of Specc1l in CNCCs, Specc1l^fl/+; Wnt1-Cre2 females were crossed with Specc1l^null/fl or Specc1l^fl/fl males. Both Specc1l^null/fl;Wnt1-Cre2 and Specc1l^fl/fl;Wnt1-Cre2 progeny were assessed and are annotated in most figures. Since both mutant genotypes showed similar phenotypes, they are collectively referred to as Specc1l^ΔCNCC mice in the results. Two Specc1l^null/fl;Wnt1-Cre2 postnatal day (P) 0 pups (∼3%) were observed to have a cleft palate. All surviving Specc1l^ΔCNCC mutants exhibited a broad nasal bridge and a short snout (Figures 1D,E), 25% of which were asymmetrically leftward-bent (Figure 1F, arrow). Together, these phenotypes suggest that loss of Specc1l in CNCCs can account for many of the craniofacial malformation associated with SPECC1L-related hypertelorism syndrome (Saadi et al., 2023).

MicroCT analysis revealed frontal bone reduction and parietal bone increase in Specc1l^ΔCNCC mice

To obtain a better understanding of structural changes in Specc1l^ΔCNCC crania, we performed microCT analysis of 6–8-week-old mice (Figure 2). Both Specc1l^null/fl;Wnt1-Cre2 and Specc1l^fl/fl;Wnt1-Cre2 mice, with or without bent nose, are shown (Figure 2A; Supplementary Figure S1). Overall, we observed a significant decrease in frontal bone length (Figures 2B,C; distance BC), and a concomitant increase in parietal bone length (Figures 2B,C; distance CD). In contrast, skull bone width remained mostly similar, except a decrease in width at the nasal suture (Figures 2B,D; distance HI). When we assessed the ratio of width to total length measurement between wildtype and Specc1l^ΔCNCC mutant crania, the nasal suture difference was not observed (Figures 2B,E; distance HI/AE). However, a significant increase was observed at the position of the lambdoid suture (Figures 2B,E; distance LM/AE), which is consistent with the brachycephaly associated with SPECC1L-related hypertelorism syndrome.

Figure 2

Figure 2. Craniofacial phenotypes of Specc1l^ΔCNCC mice. (A) Three-dimensional micro–computed tomography (microCT) reconstructions of postnatal mouse skulls shown in four standard orientations: dorsal, lateral, ventral, and anterior (left to right). (B) Anatomical landmarks used for craniofacial morphometric analyses in (C,D). (C) Quantification of skull length (mm) as a composite of nasal (AB), frontal (BC), parietal (CD) and interparietal (DE) bones. The overall skull length (AE) was shorter in the mutant mice (p < 0.026), mainly driven by reduction in frontal bone (BC) length (p < 0. 0015). In contrast, the parietal bone (CD) was longer in the mutants (p < 0.0108). (D) Quantification of average skull width (mm) at the level of nasal tip (FG), nasal suture (HI), coronal suture (JK) and lambdoid suture (LM), only showed significant reduction at nasal suture (HI) in the mutant (p < 0.04). (E) Normalization of skull width by total length (AE) at the levels described in (D). Only normalized skull width at lambdoid suture (LM) was significantly increased in the mutant mice (p < 0.0028). (F) Segmentation of frontal and parietal bones showed a drastic change in coronal suture shape, which was more “box-like” in the mutant samples (arrow). (G) The differences in frontal and parietal bone sizes in the mutant skulls resulted in a significantly decreased frontal to parietal ratio (p < 0.0023). (H) Mandibular bone thickness maps did not show significant differences. (I) Normalized mandibular volume relative to total skull volume was significantly decreased in the mutant samples (p < 0.0007). Data represent mean ± SD, n = 4. Statistical significance was assessed using an unpaired two-tailed t-test.

We next examined the sizes of the cranial bones. There was a marked decrease in frontal bone area (Figure 1F, magenta). In contrast, parietal bone size was increased (Figure 1F, blue), resulting in a significant skewing of the frontal to parietal bone ratio (Figure 1G). In addition, the coronal suture shape appeared flatter and more ‘box-like’ in the mutant samples (Figure 1F, arrow). We also assessed regional bone volume and thickness (Supplementary Figure S2). We observed a significant reduction in mandible volume when normalized to the skull (Figures 2H,I). Malocclusion or incisor defects, however, were not observed (Figure 2; Supplementary Figures S1,S2).

