In the original article, there was a mistake in Table 1 as published. Due to a copy-paste error, the accession numbers, PCR primers, and amplicon sizes given for two of the RT-qPCR assays, mapk1 and casp3a, were wrong. Also, the accession number for dnmt1 was incorrect. The corrected Table 1 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Table 1
| Gene symbol | Gene name | Potential marker for | Accession no. | Forward primer | Reverse primer | Amplicon size (bp) | PCR efficiency |
|---|---|---|---|---|---|---|---|
| dnmt1 | DNA (cytosine-5-)- methyltransferase 1 | DNA methylation | NM_131189 | GGGCTACCAGTGCACCTTTG | GATGATAGCTCTGCGTCGAGTC | 76 | 1.91 |
| dnmt3aa | DNA (cytosine-5-)- methyltransferase 3A | DNA methylation | NM_001018134 | GGCGCCTGTTCTTTGAGTTT | TCACTGACCCCCATTGCAA | 112 | 1.91 |
| dnmt3b | DNA (cytosine-5-)- methyltransferase 3B | DNA methylation | NM_001020476 | AGGTTTGGAACCTCCCGAAA | TGCGCACAGGTAACAAATGG | 115 | 1.94 |
| cbs | Cystathionine-beta-synthase | Transsulfuration | NM_001111232 | CTTTGCCCTGGTGGTTCATG | ACCACTCCAAACACCATTTGC | 81 | 2.00 |
| mgmt | O-6-methylguanine-DNA methyltransferase | DNA repair | NM_001256243 | TCCACCCTGTTGTCCTGTCA | GATGTAAGGCAGGCAGAGGAA | 117 | 2.03 |
| pgrmc1 | Progesterone receptor membrane component 1 | Glucose/Energy metabolism | NM_001007392 | TTTTCACGTCGCCACTGAAC | CTCCTCAACCGGGCCATAGT | 104 | 1.90 |
| cyp1a1 | Cytochrome P450 family 1 subfamily A member 1 | Detoxification | AF210727 | GGTGTTGGTTTTCGGTTTGG | GGCATCCCGGTGAACTTTAA | 114 | 1.99 |
| vtg1 | Vitellogenin 1 | Endocrine disruption | NM_001044897 | GTCATCAATGAGGATCCAAAGGCCA | GCCTCAGCGATCAGTGCACCAT | 209 | 1.91 |
| esr1* | Estrogen receptor 1 | Endocrine disruption | NM_152959 | AAACACAGCCGGCCCTACAC | GCCAAGAGCTCTCCAACAAC | 157 | 2.12 |
| esr2a* | Estrogen receptor 2a | Endocrine disruption | NM_180966 | TGATCAGCTGGGCCAAGAAG | GATTAACGGAGCGCCACATC | 123 | 2.00** |
| ar | Androgen receptor | Endocrine disruption | NM_001083123 | GGATGAGGTCGGAGCAGTTC | GGCTCAATGGCCTCCAGAAT | 117 | 2.03 |
| cyp19a2 | Cytochrome P450 family 19 subfamily A member 2 | Endocrine disruption | AF406756 | GAGCGGGCAGGACATAGTGT | GCTTGGGCTCAATCACTCTCA | 89 | 2.10 |
| fos | Fos proto-oncogene | Cell proliferation, differentiation and transcription regulation | NM_205569 | GGGTATTACCCGCTCAACCA | CAAGTCCGGGCATGAAGAGA | 102 | 2.02 |
| mapk1 | Mitogen-activated protein kinase 1 | Cell proliferation, differentiation and survival | NM_182888 | TACATCGGAGGAGGCGCTTA | GCTCAAACGGGCTGATCTTC | 94 | 1.99 |
| casp3a | Caspase 3A | Apoptosis | NM_131877 | CCCAGATGGTCGTGAAAGGAT | TGAACCATGAGCCGGTCATT | 107 | 2.07 |
| eef1a1 | Eukaryotic translation elongation factor 1 alpha 1 | Refgen | AY422992 | AGACAACCCCAAGGCTCTCA | CTCATGTCACGCACAGCAAA | 126 | 2.06 |
| uba52 | Ubiquitin A-52 residue ribosomal protein fusion product 1 | Refgen | NM_001037113 | CGAGCCTTCTCTCCGTCAGT | TTGTTGGTGTGTCCGCACTT | 126 | 2.08 |
| actb | Beta-actin | Refgen | AF057040 | CGAGCAGGAGATGGGAACC | CAACGGAAACGCTCATTGC | 102 | 2.08 |
PCR primers, accession numbers, amplicon sizes, and PCR efficiencies.
*PCR primers obtained from Sawyer et al. [93]. **PCR efficiency set to 2.00.
Summary
Keywords
zebrafish embryos, bisphenol A, behavior, gene expression, DNA methylation, epigenetics
Citation
Olsvik PA, Whatmore P, Penglase SJ, Skjærven KH, d’Auriac MA and Ellingsen S (2020) Corrigendum: Associations Between Behavioral Effects of Bisphenol A and DNA Methylation in Zebrafish Embryos. Front. Genet. 11:107. doi: 10.3389/fgene.2020.00107
Received
29 January 2020
Accepted
29 January 2020
Published
12 February 2020
Approved by
Frontiers in Genetics Editorial Office, Frontiers Media SA, Switzerland
Volume
11 - 2020
Updates
Copyright
© 2020 Olsvik, Whatmore, Penglase, Skjærven, d’Auriac and Ellingsen.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Pål A. Olsvik, pal.a.olsvik@nord.no
†Present address: Pål A. Olsvik, Nord University, Bodø, Norway; Sam J. Penglase, School of Marine and Tropical Biology, James Cook University, Townsville, QLD, Australia; Ståle Ellingsen, University of Bergen, Bergen, Norway
This article was submitted to Toxicogenomics, a section of the journal Frontiers in Genetics
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.