Abstract
Rapamycin, an inhibitor of mTOR complex 1 (mTORC1), improves insulin sensitivity in acute studies in vitro and in vivo by disrupting a negative feedback loop mediated by S6 kinase. We find that rapamycin has a clear biphasic effect on insulin sensitivity in C2C12 myotubes, with enhanced responsiveness during the first hour that declines to almost complete insulin resistance by 24–48 h. We and others have recently observed that chronic rapamycin treatment induces insulin resistance in rodents, at least in part due to disruption of mTORC2, an mTOR-containing complex that is not acutely sensitive to the drug. Chronic rapamycin treatment may also impair insulin action via the inhibition of mTORC1-dependent mitochondrial biogenesis and activity, which could result in a buildup of lipid intermediates that are known to trigger insulin resistance. We confirmed that rapamycin inhibits expression of PGC-1α, a key mitochondrial transcription factor, and acutely reduces respiration rate in myotubes. However, rapamycin did not stimulate phosphorylation of PKCθ, a central mediator of lipid-induced insulin resistance. Instead, we found dramatic disruption of mTORC2, which coincided with the onset of insulin resistance. Selective inhibition of mTORC1 or mTORC2 by shRNA-mediated knockdown of specific components (Raptor and Rictor, respectively) confirmed that mitochondrial effects of rapamycin are mTORC1-dependent, whereas insulin resistance was recapitulated only by knockdown of mTORC2. Thus, mTORC2 disruption, rather than inhibition of mitochondria, causes insulin resistance in rapamycin-treated myotubes, and this system may serve as a useful model to understand the effects of rapamycin on mTOR signaling in vivo.
INTRODUCTION
Rapamycin is the only drug that has been unequivocally established to robustly and reproducibly extend maximum lifespan in mice (). However, very little is known about the changes in physiology or intracellular signaling that accompany this effect. Interestingly, rapamycin was tested for effects on lifespan in part because it is proposed to mimic some of the signaling events triggered by caloric restriction (CR), which extends life in most species that have been tested (; ; ). Two hallmarks of CR in rodents are improved insulin sensitivity () and increased mitochondrial biogenesis (). Surprisingly, rapamycin causes insulin resistance (; ) and inhibits both the production and function of mitochondria, at least in cells (; ; ). It is therefore clear that rapamycin does more than act as a simple “CR mimetic,” and understanding the molecular mechanisms involved has the potential to lead to both the development of more effective molecules, and new insights into the underlying processes that regulate mammalian aging.
The canonical target of rapamycin is mechanistic (formerly mammalian) target of rapamycin complex 1 (mTORC1), a kinase involved in nutrient sensing and the regulation of growth and metabolism (). The mTORC1 pathway is suppressed by CR in a variety of mammalian tissues (e.g., ; ; ), and interfering with this pathway genetically in yeast results in lifespan extension that is not additive with CR in that organism (). Although complete elimination of mTORC1 in mammals causes embryonic lethality (), animals lacking one of its substrates, S6K1, are long-lived and display enhanced insulin sensitivity (), supporting the idea that important features of CR may be mediated by suppression of this pathway. We have recently described a strain of mice with mildly impaired mTORC1 signaling that are also long-lived (). However, these mice lack the enhanced insulin sensitivity that is conferred by total S6K1 ablation, suggesting that the two effects are separable. Consistent with this, we and others have reported that rodents treated with rapamycin are overtly insulin resistant (; ), despite the longer lifespan of rapamycin-treated mice (; ).
We have shown that rapamycin-induced insulin resistance in mice is at least partially due to disruption of mTORC2, a second mTOR-containing complex that phosphorylates several substrates, including AKT at serine 473 as part of the insulin signaling cascade (Figure 1; ). mTORC2 is not acutely sensitive to rapamycin, but was shown to be disrupted in some, but not all, cultured cell lines after continuous exposure to the drug (). In addition, loss of AKT phosphorylation at serine 473 after prolonged rapamycin treatment has been observed in vivo, consistent with our biochemical demonstration that mTORC2 can be disrupted in intact tissues in mice.
FIGURE 1
A possibility that has not been adequately addressed to date is that decreased abundance or function of mitochondria could contribute to the detrimental effects of rapamycin on metabolism. In stark contrast to CR (), rapamycin has been shown to suppress mitochondrial biogenesis (), and to acutely decrease mitochondrial respiration in cultured cells (; ). A large body of evidence supports the contention that insufficient mitochondrial capacity in skeletal muscle can trigger a buildup of lipid-derived molecules, including diacylglycerols and ceramides, that subsequently trigger activation of PKCθ, inhibitory serine phosphorylation of IRS1, and insulin resistance (; ).
In C2C12 myotubes, we have observed a clear biphasic effect of rapamycin on insulin sensitivity. We show that an early (~ h) improvement in insulin responsiveness correlates to the acute loss of signaling through S6K1, consistent with disruption of the negative feedback loop driving inhibitory phosphorylation of IRS1 (Figure 1; ). At later time points (>24 h), however, we find that myotubes become refractory to the effects of insulin. We provide biochemical and genetic evidence to show that disruption of mTORC2, rather than mitochondrial dysfunction, plays the dominant role in rapamycin-induced insulin resistance. These studies expand our understanding of the molecular consequences of rapamycin exposure, and how these changes influence insulin sensitivity in a cell culture model of skeletal muscle.