Specc1l^ΔCNCC mice showed increased F-actin and reduced cell proliferation in the cranial mesenchyme

To assess the molecular underpinnings of the frontonasal dysplasia, we analyzed the cranial mesenchyme at the level of the developing frontal bone in E13.5 embryos (Figure 3). We also crossed the mutant alleles with ROSA-mTmG allele, which marks the Cre lineage-traced CNCCs in green (Supplementary Figure S3). We confirmed that SPECC1L expression was significantly diminished in the Specc1l^ΔCNCC cranial mesenchyme (Figures 3A–C). The ROSA-mTmG based CNCC-lineage was mapped only in the Specc1l^ΔCNCC mutant mice (Figure 3). Measurements were taken in the Wnt1-Cre2 positive green region in the mutants, and in a comparable cranial mesenchyme region in controls (Figure 3). We next looked at levels of F-actin and cell proliferation via phalloidin and Ki-67 staining, respectively. SPECC1L has been shown to facilitate F-actin turnover (Saadi et al., 2011; Wilson et al., 2016; Hall et al., 2020; Goering et al., 2021). Consistently, we observed a significant increase in F-actin staining in the Specc1l^ΔCNCC mutant cranial mesenchyme (Figures 3D–F). The cranial mesenchyme region in the mutant mice appeared narrower than in controls (Figures 3A,D). Thus, we examined cell proliferation and found it to be significantly decreased in the Specc1l^ΔCNCC mutant cranial mesenchyme (Figures 3G–I).

Figure 3

Figure 3. Specc1l^ΔCNCC cranial mesenchyme showed increased filamentous actin and decreased cell proliferation at E13.5. Immunofluorescence analysis of coronal sections at the level of frontal bone at E13.5. (A–C) Immunostaining for SPECC1L at ×20 (A) and ×60 (B) magnification of boxed region in A showed the expected loss of expression in cranial neural crest cell (CNCC) lineage (green) in Specc1l^ΔCNCC tissue. Control sample was Wnt1-Cre2 negative. The corresponding quantification of integrated fluorescence intensity difference is shown (p < 9.24 E^-07). (D–F) Phalloidin staining for filamentous actin (F-actin) at ×20 (D) and ×60 (E) magnification showed an increase in mutant CNCCs (F, p < 1.24 E^-06). (G–I) Cell proliferation was assessed using Ki-67 immunolabeling. Images at ×20 (G) and ×60 (H) magnification, and quantitation of percent Ki-67 positive cells, showed a decrease in cell proliferation in mutant CNCCs ((I), p < 0.0033). Data represent mean ± SD. Statistical significance was assessed using an unpaired two-tailed t-test, n = 5.

Altered ciliogenesis and hedgehog signaling in Specc1l^ΔCNCC cranial mesenchyme

We have shown that increased F-actin upon SPECC1L deficiency results in shortened primary cilia and increased Hh signaling in the palate of mice at E13.5 (Hufft-Martinez et al., 2025). Thus, we hypothesized primary cilia length and Hh signaling in the cranial mesenchyme to be perturbed in Specc1l^ΔCNCC mice. Indeed, cilia length was significantly decreased in Specc1l^ΔCNCC cranial mesenchyme at E13.5 (Figures 4A,B). Consistent with the ciliary defect, expression of GLI1, a downstream activator of hedgehog signaling, was increased in the Specc1l^ΔCNCC cranial mesenchyme (Figures 4C,D). Altered Hh signaling in ciliary mutants is known to affect canonical WNT signaling (Kurosaka et al., 2014). To this end, we assessed expression of functionally active β-catenin, which was significantly decreased in Specc1l^ΔCNCC cranial mesenchyme (Figures 4E,F), consistent with the observed decrease in cell proliferation.

Figure 4

Figure 4. Shortened primary cilia and elevated hedgehog signaling in Specc1l^ΔCNCC cranial mesenchyme. Cranial mesenchyme was assessed in E13.5 coronal sections at the level of the frontal bone to assess cilia length using the ciliary membrane marker ARL13B (A,B), hedgehog signaling using the downstream effector GLI1 immunostaining (C,D), and canonical WNT signaling using active β-catenin (ABC) immunostaining (E,F). Boxed regions are magnified in insets (A) or in panels to the right (C,E). Cilia length measurement (B) showed a significant reduction in E13.5 Specc1l^ΔCNCC cranial mesenchymal cells (N = 5 embryos, n = 84 cilia), compared with control cells (N = 5 embryos, n = 68 cilia). GLI1 levels were increased in the mutant samples (D), while active β-catenin levels were decreased (F). To determine if these changes were potentially causal, E9.5 sections through the first pharyngeal arch (PA1) were assessed. The cilia length decreased in comparison between control (N = 4 embryos, n = 70 cilia) and Specc1l^ΔCNCC (N = 5, n = 88 cilia) (G,H), and GLI1 levels increased (I,J) in Specc1l^ΔCNCC mutant mesenchyme, similarly to E13.5 cranial mesenchyme. However, active β-catenin levels were increased in the E9.5 mutant mesenchyme (K,L), in contrast to E13.5 cranial mesenchyme. Cilia length analysis represents mean ±95% CI. Remaining analyses represent mean ± SD. Statistical significance was assessed using an unpaired two-tailed t-test; n = 5 for (D,F) and n = 3 for (J,L) (*p < 0.05, ***p < 0.001, ****p < 0.0001).

