ORIGINAL RESEARCH article

Front. Cell. Neurosci., 15 December 2022

Sec. Cellular Neuropathology

Volume 16 - 2022 | https://doi.org/10.3389/fncel.2022.1088099

Protective effect of anakinra on audiovestibular function in a murine model of endolymphatic hydrops

  • 1. Department of Otolaryngology-Head and Neck Surgery, Shandong Provincial ENT Hospital, Shandong University, Jinan, Shandong, China

  • 2. Shandong Provincial Vertigo and Dizziness Medical Center, Jinan, Shandong, China

  • 3. Laboratory of Vertigo Disease, Shandong Second Provincial General Hospital, Shandong Institute of Otorhinolaryngology, Jinan, Shandong, China

  • 4. Center of Clinical Laboratory, Shandong Second Provincial General Hospital, Jinan, Shandong, China

Abstract

Introduction:

Ménière’s disease (MD), a common disease in the inner ear, is characterized by an increase in endolymph in the cochlear duct and vestibular labyrinth. The pathophysiology of the condition appears to be the immune response. Studies have shown that basal levels of the IL-1β increased in some MD patients.

Methods:

Here, we used a murine model of endolymphatic hydrops (EH) to study the effect of anakinra on auditory and vestibular function. Mice were intraperitoneal injected with anakinra or saline before LPS by postauricular injection. Weight and disease severity were measured, histologic changes in auditory were assessed, and inflammation state was evaluated.

Results:

We found that anakinra therapy reduced LPS-induced EH, alleviated LPS-induced hearing loss and vestibular dysfunction, and inhibited the expression of the inflammatory cytokines and macrophage infiltration in the cochlea of mice. We further demonstrated that anakinra ameliorated the disorganization and degeneration of myelin sheath, and reduced the neuron damage in cochlea of EH mice.

Discussion:

Consequently, anakinra contributes to a promising therapeutic approach to MD, by restricting EH, alleviating auditory and vestibular function, inhibiting inflammation of the inner ear and protecting the cochlear nerve. Further investigations are needed to assess the potential therapeutic benefits of anakinra in patients with MD.

1 Introduction

Ménière’s disease (MD), a complex peripheral vestibular illness, is characterized by episodic vertigo, fluctuating low-to-medium frequencies of sensorineural hearing loss, tinnitus, and/or aural fullness (). Population-based studies report that MD affects about 3.5–513 people per 100,000 annually (). Endolymphatic hydrops (EH) underlies its classic pathological characteristics (; ). Numerous underlying factors have been postulated to be involved in MD, including anatomical variations in the temporal bone, genetic heterogeneity, allergies, immune dysfunction, and cellular and molecular mechanisms (; ; ; ; ; Na Zhang et al., 2022). Because the mechanisms underlying MD remain poorly understood, the clinical treatment strategy of MD is mainly to relieve the symptoms. Patients after treatment still suffer from recurrent vertigo and progressive hearing loss, and need hospital treatment frequently, which seriously affects the psychological status, quality of life and economic burden of patients (). Therefore, it is of great practical significance to study the pathogenesis and open up a more accurate treatment direction of MD.

Tissue-resident macrophages play critical roles in inflammation regulation for specific organ by releasing interferons, inflammatory cytokines, and chemokines. Studies have showed that there is a large population of macrophages in the inner ear, can be recruited from blood-borne monocytes to hair cells following damage induced by noise, ototoxic drugs, and aging (), which may be important to initiate local inflammatory response in the cochlear and vestibular system (Zhang et al., 2013; ; ).

Recent studies have shown that immunology is an important pathogenic factor of MD, although the molecular mechanisms remain poorly understood. It is estimated that a third of patients with MD may have immune dysfunction (). Our previous study suggested that MD is in a state of inflammation manifested in elevated levels of Th2-relative cytokines such as interleukin (IL)-4, IL-5, IL-10, and IL-13 in serum, vestibular end organ (VEO) and endolymphatic sac (ES) (Zhang et al., 2022). IL-1β, exerts strong proinflammation, overproduction by macrophages causes autoinflammatory diseases (; ; ). A study reported that compared to healthy controls, the levels of pro-inflammatory cytokines such as IL-1β, IL1-receptor antagonist (IL-1RA), tumor necrosis factor alpha (TNFα), and IL-6 released by peripheral blood mononuclear cells are elevated in 24 of 113 patients (20%) with MD (). Additionally, polymorphisms in IL-1 are associated with MD (; ; ). These studies suggest that IL-1β may play an important role in MD pathogenesis and IL-1β-targeted therapy may be a potential treatment for MD.

IL-1RA blocks the biological cascades and inhibits the biological effects of IL-1, acting as a natural decoy for IL-1β (). Anakinra, a recombinant form of IL-1RA, exerts anti-inflammatory and immunomodulatory roles. In 2001, it was approved by the US Food and Drug Administration for the treatment of rheumatoid arthritis (), and has shown significant therapeutic effects associated with an unparalleled record of safety on a broad spectrum autoimmune and inflammation diseases such as steroid-refractory immune effector cell-associated neurotoxicity syndrome (Wehrli et al., 2022), Coronavirus disease 2019 (), and gout flares (). Moreover, anakinra has been demonstrated to reverse or improve hearing loss and inflammatory of an atypical cryopyrin-associated periodic syndromes (). However, previous studies have neither revealed its role in MD development nor its regulatory mechanisms. Although MD is considered closely related to inflammation, whether anakinra have therapeutic effect on MD remains unexplored.

Animal models are an important tool for exploring the pathogenesis and treatment of diseases. At present, models of chronic EH have been established by surgical obstruction of the ES or systemic drugs such as aldosterone, vasopressin, or lipopolysaccharide (LPS) for cochlear and vestibular research (). For example, LPS induces moderate to severe hearing loss and EH (; ), and contributes to a better understanding of the MD pathogenesis.

In this study, we investigated whether blockade of IL-1β signaling by anakinra could inhibit EH and audiovestibular symptoms in LPS-induced EH murine model. We further focused on the alterations of inflammatory response and cochlear nerve. Taken together, this points to a potential and promising therapeutic strategy for MD.

2 Materials and methods

2.1 Mice and LPS injection

Wild type C57BL/6 mice (purchased from the Animal Center of Shandong university) were housed in a temperature-controlled (20–22°C) room that allows for a 12/12 h light/dark cycle. Sex-matched mice had access to food and drinking water, weighed 17–25 g, were 8–10 weeks old. All study protocols were approved by the Animal Care Committee of Shandong university and conformed to the National institutes of Health Guide for the Care and Use of Laboratory Animals.