MATERIALS AND METHODS
MATERIALS
Antibodies to phospho-AKT S473 (9271), phospho-AKT T308 (9275), AKT (9272), phospho-S6 ribosomal protein (2215), S6 ribosomal protein (2217), mTOR (2972), Raptor (2280), Rictor (2140), phospho-PKC theta T538 (9377), and VDAC (4866) were from Cell Signaling Technology. The phospho-IRS1 S307 (07-247) antibody was from Upstate and IRS1 (05-1085) and GAPDH (JC1641540) antibodies were from Millipore. OXPHOS cocktail (MS604/D1848) was from MitoSciences. Protease and phosphatase inhibitor cocktail tablets were from Roche (11836153001 and 04906845001, respectively). Rapamycin was purchased from Calbiochem (553210). Torin1 was a gift from the lab of Nathanael Gray. Triglyceride reagent was from Stanbio Laboratory. DMEM, fetal bovine serum (FBS), horse serum, insulin, protein A agarose, and Trizol were obtained from Invitrogen. Other chemicals were purchased from Sigma unless noted.
CELL CULTURE
C2C12 mouse myoblasts were maintained in DMEM supplemented with 10% FBS and antibiotics (Pen/Strep). When cells reached confluence, the medium was switched to DMEM with 2% horse serum. Cells were refreshed with differentiation medium every other day. By day 4, C2C12s were fused into myotubes. C2C12 myotubes were then treated with 500 nM rapamycin for the indicated times. Torin1 treatment was at 250 nM for 4 h. Palmitate-containing media were prepared by conjugating palmitate with FFA-free bovine serum albumin as described by . Briefly, palmitate was dissolved in ethanol (75 mM), diluted 1:25 in DMEM containing 2% BSA, sonicated briefly, and incubated at 55°C for 10 min. The complexed palmitate was then diluted to a final concentration of 0.5 mM in DMEM containing 2% BSA, cooled at RT, filtered and administrated to C2C12 myotubes for 16 h.
OXYGEN CONSUMPTION RATE MEASUREMENT
C2C12 myoblasts were seeded at 40,000 cells per well in 24-well XF plates. Myoblasts were treated with rapamycin for the indicated times, or alternatively, myotubes were generated by replacing the medium with differentiation medium when cells reached confluence. After an 4 days of differentiation, myotubes were treated with rapamycin for the indicated times. The cells were refreshed with non-buffered pH 7.4 medium (25 mM glucose) and incubated for 1 h in a non-CO2 incubator, as recommended by Seahorse Biosciences. A Seahorse XF24 Analyzer (Seahorse Biosciences) was then used to measure the oxygen consumption rate. Each cycle included 4 min of mixing, a 2-min wait, and then measurement over 2 min. One micromolar oligomycin was used to inhibit ATP synthase. Next, 300 nM FCCP was added to stimulate uncoupled respiration. Immediately after measurement, the protein concentration was measured by bicinchoninic acid (BCA) assay (Pierce Biotechnology).
WESTERN BLOTTING
Cells were rinsed with PBS and lysed in cold RIPA buffer supplemented with phosphatase inhibitor and protease inhibitor cocktail tablets. Cell lysates were incubated on ice for 10 min, sonicated on ice for 30 s, and centrifuged at 12,800 rpm for 15 min at 4°C. Protein concentration was determined by BCA assay (Pierce Biotechnology). Twenty microgram proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 8–16% gradient or 7.5% resolving gels. Quantification was performed by densitometry using ImageJ software, and loading was verified by blotting for GAPDH.
IMMUNOPRECIPITATIONS
C2C12 myotubes were lysed in cold 0.3% CHAPS lysis buffer [40 mM Hepes (pH 7.5), 120 mM NaCl, 1 mM EDTA, 0.3% CHAPS, 10 mM pyrophosphate, 10 mM β-glycerophosphate, 50 mM NaF, 0.5 mM orthovanadate, and protease inhibitors]. Cells lysates were incubated at 4°C for 15 min and then centrifuged at 16,000 rpm for 15 min at 4°C to remove insoluble material. Protein A agarose beads were added to the supernatant and incubated with rotation for 1 h. Next, the beads were centrifuged out of the lysates and mTOR or Rictor antibodies were added to the cleared lysates, which were rotated overnight at 4°C. Protein A agarose beads were added to the supernatant and incubated at 4°C for an additional hour. Immunoprecipitated complexes with protein A agarose beads were washed in 0.3% CHAPS lysis buffer three times, boiled in SDS-sample buffer, separated by SDS-PAGE (7.5% gels), and analyzed by immunoblotting. This method is adapted from that described by .