We next asked whether these changes were potentially causal. We evaluated the Specc1l^ΔCNCC mutant embryos at E9.5. We observed a similar shortening of cilia (Figures 4G,H) and increased GLI1 expression (Figures 4I,J) in E9.5 facial prominences of Specc1l^ΔCNCC mutant embryos. However, we observed increased staining of active β-catenin in the mutant tissue (Figures 4K,L), which correlated with increased Ki-67 staining (Supplementary Figure S4). Our data suggest that shortened cilia and increased hedgehog signaling are early responses to Specc1l loss. β-catenin function, in contrast, is differentially affected during cranial mesenchyme development, likely due to the ciliary signaling defect. We previously reported ectopically stabilized cell-cell adhesions in migratory CNCCs in a global Specc1l-deficient allele (Bertol et al., 2022). We found similarly increased expression of adherens junction markers, E-cadherin and β-catenin, in SOX10-positive migratory CNCCs in Specc1l^ΔCNCC mutant embryos at E9.5 (Supplementary Figure S5). Together, these findings support the conclusion that Specc1l deficiency disrupts cilia-based signaling early in CNCC development affecting migration, signaling, and differentiation.

Discussion

Frontonasal dysplasia is a collection of disorders with variable effects (Sedano et al., 1970; Sedano and Gorlin, 1988; Farlie et al., 2016). SPECC1L-related syndrome is also referred to as TBHS1 (OMIM: 145420) or brachycephalofrontonasal dysplasia (ORPHA:1519), which involves shortening of the cranium with posterior widening. Our Specc1l^ΔCNCC mutant mice showed a similar phenotype of cranial shortening due to reduction in frontal bone size, and widening at the lambdoid suture, likely due to abnormal compensatory growth of the parietal bone. Nasal bone architecture was also altered, and ∼3% of the mutant mice developed cleft palate. Thus, the major craniofacial features of the SPECC1L-related hypertelorism syndrome appear to be CNCC-derived. While we did observe an increase in hedgehog signaling, which regulates midfacial growth, we did not observe an increase in the inter-canthal distance in the Specc1l^ΔCNCC mutant mice. Thus, the most canonical hypertelorism feature of the SPECC1L-related syndrome likely involves the function of SPECC1L in cells other than CNCCs.

A striking feature of Specc1l^ΔCNCC mutant crania was the change in the coronal suture shape, which appeared more ‘box-like’ with a sharp transition between frontal and parietal bones (Figure 1F). Similarly altered coronal sutures have been observed in Twist1^+/− mice (Bialek et al., 2004; Bertol et al., 2022). Specifically, Teng et al. (2018) showed that Twist1 haploinsufficiency in the mesoderm (Twi1^fl/+;Mesp1-Cre) leads to the exact same change in the coronal suture shape. They also showed an increase in parietal bone size and a concomitant decrease in frontal bone size in Twi1^fl/+;Mesp1-Cre mice, similar to our Specc1l^ΔCNCC mutant mice. However, when Teng et al. deleted a copy of Twist1 in the neural crest, the Twi1^fl/+;Wnt1-Cre mice exhibited an increase in frontal bone size and a decrease in parietal bone size. TWIST1 and SPECC1L functions intersect in at least two aspects. TWIST1 mutations are associated with syndromes primarily characterized by craniosynostosis and variably by facial dysmorphism, including cleft palate (Topa et al., 2020; Bertol et al., 2022). Similarly, three patients with SPECC1L-related hypertelorism syndrome also manifested craniosynostosis (Bhoj et al., 2019). Additionally, we previously reported that TWIST1 can bind directly to Specc1l putative intronic regulatory elements, and that Specc1l expression was decreased in early embryonic tissue from Twist1 mutants (Bertol et al., 2022). These observations suggest a complementary relationship between Specc1l and Twist1.