C57BL/6 mice were subjected to LPS-induced EH. Briefly, mice were challenged with LPS (2 mg/kg, Sigma) solvent in saline by bilateral postauricular injection (p.a.) () once a day for 3 days, while control groups were p.a. injected with equivalent 0.9% normal saline (NS).

2.2 Anakinra injection

To evaluate the roles for anakinra in LPS-induced EH, mice were intraperitoneal injected (i.p.) with anakinra (10 mg/kg, Med Chem Express, Monmouth Junction, NJ, USA) or equivalent NS 30 min before LPS challenge. In all cases, hearing and vestibular function were tested on day 5 after first dose of LPS injection. After then, those mice were anesthetized by intraperitoneal injection with a mixture of xylazine (10 mg/kg) and ketamine (100 mg/kg) and inner ears were subjected to protein or RNA expression and EH analysis.

2.3 Frozen sections

The mouse cochleae were collected, fixed with 4% paraformaldehyde overnight at 4°C, continuously dehydrated in a sucrose phosphate-buffered saline mixture with sucrose concentrations increasing at 15, 20, and 30%, and ultimately encapsulated in an OCT compound (Tissue−Tek, Sakura Finetek, Torrance, USA). The embedded cochlea was sliced (5 μm thick) using a cryostat (Leica CM 1850, Nussloch, Germany) and the slice was stored at −80°C.

2.4 Histological and histomorphometric analyses

For hematoxylin-eosin (HE) staining, the cochlear sections were stained with hematoxylin (H8070, Solarbio life sciences, Beijing, China) for 3 min followed 2 min of staining with eosin (C0109, Beyotime, Shanghai, China) at room temperature.

For the immunofluorescence, the cochlear sections were permeabilized in 0.5% Triton X-100 for 30 min, and blocked with 10% donkey serum for 60 min at room temperature. The sections were incubated with the appropriate primary antibodies at 4°C overnight: anti-CD68 antibody (1:200; 97778, CST, Boston, USA), anti-Tuj1 (1:800; 5568, CST, Boston, USA), anti- Myelin Basic Protein (MBP, 1:200; 78896, CST, Boston, USA), and anti-Neurofilament 200 antibody (NF-200, 1:20; 2836, CST, Boston, USA). At last, the sections were incubated with the relevant fluorescently labeled secondary antibodies (1:1,000; Invitrogen, Carlsbad, CA, USA) and DAPI (1:1,000; D9542; Sigma-Aldrich, St. Louis, MO, USA) for 60 min in dark at room temperature. The sections were photographed under a laser scanning confocal microscope (Leica SP8; Leica, Wetzlar, Germany).

2.5 Rotarod test

The mice were placed on an electric rotating rod (ZH–600 B, Huaibei Zhenghua Biological Instruments Co., Ltd.). Gradually increased the speed to 30 rpm for 2 min. Each mouse was trained 2 times per day for 3 days and tested twice. Whereafter, the average time to fall off the rotarod in 2 trials was calculated for analysis.

2.6 Swim test

General vestibular function could be scored using swimming tests (). Mice were placed in a standard pool with a water level height of approximately 15 cm and a water temperature of around 25°C. Mice were scored for swimming posture, with mice swimming in the water (score 0), swimming irregularly (score 1), floating stationarily (score 2), or rolling underwater (score 3).

2.7 Vestibular evoked myogenic potentials (VEMPs)

Click-evoked VEMPs was recorded at the same time as electromyography potential after anesthesia. A custom-made holder previously reported () was used to fix the mice with a suspension wire behind the anterior teeth, so that the mice hyperextended their necks and raised their heads with free legs, holding them in a prone position. For the test, a needle electrode was inserted into the cervical extensor muscle and a reference electrode was placed in the midline of the cervico-occipital region, with the ground electrode placed on the back. Each animal was tested for VEMPs with a stimulation intensity of 100 dB nHL. The response threshold is the minimum threshold at which the waveform occurred. Its repeatability was verified by running it continuously (>3 times). Eventually, the latencies and amplitudes of the negative and positive peaks were recorded.

2.8 Vestibular ocular reflexes (VOR)

VOR test was conducted as reported previously (Yang et al., 2019). Briefly, mice were placed with a non-invasive animal-immobility setup. Horizontal eye position signals were recorded using a binocular VOG-based VFT system provided by Prof. Fangyi Chen’s team (Southern University of Science and Technology). An infrared camera equipped with a zoom lens (MI®, China) was placed on translation stages at 45° angles to the anteroposterior axis of the mouse. Illumination of the video recording was achieved by two near-infrared light-emitting diode lamps (940 nm, Chuntaxin®, China) that were connected to the camera. The eye tracker tracked the region of interest (ROI) at a speed of 60 frames/s. ROI, which contains the pupil, in each frame was automatically selected following a template-matching method. Then, an ellipse fit was used to determine the pupil center, and to extract the horizontal component derived from the eye movements. The obtained translation distances were converted to eye rotation angel for calibration. To measure the VOR responses, horizontal rotations were delivered at 20°/s (0.2, 0.5, 0.8, 1.0, 1.6, and 3.2 Hz). Exported eye-position data underwent Fourier transformation using the MATLAB 2016b software to yield amplitude data for eye movement. The VOR gain were calculated as the amplitude ratio between response and stimulus.

2.9 Auditory function evaluation

The auditory brainstem response (ABR) were measured as previously described (Zhang et al., 2020). The sound level started at a 90-dB sound pressure level (SPL) and then decreased by 5-dB to the acoustic threshold. The ABR threshold was determined at each frequency, which refers to the minimal SPL resulting in a reliable ABR recording with one or more distinguishable waves clearly identified by visual inspection. Repeated the process for low SPLs near the threshold to ensure the waveform consistency. Mice were housed in a sound isolation chamber and stimulated at sound frequencies of 4, 8, 12, 16, 24, and 32 kHz, each frequency to be repeated 1,024 times, and ABR responses were measured using the TDT System 3 (Tucker-Davis Technologies, Alachua, FL, USA). Briefly, a total of 15 mice (n = 5 per group) were anesthetized by intraperitoneal injection with a mixture of xylazine (10 mg/kg) and ketamine (100 mg/kg). The speaker was positioned 10 cm away from each mouse. Needle electrodes are inserted into the subcutaneous tissue of the mouse. The recording electrode is inserted into the cranial vault, the reference electrode is inserted in the subauricular mastoid region of the ipsilateral ear, and the grounding electrode is inserted on the back. Starting from a SPL of 90 dB and decreasing by 5 dB to the hearing threshold. The ABR threshold determined at each frequency was the minimum SPL that produced a reliable ABR recording where the eye could clearly identify the waveform. This process was repeated for lower SPLs close to the threshold to ensure consistency of the waveform.