QUANTITATIVE REAL TIME RT-PCR ASSAY
Total RNA was extracted from the sample using TRIzol reagent. The concentration and purity of RNA were determined by absorbance at 260/280 nm. One microgram of total RNA was reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer’s instructions. The cDNA was subjected to real time PCR using SYBR Q-PCR master mix (Applied Biosystems). Primer sequences used to produce gene-specific amplicons are as follows: PGC-1α: forward: ACTATGAATCAAGCCACTACAGAC; reverse: TTCATCCCTCTTGAGCCTTTCG, GAPDH: forward: GGTGAAGGTCGGAGTCAACGGA; reverse: GAGGGATCTCG- CTCCTGGAAGA, TFAM: forward: AAGACCTCGTTCAGCATA- TAACATT; reverse: TTTTCCAAGCCTCATTTACAAGC, A typical reaction contained 250 nM of forward and reverse primer, 1 μl cDNA and the final reaction volume was 20 μl. The reaction was initiated by preheating at 50°C for 2 min, followed by 95°C for 10 min. Subsequently, 40 amplification cycles were carried out with 15 s denaturation at 95°C and 30 s annealing and extension at 60°C. Gene expression was normalized to GAPDH.
mtDNA DETERMINATION
Briefly, cell pellets were digested in with 15 μl proteinase K (10 mg/ml) in a 500 μl total volume of proteinase K buffer (100 mM Tris-HCl pH 8.5, 5 mM EDTA, 0.2% SDS, 200 mM NaCl) overnight at 55°C. 170 μl of 5 M NaCl was added and samples were mixed for 1 min and then centrifuged at max speed for 15 min at 4°C. Supernatants were collected and 1 ml ethanol was added, after which the tubes were inverted several times. Samples were centrifuged at max speed for 15 min at 4°C, after which ethanol supernatant was aspirated and DNA pellet was washed in 500 μl of 70% ethanol. Samples were centrifuged for 5 min, max speed at 4°C, ethanol supernatant was removed, the DNA pellet was air dried and resuspended in 50 μl of TE. Primer sequences used to produce mitochondrial and nuclear specific DNA products for quantification of mtDNA/nuclear DNA ratios are as follows: MT-CO1: forward: TGCTAGCCGCAGGCATTAC; reverse: GGGTGCCCAAAGAATCAGAAC, Ndufv1: forward: CTTCCCCACTGGCCTCAAG; reverse: CCAAAACCCAGTGATCCAGC.
KNOCKDOWN OF RICTOR AND RAPTOR WITH LENTIVIRUS
293T cells were from ATCC and were seeded onto 10 cm diameter dishes with DMEM (supplemented with 10% FBS and penicillin–streptomycin) and incubated overnight. When the cells became 70% confluent, they were refreshed the cells with antibiotic-free DMEM. Next, the Rictor shRNA, Raptor shRNA, and control GFP shRNA plasmids (; ), together with helper vectors pCMV-dR8.2dvpr and pCMV-VSVG, were cotransfected into 293T cells using Fugene reagent. Media containing lentivirus were harvested after 48 h and passed through a 0.4 μM filter. C2C12 myoblasts were infected with lentivirus-containing media for 24 h and selected with 2 μg/ml puromycin. The cell lysates were harvested at appropriate time points and analyzed by immunoblotting.
MEASUREMENT OF TRIGLYCERIDES
C2C12 myotubes were lysed in PBS containing 1% Nonidet P-40. Triglycerides were determined by triglyceride reagent according to manufacture’s instructions (Stanbio Laboratory). Intracellular triglycerides were normalized to total protein content.
STATISTICAL ANALYSIS
Densitometry was performed using ImageJ software (NIH, Bethesda, MD) and band intensities were normalized to GAPDH, unless otherwise indicated. Significance was tested using the two-tailed unpaired Student’s t-test in Microsoft Excel (Microsoft, Seattle, Washington) or a one-sample t-test to test whether ratios of phosphorylated Akt differed significantly from the control value (set to one) in Figures 2 and 6. * denotes p < 0.05 compared to control unless otherwise indicated.
FIGURE 2
RESULTS
We initially chose to explore the effects of rapamycin in differentiated C2C12 myotubes cultured in the presence of palmitate because it is known that insulin sensitivity in this system is decreased by the accumulation of lipid intermediates, such as diacylglycerols and ceramides, and that enhancing mitochondrial fatty acid oxidation is sufficient to improve insulin sensitivity (). Therefore, we expected that any major influence of rapamycin on mitochondrial function would be reflected as a change in insulin signaling to AKT.
We found that pre-treatment of C2C12 myotubes with rapamycin for 1 h caused a small, but reproducible improvement in insulin sensitivity, likely due to the loss of negative feedback through S6K1, a substrate of the canonical rapamycin target, mTORC1 (Figure 2). Over four independent experiments, the average effect of short-term rapamycin was an approximately 50% increase in the pAkt:Akt ratio following insulin stimulation, p = 0.02. Interestingly, when the rapamycin pre-treatment was extended to 48 h, the myotubes became almost completely unresponsive to insulin stimulation, consistent either with further antagonism of lipid-induced insulin resistance via inhibition of mitochondria, or with disruption of mTORC2. Over four independent experiments, the average effect was a 67% decrease in the pAkt:Akt ratio, p < 0.001. AICAR, an AMPK activator that promotes respiration and mitochondrial biogenesis (), had the opposite effect, improving insulin sensitivity at the 48 h time point, whereas a second compound known to promote mitochondrial biogenesis, resveratrol, had no effect.