In addition to Twist1, combinatorial reduction in Msx1 and Msx2 dosage in the CNCCs affected frontal bone formation (Roybal et al., 2010). Heterozygous loss of Efnb1 in CNCCs alone, or in combination with Efnb2 heterozygosity, also affected frontal bone development (Davy et al., 2006). Loss of Fgfr1 in the CNCCs did not appear to change the frontal bone size but led to heterotopic osteogenesis (Kawai et al., 2019). Both ephrin and FGF signaling also affect cilia, and MSX1/2 function downstream of Hh signaling in the calvarial bone (Kunova Bosakova et al., 2019; Cho et al., 2025; Loukil et al., 2025). In contrast, loss of Mid1 in CNCCs resulted in an increase in both frontal and nasal bones (Liang et al., 2023). MID1 mutations result in X-linked Opitz GBBB syndrome (OMIM:300000) with a phenotypic spectrum similar to that of SPECC1L-related syndrome, including hypertelorism, cleft lip/palate, cardiac defects and hypospadias (Opitz, 1987; So et al., 2005). In fact, SPECC1L mutations have been identified in patients characterized by non-X-linked Opitz GBBB syndrome (Kruszka et al., 2015).

The compensatory changes in frontal and parietal bone sizes have also been reported in mouse mutants in hedgehog signaling pathway. In the Fuz mutant mice, the frontal bone expands at the expense of the parietal bone, which could be rescued with reduction in Fgf8 levels (Tabler et al., 2016). FUZ is an essential regulator of ciliogenesis, where it controls the processing of GLI3 full length (GLI3FL) into its cleaved repressor form (GLI3R). In Fuz mutants, there is an increase in GLI3FL while GLI1 levels either remain unchanged or decrease depending on the tissue. In Specc1l^ΔCNCC mutant tissue, GLI3 levels are decreased upon immunostaining (Supplementary Figure S6), however, we could not distinguish between GLI3FL and GLI3R levels. While shortened cilia and increased GLI1 levels were observed at both E9.5 and E13.5 in our Specc1l^ΔCNCC mutant cranial mesenchyme, active β-catenin levels differed (Figure 4), suggesting stage-specific crosstalk, especially in the context of osteogenic differentiation (Hu et al., 2005; Rodda and McMahon, 2006). Hedgehog signaling normally promotes cell proliferation. However, Mak et al. (2008) reported that increased hedgehog signaling in mature osteoblasts resulted in ectopically induced osteoclast differentiation leading to bone loss (Mak et al., 2008). Thus, increased hedgehog signaling in Specc1l^ΔCNCC mutant cranial mesenchyme may initially promote proliferation but may eventually result in abnormal differentiation and frontonasal bone malformation. Our data suggest that loss of Specc1l in CNCCs results in a shift in the neural crest-mesoderm interface in a direction opposite to that of the Fuz mutant.

Overall, loss of SPECC1L results in increased F-actin in CNCCs, which results in shortened cilia and increased Hh signaling, affecting CNCC migration and differentiation. The ciliary and Hh defects also affect canonical WNT signaling and cell proliferation, resulting in imbalanced growth of frontonasal and parietal bones.

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material, and the Stowers Original Data Repository at https://www.stowers.org/research/publications/libpb-2604. Further inquiries can be directed to the corresponding author.

Ethics statement

The animal study was approved by The University of Kansas Medical Center Institutional Animal Care and Use Committee. The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

AT: Formal Analysis, Project administration, Methodology, Software, Visualization, Writing – review and editing, Writing – original draft, Investigation. BH-M: Writing – review and editing, Project administration, Investigation, Software, Formal Analysis, Methodology, Visualization, Writing – original draft. DT: Writing – review and editing, Writing – original draft, Formal Analysis, Investigation. LM: Project administration, Writing – review and editing, Writing – original draft, Methodology, Formal Analysis, Investigation, Software, Visualization. SM: Software, Writing – review and editing, Methodology, Formal Analysis. JG: Formal Analysis, Project administration, Writing – review and editing, Investigation. PT: Writing – review and editing, Formal Analysis, Supervision, Methodology, Investigation, Resources, Software. IS: Conceptualization, Writing – review and editing, Investigation, Funding acquisition, Supervision, Writing – original draft, Methodology, Project administration, Resources.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This project was supported in part by the National Institutes of Health grants DE026172, DE032825, DE032515, DE032742 (IS), TL1TR002368 (BMH) and DE033617 (LM). IS was also supported in part by the Center of Biomedical Research Excellence (COBRE) grant (National Institute of General Medical Sciences P30 GM122731), Kansas IDeA Network for Biomedical Research Excellence grant (National Institute of General Medical Sciences P20 GM103418), and Kansas Intellectual and Developmental Disabilities Research Center (KIDDRC) grant (Eunice Kennedy Shriver National Institute of Child Health and Human Development, U54 HD090216). The Confocal Imaging Facility, the Integrated Imaging Core, and the Transgenic and Gene Targeting Institutional Facility at the University of Kansas Medical Center are supported, in part, by NIH/NIGMS COBRE grant P30 GM122731 and by NIH/NICHD KIDDRC grant U54 HD090216. The Leica STED microscope was supported by NIH S10 OD023625. The Nikon CSU-W1 SoRa microscope was supported by NIH S10 OD032207. Research in the PT laboratory is supported by the Stowers Institute for Medical Research.