2.10 Extraction of mRNA and quantitative real-time PCR (qRT-PCR)

Total RNA of the mouse cochlea was obtained using the RNA extraction kit (RNeasy Mini QIAcube Kit, QIAGEN, Hilden, Germany). The relative expression levels of RNA were calculated by reverse transcription and assayed using qRT-PCR (Eppendorf AG 22331 PCR, Hamburg, Germany). The qRT-PCR reaction mixture comprised 2 × SYBR Green Premix EX Taq (RR42LR, Takara Biotechnology, Shiga, Japan), cDNA template, forward and reverse primer, and deionized water. The qRT-PCR parameters involved an initial denaturation step at 95°C for 3 min, then denaturing at 95°C for 50 s, 60°C with annealing for 45 s, and a further extension at 72°C for 50 s across 40 cycles. The specificity of each PCR reaction was identified by the melting curve analysis. The primers used in this experiment were listed in Table 1. Actin was used to standard the target mRNA expression. The fold change for each gene was measured with the comparative Ct method (Zhang et al., 2020).

TABLE 1

GeneForward primersReverse primers
ActinGTCCCTCACCCTCCCAAAAGGCTGCCTCAACACCTCAACCC
IlbGAAATGCCACCTTTTGACAGTGTGGATGCTCTCATCAGGACAG
IlaTTGGTTAAATGACCTGCAACAGAGCGCTCACGAACAGTTG
Il6GGAGCCCACCAAGAACGATAGTCAAGTCACCAGCATCAGTCCCAAGAA
TnfCAGGCGGTGCCTATGTCTCCGATCACCCCGAAGTTCAGTAG
IfnbCAGCTCCAAGAAAGGACGAACGGCAGTGTAACTCTTCTGCAT
Il4CCAAACGTCCTCACAGCAACAGGCATCGAAAAGCCCGAA
Il5AATCAAACTGTCCGTGGGGGCTCTCCTCGCCACACTTCTC
Il8GGCTTTGCGTTGATTCTGGGAACTAGCGGTGTCCTGATTATCGTCCT
Mmp3TTTGATGCAGTCAGCACCCTCCGTCGTGCCCTCGTATAGCCCAGAA
Mmp13TCACCTGATTCTTGCGTGCTATGCTTTATCTGTGCTCATCTGTGGC

Primer sequences for quantitative RT-PCR.

2.11 Enzyme linked immunosorbent assay (ELISA)

Cytokine concentrations were determined using mouse IL-1β ELISA kit (ab197742; Abcam, Cambridge, MA, USA) depending on the manufacturer’s instructions. The signal was examined at 450 nm using a microplate reader (Bio-RAD).

2.12 Quantitative assessment of changes in endolymphatic space in cochlea

For quantitative assessment of the changes of EH in each cochlea, the length of the stretched Reissner’s membrane (L) and the ideal length of the Reissner’s membrane (L*) were measured as stated in the literature before (). The increase ratio of the length change of the Reissner’s membrane (IR-L = L/L* × 100%) was calculated to evaluate the level of EH in upper and lower turns. Image J software was used for the above measurements.

2.13 Quantitative evaluation of immunofluorescence staining

All quantification in the study was performed in a blinded fashion. Three fields that covered a similar area were obtained for the mid-modiolar cochlear sections. Images were analyzed using ImageJ v1.51. The eight-bit blue channel image was corrected for background illumination using the eight-bit blue channel of a bright-field image (Zhang et al., 2022). A threshold was then applied to the image to measure the total expression identified through specific immunostaining. The integrated optical density (IOD)/pixel of the fields was used to indicate the CD68 load and the expression of MBP and FN-200.

2.14 Statistical analysis

SPSS 13.0 software (SPSS Inc., USA) was applied for statistical analysis. All data are shown as the mean ± standard deviation (SD). One-way ANOVA followed by a Dunnett multiple comparisons test was used to compare more than 2 groups. P-values < 0.05 were regarded as statistically significant differences.

3 Results

3.1 Anakinra reduced the severity of LPS-induced EH in mice

Based on previous studies, LPS was injected subcutaneous behind the ear to induce EH model () to determine whether anakinra effects the clinically relevant MD process. Anakinra (i.p.) and/or LPS (p.a.) was injected to age- and sex-matched C57BL/6 mice for 3 consecutive days, and then we assessed the features of relevant EH and audiovestibular symptoms thus induced (Figure 1A). Ranging from 1 to 5 days, the body weight of control mice increased slowly, while the body weight in the LPS group decreased, which was significantly different from that in the control group from the second day (Figure 1B). Compared with LPS group, anakinra treatment significantly decreased the weight loss induced by LPS (Figure 1B). Here, we quantified and evaluated the EH level. As shown in Figures 1C, D and the LPS-mice showed enlargement of scala media and more severe EH in all cochlear turns than control mice. Next, we analyzed whether anakinra reduced the outcomes of LPS-induced EH. Indeed, we found that LPS mice treated with anakinra result in alleviating of EH in cochlear upper-turns, not in lower-turns (Figures 1C, D). These data showed that anakinra decreased the severity of hydrops in LPS-induced EH mouse model.

FIGURE 1

3.2 Anakinra alleviated LPS-induced vestibular dysfunction in mice

Vertigo caused by vestibular dysfunction is one of main clinical symptoms of MD, we next performed experiments to determine whether anakinra alleviated the vestibular symptoms of LPS-induced EH murine model. To evaluate the vestibular function, we performed behavioral tests and electrophysiological examination for mice (). The mice were subjected to rotarod tests and the time remained on the rotating rod with increasing acceleration were recorded. After training, LPS-challenged mice performed shorter latency time to fall from accelerating rotarod than the control mice, while LPS mice treated with anakinra increased the residence time on the rotarod (Figure 2A and Supplementary Video 1). For swim test, the control group displayed normal swimming (score 0), while the scores were significantly raised for LPS-treated mice, and reversed after anakinra treatment (Figure 2B). The positive peak (P1, ) and negative peak (N1, ▲) latency in VEMPs in response to clicks presented at 100 dB nHL were performed and shown in Figure 3A. After administration of LPS, the mice showed increased threshold compared to those control mice, but no differences in the threshold or amplitudes between P1 and N1 or latency of P1 and N1 (Figures 3B, C). Indeed, anakinra treatment decreased the threshold and latency of P1 and N1 (Figures 3B, C). We further examined the function of horizontal semicircular canal using horizontal VOR test delivered at 20°/s (0.2, 0.5, 0.8, 1.0, 1.6, and 3.2 Hz), and the VOR gain and phase were calculated (Figure 3D). The LPS group showed a significant decrease of VOR gain from 0.2 to 3.2 Hz, and the increased phase was identified at 0.8, 1.0, and 3.2 Hz compared to NS group (Figure 3E). In contrast, LPS mice treated with anakinra resulted in reversing the gain decreases and phase increases (Figure 3E). Together, these data showed that anakinra alleviated damage to vestibular function in LPS-induced EH mouse model.