To test whether rapamycin was sufficient to suppress mitochondrial function, we measured respiration rates in treated or untreated myotubes using a Seahorse XF24 Flux Analyzer. As shown in Figure 3, pre-treatment with rapamycin caused a significant reduction in respiration rates under basal, oligomycin-inhibited (reflecting proton leak), and uncoupled conditions (all in the presence of 25 mM glucose). To test whether rapamycin might have changed the substrate preference of the mitochondria, we also added palmitate to the media. However, the addition of a fatty acid substrate did not restore respiration rates in the rapamycin-treated cells, and had only a minor effect on oxygen consumption, which was reversed upon addition of the carnitine palmitoyl transferase 1 (CPT-1) inhibitor etomoxir. Intriguingly, a significant reduction in oxygen consumption occurred after 1 h of pre-treatment, suggesting that it was largely due to changes in flux through the existing mitochondria, rather than to a reduction in the rate of mitochondrial biogenesis.
FIGURE 3
Next, we examined factors related to mitochondrial biogenesis and lipid-induced insulin resistance in rapamycin-treated myotubes. Although we confirmed the previously reported suppression of mitochondrial transcription factors (PGC-1α and TFAM; Figure 4A; ) and were able to show a small increase in triglyceride accumulation (Figure 4B), we did not detect any significant effect of rapamycin on mitochondrial DNA content or the levels of various mitochondrial proteins over the time course of this experiment (Figures 4C,D). Lipid-induced insulin resistance is typically associated with increased phosphorylation of atypical PKC isoforms and inhibitory (serine) phosphorylation of IRS1. Serine phosphorylation of IRS1 was not enhanced. In fact, IRS1 phosphorylation was diminished in the presence of rapamycin at all time points studied, likely reflecting the inhibition of S6K1. Phosphorylated (active) PKCθ (also called PRKCQ), was clearly higher in the presence of palmitate, and appeared to be incrementally increased by rapamycin. However, there was no induction of PKCθ phosphorylation by rapamycin in the absence of palmitate, yet the myotubes still became insulin resistant (Figure 4D). Together, these observations strongly suggested that mitochondrial dysfunction, leading to lipid-induced insulin resistance is not the major mechanism accounting for reduced insulin sensitivity in rapamycin-treated myotubes.
FIGURE 4
Next, we assessed the integrity of the mTORC2 complex. We found that 24 h, but not 1 h, of rapamycin exposure is sufficient to almost completely disrupt mTORC2 in C2C12 myotubes, as assessed by immunoprecipitation of either Rictor (an mTORC2-specific component) or the mTOR catalytic subunit (Figure 5). These results could account for the loss of AKT phosphorylation at serine 473, which appears to be required for subsequent phosphorylation by PDK1 at threonine 308 in many cases (). However, it has been reported that loss of mTORC2 in MEFs or in skeletal muscle selectively impairs serine 473 phosphorylation, with unchanged or even enhanced phosphorylation of threonine 308 (; ). We therefore wondered whether the loss of threonine 308 phosphorylation in our myotubes was indicative of a second mechanism contributing to insulin resistance, or simply a consequence of mTORC2 loss.
FIGURE 5
To confirm the specificity of rapamycin’s effects, we used shRNAs to selectively ablate either mTORC1 or mTORC2 by targeting the complex-specific components Raptor or Rictor, respectively (; ). As expected, Raptor knockdown recapitulated both the improved insulin sensitivity due to loss of negative feedback through S6K1, and the inhibition of respiration seen in rapamycin-treated cells (Figure 6). On the other hand, Rictor knockdown significantly diminished AKT phosphorylation at serine 473 as well as threonine 308, confirming that this site is sensitive to mTORC2 inhibition in C2C12 myotubes (Figure 6A). Torin1, a direct inhibitor of both mTORC1 and mTORC2 (), also blocked AKT phosphorylation at both threonine 308 and serine 473 (Figure 6B), although it should be noted that inhibition of upstream signaling through PI3K may have contributed to the Torin1 result (). Taken together, our results demonstrate that rapamycin-induced insulin resistance in this system is due primarily to mTORC2 disruption, rather than to mitochondrial effects of the drug.
FIGURE 6
DISCUSSION
We have shown that both the short-term improvement in insulin sensitivity and the longer-term loss of insulin sensitivity that are caused by rapamycin in vivo can be mimicked in C2C12 myotubes, and that this system can be used to explore the underlying molecular mechanisms.