Acknowledgements

We want to thank Jay Vivian, the KUMC Transgenic Core facility, and Luke Wenger for their help in the design and generation of the Specc1l conditional allele. We would like to thank Stephanie Nowotarski and Melania McClain in the Stowers Electron and Light Microscopy Technology Center for assistance with the micro-CT instrument and data visualization. An early version of this manuscript was deposited into bioRxiv (https://doi.org/10.1101/2025.11.21.689834).

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphys.2026.1751758/full#supplementary-material

References

Ahlgren S. C., Bronner-Fraser M. (1999). Inhibition of sonic hedgehog signaling in vivo results in craniofacial neural crest cell death. Curr. Biol. 9 (22), 1304–1314. doi:10.1016/s0960-9822(00)80052-4

PubMed Abstract | CrossRef Full Text | Google Scholar

Ansari N., Muller S., Stelzer E. H., Pampaloni F. (2013). Quantitative 3D cell-based assay performed with cellular spheroids and fluorescence microscopy. Methods Cell Biol. 113, 295–309. doi:10.1016/B978-0-12-407239-8.00013-6

PubMed Abstract | CrossRef Full Text | Google Scholar

Ba H., Guo Q., Shang Y., Hu P., Ma C., Li J., et al. (2024). Insights into the molecular characteristics of embryonic cranial neural crest cells and their derived mesenchymal cell pools. Commun. Biol. 7 (1), 1347. doi:10.1038/s42003-024-07056-x

PubMed Abstract | CrossRef Full Text | Google Scholar

Bertol J. W., Johnston S., Ahmed R., Xie V. K., Hubka K. M., Cruz L., et al. (2022). TWIST1 interacts with β/δ-catenins during neural tube development and regulates fate transition in cranial neural crest cells. Development 149 (15), dev200068. doi:10.1242/dev.200068

PubMed Abstract | CrossRef Full Text | Google Scholar

Bhoj E. J., Li D., Harr M. H., Tian L., Wang T., Zhao Y., et al. (2015). Expanding the SPECC1L mutation phenotypic spectrum to include teebi hypertelorism syndrome. Am. J. Med. Genet. A 167a (11), 2497–2502. doi:10.1002/ajmg.a.37217

PubMed Abstract | CrossRef Full Text | Google Scholar

Bhoj E. J., Haye D., Toutain A., Bonneau D., Nielsen I. K., Lund I. B., et al. (2019). Phenotypic spectrum associated with SPECC1L pathogenic variants: new families and critical review of the nosology of teebi, opitz GBBB, and baraitser-winter syndromes. Eur. J. Med. Genet. 62 (12), 103588. doi:10.1016/j.ejmg.2018.11.022

PubMed Abstract | CrossRef Full Text | Google Scholar

Bialek P., Kern B., Yang X., Schrock M., Sosic D., Hong N., et al. (2004). A twist code determines the onset of osteoblast differentiation. Dev. Cell 6 (3), 423–435. doi:10.1016/s1534-5807(04)00058-9

PubMed Abstract | CrossRef Full Text | Google Scholar

Bisgrove B. W., Yost H. J. (2006). The roles of cilia in developmental disorders and disease. Development 133 (21), 4131–4143. doi:10.1242/dev.02595

PubMed Abstract | CrossRef Full Text | Google Scholar

Briscoe J., Thérond P. P. (2013). The mechanisms of Hedgehog signalling and its roles in development and disease. Nat. Rev. Mol. Cell Biol. 14 (7), 416–429. doi:10.1038/nrm3598

PubMed Abstract | CrossRef Full Text | Google Scholar

Chiang C., Litingtung Y., Lee E., Young K. E., Corden J. L., Westphal H., et al. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383 (6599), 407–413. doi:10.1038/383407a0