FIGURE 2

FIGURE 3

3.3 Anakinra ameliorated LPS-induced hearing loss in mice

To evaluate the auditory function, we measured click-evoked and tone burst-evoked (8–32 kHz) ABR. The results showed that click-induced ABR threshold were considerably higher in LPS mice compared to saline group, these effects were significantly reversed by anakinra therapy (Figures 4A, B). For tone burst-induced ABR, LPS induced the threshold and threshold shift increases in the frequency range from 8 to 24 kHz, not in 32 kHz (Figure 4C), which consistent with the clinical manifestation of low-to-medium frequencies of sensorineural hearing loss in patients with MD. Indeed, we found that mice treated with anakinra reversed threshold and threshold shift increases in the frequency range from 8 to 16 kHz caused by LPS (Figure 4C). Altogether, these data showed that anakinra ameliorated damage to auditory function especially in low-to-medium frequencies in LPS-induced EH mouse model.

FIGURE 4

3.4 Anakinra inhibited LPS-induced inflammation and macrophage infiltration

As per our previous report (Zhang et al., 2022), VEO and ES of patients with MD were associated with elevated expression of inflammatory cytokines. Microarray analysis demonstrated the increased expression levels of inflammatory cytokines in the cochlea of mice treated with LPS (). Consistent with these findings, mRNA expressions of inflammatory cytokines Il1b, Il1a, Il6, Tnf, Ifnb, Il4, Il5, and Il8 were elevated in the cochlea of LPS-treated mice (Figure 5A). Elevated matrix metalloproteinase-3 (MMP3) level affects hearing function (). Real-time PCR also revealed that the mRNA levels of Mmp3 and Mmp13 were upregulated in the cochlea of LPS-treated mice relative to control mice (Figure 5A). Intervention with anakinra decreased the mRNA expression levels of any of the above genes in LPS-treated mice (Figure 5A). In addition, our results showed that the serum IL-1β in LPS-treated mice was significantly increased, and effectively reduced when intervention with anakinra (Figure 5B).

FIGURE 5

Macrophage is the main group and considered to play an important role in the microenvironment of the cochlea (). We next performed immunofluorescence to determine if anakinra similarly reduced macrophages numbers in the cochlea. Compared with control mice, LPS-induced EH was associated with elevated numbers of macrophages in the cochlea (Figure 5C). Indeed, LPS mice treated with anakinra attenuated the infiltration of macrophages (Figure 5C). Together, these data suggested that anakinra inhibited inflammation response and macrophage infiltration in LPS-induced EH mouse model.

3.5 Anakinra protected LPS-induced neurons and myelin sheath damage

MBP is one of the major myelin protein produced by oligodendrocytes and Schwann cells in the nervous system, and plays a critical role in maintaining the compact structure of the myelin sheath (). Class III β-tubulin (Tuj1) stains the microtubule components of type I spiral ganglion neurons (SGNs) (). To evaluate the effects of anakinra on cochlear nerve, we performed immunofluorescence staining to analyze myelination of SGN fibers and nerve fiber architecture using anti-MBP and anti-NF-200-antibodies, respectively. Focusing on the center of SGNs, we found that MBP surrounded SGNs and their processed (Figure 6A). In control mice, high-resolution confocal images revealed strong immunoreactivity of MBP was seen in the central myelinated processes of the cochlear nerve, and most SGNs were intact and enclosed by a MBP+ myelin sheath (Figures 6B–D). In the LPS-treated mice, MBP was expressed in the same locations as in control mice. However, abnormalities in the staining pattern and weaker immunostaining reaction for MBP were seen in the SGNs of LPS mice compared to that in NS control mice. Numerous disruptions were present in the MBP+ myelin sheath surrounding LPS SGNs in cochlear upper turn suggesting an excess of demyelinated axons and decreased myelin integrity in LPS-treated SGNs (Figure 6B). The MBP+ myelin sheaths, Tuj1+ terminations and axons in many neurons were discontinuous and in some cases appeared to be missing altogether (Figures 6C, D). In addition, LPS mice treated with anakinra upregulated the expression of MPB and reduced the loss of myelin sheath and SGNs. NF-200 is a neuronal structural protein (). A marked decrease in immunostaining intensity for NF-200 was seen in SGNs of LPS group compared to NS group, while anakinra reversed the loss of NF-200 signal (Figure 6E). Together, these results demonstrated that anakinra protected structural damage of cochlear nerve in EH mouse cochlea.

FIGURE 6

4 Discussion

IL-1β is a strong pro-inflammatory cytokine which is mainly produced by activated macrophages and is widely regarded as a hallmark of inflammatory gene cascades (Weber et al., 2010). Consistent with high basal levels of IL-1β released by peripheral blood mononuclear cells in MD (), our study found that LPS induced abnormal increase of IL-1β and macrophage infiltration in EH murine model, accompanied by elevated serum IL-1β. Many immune-related diseases are accompanied by immune imbalance and increased pro-inflammatory cytokines (; ), which is also found in our MD-relevant murine model. The findings further suggest that IL-1β signal plays an important role in the pathogenesis of MD.

The abnormal IL-1β in the inner ear may be secreted by macrophage. Macrophage is the main group and is considered to play an important role in the innate and adaptive defense and tolerance in the inner ear (; ). Resident macrophages in inner ear proliferate slowly, and renewal is primarily by the infiltration and differentiation of circulating bone-marrow-derived cells (), whether IL-1β in the inner ear is secreted by resident macrophages or by macrophages derived from bone marrow cells is remain unknown. Studies have shown that macrophages effect blood/labyrinth barrier integrity, and loss of macrophages is associated with tissue edema (Zhang et al., 2012). More importantly, LPS and ototoxic drugs activate macrophage and initiate local inflammatory response in the inner ear (Zhang et al., 2013, 2020; ). Moreover, whether the local immune disorder leads to the systemic immune imbalance, or the local abnormality caused by the systemic imbalance remains to be elucidated, which need further study.