We chose C2C12 myotubes as a cell culture model to test the contribution of mitochondria to rapamycin-induced insulin resistance for a number of reasons. First, insulin resistance is readily induced in this model with palmitate, and can be ameliorated using a small molecule that enhances mitochondrial fatty acid oxidation (). Second, the ability of rapamycin to inhibit mitochondrial biogenesis was first demonstrated in C2C12 myotubes, and has only been thoroughly characterized in this system (). Third, we have shown that AKT phosphorylation is robustly reduced in vivo in skeletal muscle by rapamycin treatment (). The effect of chronic rapamycin on mTORC2 complex formation was originally explored in a series of immortalized and tumor cell lines, many of which proved refractory to the drug for reasons that remain unclear (). Herein, we show that this differentiated, post-mitotic cell type remains sensitive to mTORC2 disruption by rapamycin.
Rapamycin has previously been established to inhibit both mitochondrial biogenesis () and oxidative phosphorylation by existing mitochondria (; ), raising the possibility that a buildup of lipid intermediates due to insufficient fatty acid oxidation might trigger insulin resistance through the PKCθ to IRS1 signaling cascade in rapamycin-treated cells (). Indeed, palmitate-induced insulin resistance correlated with a pronounced induction of PKCθ phosphorylation that was mildly augmented by rapamycin. Rapamycin also caused a decrease in the expression of key mitochondrial transcription factors and an acute suppression of respiration in our differentiated C2C12 myotubes. However, we found that mTORC2 disruption, rather than mitochondrial dysfunction, was the major cause of insulin resistance after chronic rapamycin exposure.
Nevertheless, the incremental increase in triglyceride buildup, increase in PKCθ phosphorylation in palmitate-treated cells, and reduced expression of PGC-1α and TFAM, hint that mitochondrial effects might exacerbate the insulin resistance caused by mTORC2 disruption, particularly in longer-term experiments in vivo. The lack of an appreciable decrease in mitochondrial proteins over the course of 64 h is perhaps not surprising, since many have half lives on the order of 1–3 weeks (). However, long-term changes in the expression of PGC-1α and TFAM are sufficient to drive changes in total mitochondrial content () and the abundance and transcription of mtDNA, respectively (). Moreover, evidence from human studies suggest that a 38% decrease in mitochondrial density may be enough to predispose humans to diabetes (). Therefore, it will be extremely interesting to examine the consequences of long-term rapamycin treatment on mitochondrial function in vivo.
Interestingly, a third potential mechanism by which rapamycin could cause insulin resistance in skeletal muscle was recently described by , who showed that 2 weeks of rapamycin treatment decreased expression of YY1 target genes, including upstream components of the insulin signaling cascade. This mechanism is unlikely to be important in our C2C12 myotube model because YY1 interacts with mTORC1, and our shRNA experiments implicate mTORC2 inhibition as the cause of insulin resistance. In addition, the time frame for our experiments is much shorter, allowing less time for changes in protein level. For example, the expression of IRS1, one of the YY1 targets studied by , is unchanged in myotubes after 64 h of rapamycin treatment (Figure 4D). However, this mechanism may play a role in the longer-term effects of rapamycin on insulin sensitivity in skeletal muscle in vivo.
It is also intriguing to speculate that rapamycin may have effects that are independent from the mTOR complexes, in cells and in vivo. Rapamycin binds directly to FKBP12 and FKBP12.6, and inhibits mTORC1 via a drug-induced interaction (). FKBP12 proteins have mTORC1-independent functions in the regulation of calcium channels that can lead to cardiac () and neuronal () phenotypes, and FKBP12.6 null mice exhibit strain-dependent alterations in insulin secretion (; ). Therefore, the in vivo consequences of rapamycin treatment may include effects that go beyond the canonical inhibition of mTORC1 and the disruption of mTORC2.
Rapamycin is the only drug that has been proven to extend the maximum lifespan of a mammalian species in a rigorous, multi-center trial using lean, healthy animals that are not predisposed to any specific disease (). In contrast, many other molecules that improve measures of health and produce benefits that are thought to be consistent with longevity have failed to achieve an extension of maximum lifespan (e.g., ; ; ). Although rapamycin is in clinical use, its detrimental side effects on lung health, serum lipid profiles, and immune function, as well as a possible increased risk of diabetes, are likely to preclude its use in healthy humans (; ; ). Therefore, there is an urgent need and opportunity to understand how rapamycin works at the molecular level. The present results improve our understanding of how rapamycin influences mitochondria and insulin signaling, and lay the groundwork for future studies in cells and in vivo.
Statements
Acknowledgments
We would like to thank all the members of the Baur and Sabatini labs for help with protocols, reagents and advice. We thank Nathanael Gray for generously providing Torin1. This project was funded in part by a Research Grant from AFAR and a Bingham Trust Pilot Award from Penn’s Institute on Aging to Joseph A. Baur. Lan Ye is supported by a Postdoctoral Fellowship from the American Heart Association, 7600031, and Dudley W. Lamming was supported by a Ruth L. Kirschstein National Research Service Award, 1F32AG032833-01A1 and is a Charles A. King Trust Postdoctoral Fellow. Access to equipment was provided by Penn’s DERC (P30DK19525). David M. Sabatini is an Investigator of the Howard Hughes Medical Institute.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
REFERENCES
1
BaurJ. A. (2009). “Metabolic effects of caloric restriction,” inEncyclopedia of Life Sciences(Chichester:John Wiley & Sons, Ltd).