PubMed Abstract | CrossRef Full Text | Google Scholar

Cho J. G., Hah Y., Yun E., Ka H. I., Lee A., Han S., et al. (2025). Loss of primary cilia promotes EphA2-mediated endothelial-to-mesenchymal transition in the ovarian tumor microenvironment. Mol. Oncol. 19 (10), 2951–2966. doi:10.1002/1878-0261.70057

PubMed Abstract | CrossRef Full Text | Google Scholar

Cordero D. R., Brugmann S., Chu Y., Bajpai R., Jame M., Helms J. A. (2011). Cranial neural crest cells on the move: their roles in craniofacial development. Am. J. Med. Genet. A 155a (2), 270–279. doi:10.1002/ajmg.a.33702

PubMed Abstract | CrossRef Full Text | Google Scholar

Davy A., Bush J. O., Soriano P. (2006). Inhibition of gap junction communication at ectopic Eph/ephrin boundaries underlies craniofrontonasal syndrome. PLoS Biol. 4 (10), e315. doi:10.1371/journal.pbio.0040315

PubMed Abstract | CrossRef Full Text | Google Scholar

Dinsmore C. J., Ke C. Y., Soriano P. (2022). The Wnt1-Cre2 transgene is active in the male germline. Genesis 60 (3), e23468. doi:10.1002/dvg.23468

PubMed Abstract | CrossRef Full Text | Google Scholar

Farlie P. G., Baker N. L., Yap P., Tan T. Y. (2016). Frontonasal dysplasia: towards an understanding of molecular and developmental aetiology. Mol. Syndromol. 7 (6), 312–321. doi:10.1159/000450533

PubMed Abstract | CrossRef Full Text | Google Scholar

Goering J. P., Wenger L. W., Stetsiv M., Moedritzer M., Hall E. G., Isai D. G., et al. (2021). In-frame deletion of SPECC1L microtubule association domain results in gain-of-function phenotypes affecting embryonic tissue movement and fusion events. Hum. Mol. Genet. 31 (1), 18–31. doi:10.1093/hmg/ddab211

PubMed Abstract | CrossRef Full Text | Google Scholar

Goetz S. C., Anderson K. V. (2010). The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet. 11 (5), 331–344. doi:10.1038/nrg2774

PubMed Abstract | CrossRef Full Text | Google Scholar

Hall E. G., Wenger L. W., Wilson N. R., Undurty-Akella S. S., Standley J., Augustine-Akpan E. A., et al. (2020). SPECC1L regulates palate development downstream of IRF6. Hum. Mol. Genet. 29 (5), 845–858. doi:10.1093/hmg/ddaa002

PubMed Abstract | CrossRef Full Text | Google Scholar

Han J., Mayo J., Xu X., Li J., Bringas P., Jr., Maas R. L., et al. (2009). Indirect modulation of Shh signaling by Dlx5 affects the oral-nasal patterning of palate and rescues cleft palate in Msx1-null mice. Development 136 (24), 4225–4233. doi:10.1242/dev.036723

PubMed Abstract | CrossRef Full Text | Google Scholar

Hu H., Hilton M. J., Tu X., Yu K., Ornitz D. M., Long F. (2005). Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 132 (1), 49–60. doi:10.1242/dev.01564

PubMed Abstract | CrossRef Full Text | Google Scholar

Hufft-Martinez B. M., Thalman D. N., Tran A. J., Goering J. P., Stetsiv M., Moedritzer M., et al. (2025). Genetic interaction of Specc1l and Thm1 reveals cytoskeletal - ciliary crosstalk. bioRxiv, 2025.11.03.686369. doi:10.1101/2025.11.03.686369

PubMed Abstract | CrossRef Full Text | Google Scholar

Jack B., Mueller D. M., Fee A. C., Tetlow A. L., Avasthi P. (2019). Partially redundant actin genes in chlamydomonas control transition Zone organization and flagellum-directed traffic. Cell Rep. 27 (8), 2459–2467 e2453. doi:10.1016/j.celrep.2019.04.087

PubMed Abstract | CrossRef Full Text | Google Scholar

Jeong J., Mao J., Tenzen T., Kottmann A. H., McMahon A. P. (2004). Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia. Genes Dev. 18 (8), 937–951. doi:10.1101/gad.1190304

PubMed Abstract | CrossRef Full Text | Google Scholar

Kawai M., Herrmann D., Fuchs A., Cheng S., Ferrer-Vaquer A., Götz R., et al. (2019). Fgfr1 conditional-knockout in neural crest cells induces heterotopic chondrogenesis and osteogenesis in mouse frontal bones. Med. Mol. Morphol. 52 (3), 156–163. doi:10.1007/s00795-018-0213-z