IL-1 receptor (IL-1R) promotes or inhibits inflammation and immune response, notably innate immune reactions, and the downstream signal transduction regulates the expression of various proinflammatory cytokines, such as IL-1, IL-6, IL-8, and TNF-a (). IL-1RA binds to IL-1R with a high affinity and competitively interferes with the binding of IL-1 to IL-1R as an inhibitory protein for IL-1 activity. Deficiency in IL-1RA due to mutation results in autoinflammatory disease, underlining the critical role of IL-1RA in regulating inflammation (). Anakinra is a recombinant, non-glycosylated form of human IL-1RA, exerts anti-inflammatory and immunomodulatory roles by binding to IL-1R and blocking its activity. The beneficial effects of anakinra have been demonstrated in the treatment of a wide range of disorders, including auto-inflammatory disorders (; ), seizure (), pericarditis (), and gout (), wherein the pathogenesis is associated with an excessive IL-1β expression. Study has demonstrated that anakinra improved hearing loss and inflammatory in patients of atypical cryopyrin-associated periodic syndromes (). Here, we found that anakinra reduced EH, protected auditory and vestibular function, inhibited never injury, and effectively inhibited the local and systemic inflammation in a murine model of EH, which providing a new direction for clinical treatment of MD. Given that in many diseases, anakinra plays a protective role by inhibiting IL-1β signal, we speculate that anakinra alleviates EH and audiovestibular symptoms and pathological damage by inhibiting IL-1β inflammation. However, the exact and molecular mechanisms remain unexplored.

Since its introduction in 2002, thousands of patients have received anakinra for numerous indications, with a remarkable record of safety and tolerance (; ; ; ; ). Our study also found that anakinra inhibited weight loss induced by LPS in mice, which further validates the well-tolerated of anakinra and provides theoretical basis for future clinical trials.

Although MD is a common disease in otology, its pathogenesis is still not clear. One of the limitations of the study is that the phenotypes of EH model currently existed do not fully mimic the clinical characteristics of MD. Previous studies directly injected LPS to the scala media, although it caused obvious hearing loss, but no vestibular dysfunction (). Intraperitoneal injection or middle ear injection of LPS resulted in inflammation in the inner ear (; ). In this study, postauricular injection of LPS not only induced EH and serious low-to-medium frequencies hearing loss, also caused vestibular dysfunction, which comprehensively imitated the clinical symptoms of MD. Therefore, this mode of administration provided a good animal model for MD, which is beneficial to the study of the pathological mechanism, prevention and treatment of MD. However, animal studies can never replace clinical experiments, but provide basis for clinical experiments, all animal studies need be verified in more rigorous clinical trial.

As per our previous report (Zhang et al., 2022), there are elevated cytokines in the inner ear in VEO and ES of patients with MD. In addition, early study has shown that administration of LPS activated many more cytokines and provoked an inflammatory response in mice and hair cells (; ). Elevated MMP3 level also affected hearing function (). Our study found that except IL-1β, LPS increased expression of many cytokines (Il4, Il1a, Il6, Tnf, Ifnb, and Il8) and Mmp (Mmp3 and Mmp13). Interestingly, anakinra as an IL-1RA also inhibited the expression of the above genes. IL-1β upregulates the expression of many inflammatory cytokines, such as MMP3 and MMP13 (; ). Studies show that anakinra effectively inhibited IL-8 and IL-6 secretion induced by IL-1β (; ), which is consistent with our results and suggest that anakinra plays a protective role by inhibiting these inflammatory mediators. Do these inflammatory mediators play a role in LPS-induced auditory and vestibular dysfunction? Case report has shown that Omalizumab by targeted immunoglobulin E completely resolved debilitating vertigo and nausea without any associated side effects in MD (). Does targeted these inflammatory mediators (such as IL-6 receptor blockers sarilumab, anti-TNF agent infliximab) to regulate immune balance have a therapeutic effect on MD? The effectiveness of these immunotherapies will further verify that MD is an immune mediated disease.

In this study, we found that most of SGNs in the control group were enveloped by MBP+ myelin sheath. In contrast, in the LPS group, disorganization and degeneration of the myelin sheath in the cochlear nerve as well as the loss of SGNs were shown. In all complex nervous systems, neurons coexist with glial cells, which suggests that neuron-glial interaction is a main feature of neurological function. In the peripheral niveous nervous system, Schwann cells not only myelinate axons and neuron bodies, but also play an important role in maintaining the long-term functional integrity and survival of neuron (). Unlike in human, the somata of most mouse SGNs are myelinated (Xing et al., 2012). Importantly, loss of Schwann cells and intact myelin causes progressive axon degeneration and local inflammation, contributing to various peripheral neuropathies (). Thus, it is highly likely that the LPS-induced loss of myelin sheath integrity contributes to the degeneration of SGNs and declines in cochlear nerve function. Overload of IL-1β secretion have been shown to promote demyelination and deteriorate the severity of inflammatory neurodegenerative experimental autoimmune encephalomyelitis (; ). In our study, anakinra effectively alleviated cochlear nerve injury and reduced the loss of MBP by inhibiting IL-1β response, which further proves that LPS-induced neurodegeneration is at least partly mediated by IL-1β.

Cochlear nerve and vestibular nerve are very similar in terms of anatomy and development (). Both cochlear and vestibular nerve exhibited similar damage following exposure to ototoxic agent (Ye et al., 2019). Therefore, we only demonstrated the changes of the cochlear nerve, did not pay attention to the vestibular nerve. Whether vestibular dysfunction induced by LPS is caused by injury of vestibular myelin sheath and nerve fibers remains to be further investigated. Although no attempt was made to study the effect of hair cell in our study, study has shown that neuronal degeneration occurs independent of hair cell loss (). It is unclear whether LPS-induced myelin loss is a primary event which leads to secondary neurodegeneration, and vice versa. Further molecular and functional studies of the myelin protein are needed to better understand the causes of demyelination and axon degeneration.

In summary, our results demonstrated that anakinra attenuated EH, improved auditory and vestibular function, protected cochlear nerve in a murine model of EH. Furthermore, anakinra reduced the expressions of the inflammatory cytokines, macrophage infiltration and neurodegeneration in the cochlea of mice. These findings suggest that targeting IL-1 signaling may be a promising approach for treating MD.

Statements

Data availability statement

The original contributions presented in this study are included in the article/Supplementary material, further inquiries can be directed to the corresponding author/s.

Ethics statement

The animal study was reviewed and approved by Shandong Provincial ENT Hospital, Cheeloo College of Medicine, Shandong University Ethics Committee.

Author contributions

HW, DZ, and NL designed the study. NZ, JL, and YLiu performed experiments. NZ and NL drafted the manuscript. SW and JG analyzed the data. XL, YS, LK, and WX housed the mice. All authors revised and approved the final version of the manuscript.