2
BentzingerC. F.RomaninoK.CloettaD.LinS.MascarenhasJ. B.OliveriF.XiaJ.CasanovaE.CostaC. F.BrinkM.ZorzatoF.HallM. NRüeggM. A. (2008). Skeletal muscle-specific ablation of raptor, but not of rictor, causes metabolic changes and results in muscle dystrophy.Cell Metab.8411–424.
3
BlattlerS. M.CunninghamJ. T.VerdeguerF.ChimH.HaasW.LiuH.RomaninoK.RueggM. A.GygiS. P.ShiY.PuigserverP. (2012). Yin Yang 1 deficiency in skeletal muscle protects against rapamycin-induced diabetic-like symptoms through activation of insulin/IGF signaling.Cell Metab.15505–517.
4
ChavezJ. A.HollandW. L.BarJ.SandhoffK.SummersS. A. (2005). Acid ceramidase overexpression prevents the inhibitory effects of saturated fatty acids on insulin signaling.J. Biol. Chem.28020148–20153.
5
ChenC.LiuY.ZhengP. (2009). mTOR regulation and therapeutic rejuvenation of aging hematopoietic stem cells.Sci. Signal.2ra75.
6
ChenZ.LiZ.WeiB.YinW.XuT.KotlikoffM. I.JiG. (2010). FKBP12.6-knockout mice display hyperinsulinemia and resistance to high-fat diet-induced hyperglycemia.FASEB J.24357–363.
7
CollT.Alvarez-GuardiaD.BarrosoE.Gomez-FoixA. M.PalomerX.LagunaJ. C.Vazquez-CarreraM. (2010). Activation of peroxisome proliferator-activated receptor-{delta} by GW501516 prevents fatty acid-induced nuclear factor-{kappa}B activation and insulin resistance in skeletal muscle cells.Endocrinology1511560–1569.
8
CoxL. S.MattisonJ. A. (2009). Increasing longevity through caloric restriction or rapamycin feeding in mammals: common mechanisms for common outcomes?Aging Cell8607–613.
9
CunninghamJ. T.RodgersJ. T.ArlowD. H.VazquezF.MoothaV. K.PuigserverP. (2007). mTOR controls mitochondrial oxidative function through a YY1-PGC-1alpha transcriptional complex.Nature450736–740.
10
ErionD. M.ShulmanG. I. (2010). Diacylglycerol-mediated insulin resistance.Nat. Med.16400–402.
11
EstepP. W.IIIWarnerJ. B.BulykM. L. (2009). Short-term calorie restriction in male mice feminizes gene expression and alters key regulators of conserved aging regulatory pathways.PLoS ONE4e5242 10.1371/journal.pone.0005242
12
GantJ. C.ChenK. C.NorrisC. M.KadishI.ThibaultO.BlalockE. M.PorterN. M.LandfieldP. W. (2011). Disrupting function of FK506-binding protein 1b/12.6 induces the Ca2+-dysregulation aging phenotype in hippocampal neurons.J. Neurosci.311693–1703.
13
GuertinD. A.StevensD. M.SaitohM.KinkelS.CrosbyK.SheenJ. H.MullhollandD. J.MagnusonM. A.WuH.SabatiniD. M. (2009). mTOR complex 2 is required for the development of prostate cancer induced by Pten loss in mice.Cancer Cell15148–159.
14
GuertinD. A.StevensD. M.ThoreenC. C.BurdsA. A.KalaanyN. Y.MoffatJ.BrownM.FitzgeraldK. J.SabatiniD. M. (2006). Ablation in mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt-FOXO and PKCalpha, but not S6K1.Dev. Cell11859–871.
15
HarrisonD. E.StrongR.SharpZ. D.NelsonJ. F.AstleC. M.FlurkeyK.NadonN. L.WilkinsonJ. E.FrenkelK.CarterC. S.PahorM.JavorsM. A.FernandezE.MillerR. A. (2009). Rapamycin fed late in life extends lifespan in genetically heterogeneous mice.Nature460392–395.
16
HoudeV. P.BruleS.FestucciaW. T.BlanchardP. G.BellmannK.DeshaiesY.MaretteA. (2010). Chronic rapamycin treatment causes glucose intolerance and hyperlipidemia by upregulating hepatic gluconeogenesis and impairing lipid deposition in adipose tissue.Diabetes Metab. Res. Rev.591338–1348.
17
JacintoE.FacchinettiV.LiuD.SotoN.WeiS.JungS. Y.HuangQ.QinJ.SuB. (2006). SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity.Cell127125–137.
18
KaeberleinM.PowersR. W.IIISteffenK. K.WestmanE. A.HuD.DangN.KerrE. O.KirklandK. T.FieldsS.KennedyB. K. (2005). Regulation of yeast replicative life span by TOR and Sch9 in response to nutrients.Science3101193–1196.