PubMed Abstract | CrossRef Full Text | Google Scholar

Kruszka P., Li D., Harr M. H., Wilson N. R., Swarr D., McCormick E. M., et al. (2015). Mutations in SPECC1L, encoding sperm antigen with calponin homology and coiled-coil domains 1-like, are found in some cases of autosomal dominant Opitz G/BBB syndrome. J. Med. Genet. 52 (2), 104–110. doi:10.1136/jmedgenet-2014-102677

PubMed Abstract | CrossRef Full Text | Google Scholar

Kunova Bosakova M., Nita A., Gregor T., Varecha M., Gudernova I., Fafilek B., et al. (2019). Fibroblast growth factor receptor influences primary cilium length through an interaction with intestinal cell kinase. Proc. Natl. Acad. Sci. U. S. A. 116 (10), 4316–4325. doi:10.1073/pnas.1800338116

PubMed Abstract | CrossRef Full Text | Google Scholar

Kurosaka H., Iulianella A., Williams T., Trainor P. A. (2014). Disrupting hedgehog and WNT signaling interactions promotes cleft lip pathogenesis. J. Clin. Invest 124 (4), 1660–1671. doi:10.1172/jci72688

PubMed Abstract | CrossRef Full Text | Google Scholar

Lewis A. E., Vasudevan H. N., O'Neill A. K., Soriano P., Bush J. O. (2013). The widely used Wnt1-Cre transgene causes developmental phenotypes by ectopic activation of Wnt signaling. Dev. Biol. 379 (2), 229–234. doi:10.1016/j.ydbio.2013.04.026

PubMed Abstract | CrossRef Full Text | Google Scholar

Liang C., Profico A., Buzi C., Khonsari R. H., Johnson D., O'Higgins P., et al. (2023). Normal human craniofacial growth and development from 0 to 4 years. Sci. Rep. 13 (1), 9641. doi:10.1038/s41598-023-36646-8

PubMed Abstract | CrossRef Full Text | Google Scholar

Loukil A., Ebright E., Hamdi K., Menzel E., Uezu A., Gao Y., et al. (2025). Identification of new ciliary signaling pathways in the brain and insights into neurological disorders. J. Neurosci. 45 (33), e0800242025. doi:10.1523/jneurosci.0800-24.2025

PubMed Abstract | CrossRef Full Text | Google Scholar

Mak K. K., Bi Y., Wan C., Chuang P. T., Clemens T., Young M., et al. (2008). Hedgehog signaling in mature osteoblasts regulates bone formation and resorption by controlling PTHrP and RANKL expression. Dev. Cell 14 (5), 674–688. doi:10.1016/j.devcel.2008.02.003

PubMed Abstract | CrossRef Full Text | Google Scholar

Mehta V., Decan N., Ooi S., Gaudreau-Lapierre A., Copeland J. W., Trinkle-Mulcahy L. (2023). SPECC1L binds the myosin phosphatase complex MYPT1/PP1β and can regulate its distribution between microtubules and filamentous actin. J. Biol. Chem. 299 (2), 102893. doi:10.1016/j.jbc.2023.102893

PubMed Abstract | CrossRef Full Text | Google Scholar

Opitz J. M. (1987). G syndrome (hypertelorism with esophageal abnormality and hypospadias, or hypospadias-dysphagia, or Opitz-Frias or Opitz-G syndrome)--perspective in 1987 and bibliography. Am. J. Med. Genet. 28 (2), 275–285. doi:10.1002/ajmg.1320280203

PubMed Abstract | CrossRef Full Text | Google Scholar

Parsons J. T., Horwitz A. R., Schwartz M. A. (2010). Cell adhesion: integrating cytoskeletal dynamics and cellular tension. Nat. Rev. Mol. Cell Biol. 11 (9), 633–643. doi:10.1038/nrm2957

PubMed Abstract | CrossRef Full Text | Google Scholar

Pollard T. D., Cooper J. A. (2009). Actin, a central player in cell shape and movement. Science 326 (5957), 1208–1212. doi:10.1126/science.1175862

PubMed Abstract | CrossRef Full Text | Google Scholar

Rodda S. J., McMahon A. P. (2006). Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development 133 (16), 3231–3244. doi:10.1242/dev.02480