Funding

This study was supported by the Major Program of National Natural Science Foundation of China (no. 82196821), the Major Fundamental Research Program of the Natural Science Foundation of Shandong Province, China (no. ZR2021ZD40), The Taishan Scholar Foundation of Shandong Province (no. ts20130913), the National Natural Science Foundation of China (nos. 82171150 and 82271172), and the Natural Science Foundation of Shandong Province (nos. ZR2020MH179 and ZR2021MH385).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fncel.2022.1088099/full#supplementary-material

References

  • 1

    AksentijevichI.MastersS.FergusonP.DanceyP.FrenkelJ.van Royen-KerkhoffA.et al (2009). An autoinflammatory disease with deficiency of the interleukin-1-receptor antagonist.N Engl J. Med.36024262437. 10.1056/NEJMoa0807865

  • 2

    AlexanderT.HarrisJ. (2010). Current epidemiology of Meniere’s syndrome.Otolaryngol. Clin. North Am.43965970. 10.1016/j.otc.2010.05.001

  • 3

    BaeS.YooJ.ChoeY.KwakS.ChoiJ.JungJ.et al (2021). Neutrophils infiltrate into the spiral ligament but not the stria vascularis in the cochlea during lipopolysaccharide-induced inflammation.Theranostics1125222533. 10.7150/thno.49121

  • 4

    BourqueP.ChardonJ.MassieR. (2015). Autoimmune peripheral neuropathies.Clin. Chim. Acta.4493742. 10.1016/j.cca.2015.02.039

  • 5

    BrownD.SokolicL.FungA.PastrasC. (2018). Response of the inner ear to lipopolysaccharide introduced directly into scala media.Hear. Res.370105112. 10.1016/j.heares.2018.10.007

  • 6

    CannaS.de JesusA.GouniS.BrooksS.MarreroB.LiuY.et al (2014). An activating NLRC4 inflammasome mutation causes autoinflammation with recurrent macrophage activation syndrome.Nat. Genet.4611401146. 10.1038/ng.3089

  • 7

    CavalliG.DinarelloC. (2018). Anakinra Therapy for Non-cancer Inflammatory Diseases.Front. Pharmacol.9:1157. 10.3389/fphar.2019.00148

  • 8

    ChenG.KimY.LiH.LuoH.LiuD.ZhangZ.et al (2017). PD-L1 inhibits acute and chronic pain by suppressing nociceptive neuron activity via PD-1.Nat. Neurosci.20917926. 10.1038/nn.4571

  • 9

    ClopathC.BaduraA.De ZeeuwC.BrunelN. (2014). A cerebellar learning model of vestibulo-ocular reflex adaptation in wild-type and mutant mice.J. Neurosci.3472037215. 10.1523/JNEUROSCI.2791-13.2014

  • 10

    DereberyM.BerlinerK. (2010). Allergy and its relation to Meniere’s disease.Otolaryngol. Clin. North Am.4310471058. 10.1016/j.otc.2010.05.004

  • 11

    DinarelloC. (2018). Overview of the IL-1 family in innate inflammation and acquired immunity.Immunol. Rev.281827. 10.1111/imr.12621

  • 12

    FantuzziG.DinarelloC. (1996). The inflammatory response in interleukin-1 beta-deficient mice: Comparison with other cytokine-related knock-out mice.J. Leukoc. Biol.59489493. 10.1002/jlb.59.4.489

  • 13

    FeiJ.LiangB.JiangC.NiH.WangL. (2019). Luteolin inhibits IL-1beta-induced in fl ammation in rat chondrocytes and attenuates osteoarthritis progression in a rat model.Biomed Pharmacother.10915861592. 10.1016/j.biopha.2018.09.161

  • 14

    FrejoL.Gallego-MartinezA.RequenaT.Martin-SanzE.Amor-DoradoJ.Soto-VarelaA.et al (2018). Proinflammatory cytokines and response to molds in mononuclear cells of patients with Meniere disease.Sci. Rep.8:5974. 10.1038/s41598-018-23911-4

  • 15

    FurutaT.TeranishiM.UchidaY.NishioN.KatoK.OtakeH.et al (2011). Association of interleukin-1 gene polymorphisms with sudden sensorineural hearing loss and Meniere’s disease.Int. J. Immunogenet.38249254. 10.1111/j.1744-313X.2011.01004.x

  • 16

    GabayC.LamacchiaC.PalmerG. (2010). IL-1 pathways in inflammation and human diseases.Nat. Rev. Rheumatol.6232241. 10.1038/nrrheum.2010.4

  • 17

    GarcesK. (2001). Anakinra: Interleukin-1 receptor antagonist therapy for rheumatoid arthritis.Issues Emerg. Health Technol.30365380. 10.1016/j.rdc.2004.01.005

  • 18

    GazquezI.Soto-VarelaA.AranI.SantosS.BatuecasA.TrinidadG.et al (2011). High prevalence of systemic autoimmune diseases in patients with Menière’s disease.PLoS One.6:e26759. 10.1371/journal.pone.0026759

  • 19

    GrecoA.GalloA.FusconiM.MarinelliC.MacriG.de VincentiisM. (2012). Meniere’s disease might be an autoimmune condition?Autoimmun. Rev.11731738. 10.1016/j.autrev.2012.01.004

  • 20

    HallpikeC.CairnsH. (1938). Observations on the pathology of Meniere’s syndrome: (Section of Otology).Proc. R. Soc. Med.3113171336. 10.1177/003591573803101112

  • 21

    HeZ.ZouS.LiM.LiaoF.WuX.SunH.et al (2020). The nuclear transcription factor FoxG1 affects the sensitivity of mimetic aging hair cells to inflammation by regulating autophagy pathways.Redox Biol.28:101364. 10.1016/j.redox.2019.101364

  • 22

    HuangX.FengZ.JiangY.LiJ.XiangQ.GuoS.et al (2019). VSIG4 mediates transcriptional inhibition of and β in macrophages.Sci. Adv.5:eaau7426. 10.1126/sciadv.aau7426

  • 23

    InoueM.WilliamsK.GunnM.ShinoharaM. (2012). NLRP3 inflammasome induces chemotactic immune cell migration to the CNS in experimental autoimmune encephalomyelitis.Proc. Natl. Acad. Sci. U.S.A.1091048010485. 10.1073/pnas.1201836109

  • 24

    JanssenC.Oude VoshaarM.VonkemanH.JansenT.JanssenM.KokM.et al (2019). Anakinra for the treatment of acute gout flares: A randomized, double-blind, placebo-controlled, active-comparator, non-inferiority trial.Rheumatology.5813441352. 10.1093/rheumatology/key402

  • 25

    JefferyN.SpoorF. (2004). Prenatal growth and development of the modern human labyrinth.J. Anat.2047192. 10.1111/j.1469-7580.2004.00250.x

  • 26

    JesusA.Goldbach-ManskyR. (2014). IL-1 blockade in autoinflammatory syndromes.Annu. Rev. Med.65223244. 10.1146/annurev-med-061512-150641