19
LammingD. W.YeL.KatajistoP.GoncalvesM. D.SaitohM.StevensD. M.DavisJ. G.SalmonA. B.RichardsonA.AhimaR. S.GuertinD. A.SabatiniD. M.BaurJ. A. (2012). Rapamycin-induced insulin resistance is mediated by mTORC2 loss and uncoupled from longevity.Science3351638–1643.
20
LarsenJ. L.BennettR. G.BurkmanT.RamirezA. L.YamamotoS.GuliziaJ.RadioS.HamelF. G. (2006). Tacrolimus and sirolimus cause insulin resistance in normal sprague dawley rats.Transplantation82466–470.
21
LarssonN. G.WangJ.WilhelmssonH.OldforsA.RustinP.LewandoskiM.BarshG. S.ClaytonD. A. (1998). Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice.Nat. Genet.18231–236.
22
LashingerL. M.MaloneL. M.BrownG. W.DanielsE. A.GoldbergJ. A.OttoG.FischerS. M.HurstingS. D. (2011). Rapamycin partially mimics the anticancer effects of calorie restriction in a murine model of pancreatic cancer.Cancer Prev. Res. (Phila)41041–1051.
23
LiuQ.KirubakaranS.HurW.NiepelM.WestoverK.ThoreenC. C.WangJ.NiJ.PatricelliM. P.VogelK.RiddleS.WallerD. L.TraynorR.SandaT.ZhaoZ.KangS. A.ZhaoJ.LookA. T.SorgerP. K.SabatiniD. M.GrayN. S. (2012). Kinome-wide selectivity profiling of ATP-competitive mammalian target of rapamycin (mTOR) inhibitors and characterization of their binding kinetics.J. Biol. Chem.2879742–9752.
24
McKee AldermanJ.DePetrilloM. A.GluesenkampA. M.HartleyA. C.VerhoffS. V.ZavodniK. L.CombsT. P. (2010). Calorie restriction and dwarf mice in gerontological research.Gerontology56404–409.
25
MenziesR. A.GoldP. H. (1971). The turnover of mitochondria in a variety of tissues of young adult and aged rats.J. Biol. Chem.2462425–2429.
26
MillerR. A.HarrisonD. E.AstleC.BaurJ. A.de CaboR.FernandezE.FlurkeyK.JavorsM.NelsonJ.PletcherS.SharpZ.SinclairD. A.StarnesJ.WilkinsonJ.NadonN.StrongR. (2010). Rapamycin, but not resveratrol or simvastatin, extends lifespan of genetically heterogeneous mice.J. Gerontol. A Biol. Sci. Med. Sci.66191–201.
27
MorinoK.PetersenK. F.ShulmanG. I. (2006). Molecular mechanisms of insulin resistance in humans and their potential links with mitochondrial dysfunction.Diabetes Metab. Res. Rev.55(Suppl. 2)S9 –S15.
28
NisoliE.TonelloC.CardileA.CozziV.BracaleR.TedescoL.FalconeS.ValerioA.CantoniO.ClementiE.MoncadaS.CarrubaM. O. (2005). Calorie restriction promotes mitochondrial biogenesis by inducing the expression of eNOS.Science310314–317.
29
NoguchiN.YoshikawaT.IkedaT.TakahashiI.ShervaniN. J.UrunoA.YamauchiA.NataK.TakasawaS.OkamotoHSugawaraA. (2008). FKBP12.6 disruption impairs glucose-induced insulin secretion.Biochem. Biophys. Res. Commun.371735–740.
30
OjukaE. O. (2004). Role of calcium and AMP kinase in the regulation of mitochondrial biogenesis and GLUT4 levels in muscle.Proc. Nutr. Soc.63275–278.
31
PearsonK. J.BaurJ. A.LewisK. N.PeshkinL.PriceN. L.LabinskyyN.SwindellW. R.KamaraD.MinorR. K.PerezE.JamiesonH. A.ZhangY.DunnS. R.SharmaK.PleshkoN.WoollettL. A.CsiszarA.IkenoY.Le CouteurD.ElliottP. J.BeckerK. G.NavasP.IngramD. K.WolfN. S.UngvariZ.SinclairD. Ade CaboR. (2008). Resveratrol delays age-related deterioration and mimics transcriptional aspects of dietary restriction without extending life span.Cell Metab.8157–168.
32
RamanathanA.SchreiberS. L. (2009). Direct control of mitochondrial function by mTOR.Proc. Natl. Acad. Sci. U.S.A.10622229–22232.
33
SabatiniD. M.Erdjument-BromageH.LuiM.TempstP.SnyderS. H. (1994). RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs.Cell7835–43.
34
SarbassovD. D.AliS. M.SenguptaS.SheenJ. H.HsuP. P.BagleyA. F.MarkhardA. L.SabatiniD. M. (2006). Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB.Mol. Cell.22159–168.
35
SarbassovD. D.GuertinD. A.AliS. M.SabatiniD. M. (2005). Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex.Science3071098–1101.