PubMed Abstract | CrossRef Full Text | Google Scholar

Roybal P. G., Wu N. L., Sun J., Ting M. C., Schafer C. A., Maxson R. E. (2010). Inactivation of Msx1 and Msx2 in neural crest reveals an unexpected role in suppressing heterotopic bone formation in the head. Dev. Biol. 343 (1-2), 28–39. doi:10.1016/j.ydbio.2010.04.007

PubMed Abstract | CrossRef Full Text | Google Scholar

Saadi I., Alkuraya F. S., Gisselbrecht S. S., Goessling W., Cavallesco R., Turbe-Doan A., et al. (2011). Deficiency of the cytoskeletal protein SPECC1L leads to oblique facial clefting. Am. J. Hum. Genet. 89 (1), 44–55. doi:10.1016/j.ajhg.2011.05.023

PubMed Abstract | CrossRef Full Text | Google Scholar

Saadi I., Goering J. P., Hufft-Martinez B. M., Tran P. V. (2023). SPECC1L: a cytoskeletal protein that regulates embryonic tissue dynamics. Biochem. Soc. Trans. 51 (3), 949–958. doi:10.1042/BST20220461

PubMed Abstract | CrossRef Full Text | Google Scholar

Schindelin J., Arganda-Carreras I., Frise E., Kaynig V., Longair M., Pietzsch T., et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9 (7), 676–682. doi:10.1038/nmeth.2019

PubMed Abstract | CrossRef Full Text | Google Scholar

Sedano H. O., Gorlin R. J. (1988). Frontonasal malformation as a field defect and in syndromic associations. Oral Surg. Oral Med. Oral Pathol. 65 (6), 704–710. doi:10.1016/0030-4220(88)90014-x

PubMed Abstract | CrossRef Full Text | Google Scholar

Sedano H. O., Cohen M. M., Jr., Jirasek J., Gorlin R. J. (1970). Frontonasal dysplasia. J. Pediatr. 76 (6), 906–913. doi:10.1016/s0022-3476(70)80374-2

PubMed Abstract | CrossRef Full Text | Google Scholar

So J., Suckow V., Kijas Z., Kalscheuer V., Moser B., Winter J., et al. (2005). Mild phenotypes in a series of patients with opitz GBBB syndrome with MID1 mutations. Am. J. Med. Genet. A 132A (1), 1–7. doi:10.1002/ajmg.a.30407

PubMed Abstract | CrossRef Full Text | Google Scholar

Tabler J. M., Rice C. P., Liu K. J., Wallingford J. B. (2016). A novel ciliopathic skull defect arising from excess neural crest. Dev. Biol. 417 (1), 4–10. doi:10.1016/j.ydbio.2016.07.001

PubMed Abstract | CrossRef Full Text | Google Scholar

Teng C. S., Ting M. C., Farmer D. T., Brockop M., Maxson R. E., Crump J. G. (2018). Altered bone growth dynamics prefigure craniosynostosis in a zebrafish model of saethre-chotzen syndrome. Elife 7, e37024. doi:10.7554/eLife.37024

PubMed Abstract | CrossRef Full Text | Google Scholar

Topa A., Rohlin A., Andersson M. K., Fehr A., Lovmar L., Stenman G., et al. (2020). NGS targeted screening of 100 Scandinavian patients with coronal synostosis. Am. J. Med. Genet. A 182 (2), 348–356. doi:10.1002/ajmg.a.61427

PubMed Abstract | CrossRef Full Text | Google Scholar

Trainor P. A. (2005). Specification and patterning of neural crest cells during craniofacial development. Brain Behav. Evol. 66 (4), 266–280. doi:10.1159/000088130

PubMed Abstract | CrossRef Full Text | Google Scholar

van der Walt S., Schönberger J. L., Nunez-Iglesias J., Boulogne F., Warner J. D., Yager N., et al. (2014). scikit-image: image processing in python. PeerJ 2, e453. doi:10.7717/peerj.453

PubMed Abstract | CrossRef Full Text | Google Scholar

Wilson N. R., Olm-Shipman A. J., Acevedo D. S., Palaniyandi K., Hall E. G., Kosa E., et al. (2016). SPECC1L deficiency results in increased adherens junction stability and reduced cranial neural crest cell delamination. Sci. Rep. 6, 17735. doi:10.1038/srep17735

PubMed Abstract | CrossRef Full Text | Google Scholar

Xu J., Iyyanar P. P. R., Lan Y., Jiang R. (2023). Sonic hedgehog signaling in craniofacial development. Differentiation 133, 60–76. doi:10.1016/j.diff.2023.07.002

PubMed Abstract | CrossRef Full Text | Google Scholar