  • 27

    Kampfe NordstromC.Danckwardt-LilliestromN.LaurellG.LiuW.Rask-AndersenH. (2018). The human endolymphatic sac and inner ear immunity: Macrophage interaction and molecular expression.Front. Immunol.9:3181. 10.3389/fimmu.2018.03181

  • 28

    KatagiriY.TakumidaM.HirakawaK.AnnikoM. (2014). Long-term administration of vasopressin can cause Meniere’s disease in mice.Acta Otolaryngol.1349901004. 10.3109/00016489.2014.902989

  • 29

    KhayataM.ShahN.VermaB.GiugniA.AlkharabshehS.AsherC.et al (2020). Usefulness of interleukin-1 receptor antagonists in patients with recurrent pericarditis.Am. J. Cardiol.127184190. 10.1016/j.amjcard.2020.03.041

  • 30

    KooistraE.WaaldersN.GrondmanI.JanssenN.de NooijerA.NeteaM.et al (2020). Anakinra treatment in critically ill COVID-19 patients: A prospective cohort study.Crit. Care24:688. 10.1186/s13054-020-03364-w

  • 31

    KouhiA.ShakeriS.YazdaniN.ShababiN.MohseniA.MohseniA.et al (2021). Association of pro-inflammatory cytokine gene polymorphism with Meniere’s disease in an iranian sample.Iran. J. Allergy Asthma Immunol.20734739. 10.18502/ijaai.v20i6.8024

  • 32

    Kuemmerle-DeschnerJ.GautamR.GeorgeA.RazaS.LomaxK.HurP. (2020). Systematic literature review of efficacy/effectiveness and safety of current therapies for the treatment of cryopyrin-associated periodic syndrome, hyperimmunoglobulin D syndrome and tumour necrosis factor receptor-associated periodic syndrome.RMD Open6:e001227. 10.1136/rmdopen-2020-001227

  • 33

    LaiY.MuscalE.WellsE.ShuklaN.EschbachK.Hyeong LeeK.et al (2020). Anakinra usage in febrile infection related epilepsy syndrome: An international cohort.Ann. Clin. Transl. Neurol.724672474. 10.1002/acn3.51229

  • 34

    LeeS.KimS.HanK.Woong ChoiJ.Byung ChaeH.Yeon ChoiD.et al (2022). Microarray analysis of lipopolysaccharide-induced endotoxemia in the cochlea.Gene.823:146347. 10.1016/j.gene.2022.146347

  • 35

    LiJ.YuL.XiaR.GaoF.LuoW.JingY. (2013). Postauricular hypodermic injection to treat inner ear disorders: Experimental feasibility study using magnetic resonance imaging and pharmacokinetic comparison.J. Laryngol. Otol.127239245. 10.1017/S0022215113000017

  • 36

    LiL.WangY.AnL.KongX.HuangT. (2017). A network-based method using a random walk with restart algorithm and screening tests to identify novel genes associated with Meniere’s disease.PLoS One.12:e0182592. 10.1371/journal.pone.0182592

  • 37

    LinthicumF.FayadJ. (2009). Spiral ganglion cell loss is unrelated to segmental cochlear sensory system degeneration in humans.Otol. Neurotol.30418422. 10.1097/MAO.0b013e31819a8827

  • 38

    LiuW.Danckwardt-LilliestromN.Schrott-FischerA.GlueckertR.Rask-AndersenH. (2021b). Distribution of immune cells including macrophages in the human cochlea.Front. Neurol.12:781702. 10.3389/fneur.2021.781702

  • 39

    LiuW.MolnarM.GarnhamC.BenavH.Rask-AndersenH. (2018). Macrophages in the human cochlea: Saviors or predators-a study using super-resolution immunohistochemistry.Front. Immunol.9:223. 10.3389/fimmu.2018.00223

  • 40

    LiuW.XuL.WangX.ZhangD.SunG.WangM.et al (2021a). PRDX1 activates autophagy via the PTEN-AKT signaling pathway to protect against cisplatin-induced spiral ganglion neuron damage.Autophagy1741594181. 10.1080/15548627.2021.1905466

  • 41

    NakanishiH.KawashimaY.KurimaK.ChaeJ.RossA.Pinto-PatarroyoG.et al (2017a). NLRP3 mutation and cochlear autoinflammation cause syndromic and nonsyndromic hearing loss DFNA34 responsive to anakinra therapy.Proc. Natl. Acad. Sci. U.S.A.114E7766E7775. 10.1073/pnas.1702946114

  • 42

    NakashimaT.PyykkoI.ArrollM.CasselbrantM.FosterC.ManzoorN.et al (2016). Meniere’s disease.Nat. Rev. Dis. Primers.2:16028. 10.1038/nrdp.2016.28

  • 43

    NarayananK.ParkH. (2015). Toll/interleukin-1 receptor (TIR) domain-mediated cellular signaling pathways.Apoptosis20196209. 10.1007/s10495-014-1073-1

  • 44

    NasutionM.HaryunaT. (2019). Elevated matrix metalloproteinase-3 level may affect hearing function in patients with rheumatoid arthritis.J. Chin. Med. Assoc.82272276. 10.1097/JCMA.0000000000000036

  • 45

    NaveK.TrappB. (2008). Axon-glial signaling and the glial support of axon function.Annu. Rev. Neurosci.31535561. 10.1146/annurev.neuro.30.051606.094309

  • 46

    Nist-LundC.PanB.PattersonA.AsaiY.ChenT.ZhouW.et al (2019). Improved TMC1 gene therapy restores hearing and balance in mice with genetic inner ear disorders.Nat. Commun.10:236. 10.1038/s41467-018-08264-w

  • 47

    OkunoT.SandoI. (1987). Localization, frequency, and severity of endolymphatic hydrops and the pathology of the labyrinthine membrane in Meniere’s disease.Ann. Otol. Rhinol. Laryngol.96438445. 10.1177/000348948709600418

  • 48

    OliveraI.Sanz-PamplonaR.BolanosE.RodriguezI.EtxeberriaI.CirellaA.et al (2022). A Therapeutically Actionable Protumoral Axis of Cytokines Involving IL-8. TNFalpha, and IL-1beta.Cancer Discov.1221402157. 10.1158/2159-8290.CD-21-1115

  • 49

    O’MalleyJ.NadolJ.Jr.McKennaM. (2016). Anti CD163+, Iba1+, and CD68+ Cells in the adult human inner ear: Normal distribution of an unappreciated class of macrophages/microglia and implications for inflammatory otopathology in humans.Otol. Neurotol.3799108. 10.1097/MAO.0000000000000879

  • 50

    RequenaT.Espinosa-SanchezJ.CabreraS.TrinidadG.Soto-VarelaA.Santos-PerezS.et al (2014). Familial clustering and genetic heterogeneity in Meniere’s disease.Clin. Genet.85245252. 10.1111/cge.12150