36
SchiekeS. M.PhillipsD.McCoyJ. P.Jr.AponteA. M.ShenR. F.BalabanR. S.FinkelT. (2006). The mammalian target of rapamycin (mTOR) pathway regulates mitochondrial oxygen consumption and oxidative capacity.J. Biol. Chem.28127643–27652.
37
SelmanC.TulletJ. M.WieserD.IrvineE.LingardS. J.ChoudhuryA. I.ClaretM.Al-QassabH.CarmignacD.RamadaniF.WoodsA.RobinsonI. C.SchusterE.BatterhamR. L.KozmaS. C.ThomasG.CarlingD.OkkenhaugK.ThorntonJ. M.PartridgeL.GemsD.WithersD. J. (2009). Ribosomal protein S6 kinase 1 signaling regulates mammalian life span.Science326140–144.
38
ShinmuraK.TamakiK.SanoM.MurataM.YamakawaH.IshidaH.FukudaK. (2011). Impact of long-term caloric restriction on cardiac senescence: caloric restriction ameliorates cardiac diastolic dysfunction associated with aging.J. Mol. Cell Cardiol.50117–127.
39
SmithD. L.Jr.ElamC. F.Jr.MattisonJ. A.LaneM. A.RothG. S.IngramD. K.AllisonD. B. (2010). Metformin supplementation and life span in Fischer-344 rats.J. Gerontol. A Biol. Sci. Med. Sci.65468–474.
40
StalloneG.InfanteB.GrandalianoG.GesualdoL. (2009). Management of side effects of sirolimus therapy.Transplantation87S23–S26.
41
TeutonicoA.SchenaP. FDi PaoloS. (2005). Glucose metabolism in renal transplant recipients: effect of calcineurin inhibitor withdrawal and conversion to sirolimus.J. Am. Soc. Nephrol.163128–3135.
42
ThoreenC. C.KangS. A.ChangJ. W.LiuQ.ZhangJ.GaoY.ReichlingL. J.SimT.SabatiniD. M.GrayN. S. (2009). An ATP-competitive mammalian target of rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1.J. Biol. Chem.2848023–8032.
43
UmS. H.FrigerioF.WatanabeM.PicardF.JoaquinM.StickerM.FumagalliS.AllegriniP. R.KozmaS. C.AuwerxJ.ThomasG. (2004). Absence of S6K1 protects against age- and diet-induced obesity while enhancing insulin sensitivity.Nature431200–205.
44
WeindruchR.WalfordR. L. (1988). The Retardation of Aging and Disease by Dietary Restriction,Vol. xvii.Springfield, IL:Charles C. Thomas436.
45
WuZ.PuigserverP.AnderssonU.ZhangC.AdelmantG.MoothaV.TroyA.CintiS.LowellB.ScarpullaR. C.SpiegelmanB. M. (1999). Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1.Cell98115–124.
46
XinH. B.SenbonmatsuT.ChengD. S.WangY. X.CopelloJ. A.JiG. J.CollierM. L.DengK. Y.JeyakumarL. H.MagnusonM. A.InagamiT.KotlikoffM. I.FleischerS. (2002). Oestrogen protects FKBP12.6 null mice from cardiac hypertrophy.Nature416334–338.
47
ZhangJ. (2006). Resveratrol inhibits insulin responses in a SirT1-independent pathway.Biochem. J.397519–527.
Summary
Keywords
mTOR, mTORC1, rapamycin, mTORC2, insulin sensitivity, mitochondrial biogenesis, chronic, diabetes, raptor, rictor, respiration
Citation
Ye L, Varamini B, Lamming DW, Sabatini DM and Baur JA (2012) Rapamycin has a biphasic effect on insulin sensitivity in C2C12 myotubes due to sequential disruption of mTORC1 and mTORC2. Front. Gene. 3:177. doi: 10.3389/fgene.2012.00177
Received
21 June 2012
Accepted
23 August 2012
Published
11 September 2012
Volume
3 - 2012
Edited by
S. M. Jazwinski, Tulane University, USA
Reviewed by
Yih-Woei Fridell, University of Connecticut, USA; Gerald S. Shadel, Yale University School of Medicine, USA; Michael V. Miceli, Tulane University School of Medicine, USA
Copyright
© Ye, Varamini, Lamming, Sabatini and Baur.
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in other forums, provided the original authors and source are credited and subject to any copyright notices concerning any third-party graphics etc.
*Correspondence: Joseph A. Baur, Institute for Diabetes, Obesity, and Metabolism, Perelman School of Medicine, University of Pennsylvania, 12-114 Translational Research Center, 3400 Civic Center Boulevard, Philadelphia, PA 19104, USA; Department of Physiology, Perelman School of Medicine, University of Pennsylvania, 12-114 Translational Research Center, 3400 Civic Center Boulevard, Philadelphia, PA 19104, USA. e-mail: baur@mail.med.upenn.edu
This article was submitted to Frontiers in Genetics of Aging, a specialty of Frontiers in Genetics.
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.