  • 51

    SaagK.KhannaP.KeenanR.OhlmanS.Osterling KoskinenL.SparveE.et al (2021). A Randomized, phase II study evaluating the efficacy and safety of anakinra in the treatment of gout flares.Arthritis Rheumatol.7315331542. 10.1002/art.41699

  • 52

    SajjadiH.PaparellaM. (2008). Meniere’s disease.Lancet.372406414. 10.1016/S0140-6736(08)61161-7

  • 53

    SeoY.BrownD. (2020). Experimental animal models for Meniere’s disease: A mini-review.J. Audiol. Otol.245360. 10.7874/jao.2020.00115

  • 54

    SheykholeslamiK.MegerianC.ZhengQ. (2009). Vestibular evoked myogenic potentials in normal mice and Phex mice with spontaneous endolymphatic hydrops.Otol. Neurotol.30535544. 10.1097/MAO.0b013e31819bda13

  • 55

    ShiX. (2010). Resident macrophages in the cochlear blood-labyrinth barrier and their renewal via migration of bone-marrow-derived cells.Cell Tissue Res.3422130. 10.1007/s00441-010-1040-2

  • 56

    SiebenhaarF.KühnW.ZuberbierT.MaurerM. (2007). Successful treatment of cutaneous mastocytosis and Ménière disease with anti-IgE therapy.J. Allergy Clin. Immunol.120213215. 10.1016/j.jaci.2007.05.011

  • 57

    SimonsM.TrotterJ. (2007). Wrapping it up: The cell biology of myelination.Curr. Opin. Neurobiol.17533540. 10.1016/j.conb.2007.08.003

  • 58

    SinghA.FechtnerS.ChourasiaM.SicaloJ.AhmedS. (2019). Critical role of IL-1alpha in IL-1beta-induced inflammatory responses: Cooperation with NF-kappaBp65 in transcriptional regulation.FASEB J.3325262536. 10.1096/fj.201801513R

  • 59

    SmolenJ.RedlichK.ZwerinaJ.AletahaD.SteinerG.SchettG. (2005). Pro-inflammatory cytokines in rheumatoid arthritis: Pathogenetic and therapeutic aspects.Clin. Rev. Allergy Immunol.28239248. 10.1385/CRIAI:28:3:239

  • 60

    StoffelsB.HupaK.SnoekS.van BreeS.SteinK.SchwandtT.et al (2014). Postoperative ileus involves interleukin-1 receptor signaling in enteric glia.Gastroenterology14617687e1. 10.1053/j.gastro.2013.09.030

  • 61

    TakumidaM.AkagiN.AnnikoM. (2008). A new animal model for Meniere’s disease.Acta Otolaryngol.128263271. 10.1080/00016480701497436

  • 62

    TianM.LiuW.ZhangQ.HuangY.LiW.WangW.et al (2020). MYSM1 represses innate immunity and autoimmunity through suppressing the cGAS-STING pathway.Cell Rep.33:108297. 10.1016/j.celrep.2020.108297

  • 63

    TyrrellJ.WhinneyD.TaylorT. (2016). The cost of Meniere’s disease: A novel multisource approach.Ear Hear.37e202e209. 10.1097/AUD.0000000000000264

  • 64

    WeberA.WasiliewP.KrachtM. (2010). Interleukin-1 (IL-1) pathway.Sci. Signal.3:cm1. 10.1126/scisignal.3105cm1

  • 65

    WehrliM.GallagherK.ChenY.LeickM.McAfeeS.El-JawahriA.et al (2022). Single-center experience using anakinra for steroid-refractory immune effector cell-associated neurotoxicity syndrome (ICANS).J. Immunother. Cancer10:e003847. 10.1136/jitc-2021-003847

  • 66

    XingY.SamuvelD.StevensS.DubnoJ.SchulteB.LangH. (2012). Age-related changes of myelin basic protein in mouse and human auditory nerve.PLoS One.7:e34500. 10.1371/journal.pone.0034500

  • 67

    YangX.ZhouS.WuJ.LiaoQ.WangC.LiuM.et al (2019). Surgery-free video-oculography in mouse models: Enabling quantitative and short-interval longitudinal assessment of vestibular function.Neurosci. Lett.696212218. 10.1016/j.neulet.2018.12.036

  • 68

    YeH.XingY.ZhangL.ZhangJ.JiangH.DingD.et al (2019). Bilirubin-induced neurotoxic and ototoxic effects in rat cochlear and vestibular organotypic cultures.Neurotoxicology717586. 10.1016/j.neuro.2018.12.004

  • 69

    ZhangF.ZhangJ.NengL.ShiX. (2013). Characterization and inflammatory response of perivascular-resident macrophage-like melanocytes in the vestibular system.J. Assoc. Res. Otolaryngol.14635643. 10.1007/s10162-013-0403-2

  • 70

    ZhangN.CaiJ.XuL.WangH.LiuW. (2020). Cisplatin-induced stria vascularis damage is associated with inflammation and fibrosis.Neural Plasticity2020113. 10.1155/2020/8851525

  • 71

    ZhangN.LyuY.GuoJ.LiuJ.SongY.FanZ.et al (2022). Bidirectional transport of IgE by CD23 in the inner ear of patients with Meniere’s disease.J. Immunol.208827838. 10.4049/jimmunol.2100745

  • 72

    ZhangW.DaiM.FridbergerA.HassanA.DegagneJ.NengL.et al (2012). Perivascular-resident macrophage-like melanocytes in the inner ear are essential for the integrity of the intrastrial fluid-blood barrier.Proc. Natl. Acad. Sci. U.S.A.1091038810393. 10.1073/pnas.1205210109

Summary

Keywords

anakinra, IL-1β, endolymphatic hydrops, Ménière’s disease, demyelination

Citation

Zhang N, Li N, Wang S, Xu W, Liu J, Lyu Y, Li X, Song Y, Kong L, Liu Y, Guo J, Fan Z, Zhang D and Wang H (2022) Protective effect of anakinra on audiovestibular function in a murine model of endolymphatic hydrops. Front. Cell. Neurosci. 16:1088099. doi: 10.3389/fncel.2022.1088099

Received

03 November 2022

Accepted

29 November 2022

Published

15 December 2022

Volume

16 - 2022

Edited by

Chen Chen, Stanford University, United States

Reviewed by

Qing Sun, PLA General Hospital, China; Angela Ballesteros, National Institute on Deafness and Other Communication Disorders (NIH), United States

Updates

Copyright

*Correspondence: Daogong Zhang, Haibo Wang,

†These authors have contributed equally to this work and share first authorship

This article was submitted to Cellular Neuropathology, a section of the journal Frontiers in Cellular Neuroscience

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics