Abstract
Objectives:
To investigate the genetic variants that are responsible for peripheral neuroblastic tumors (PNTs) oncogenesis in one family case.
Materials and Methods:
One family was recruited, including the healthy parents, sister affected by neuroblastoma (NB), and brother who suffered from ganglioneuroma (GN). Whole-genome sequencing (WGS) of germline DNA from all the family members and RNA-seq of tumor RNA from the siblings were performed. Mutants were validated by Sanger sequencing and co-IP was performed to assess the impact of the mutant on chemosensitivity in the SH-SY5Y cell line.
Results:
A novel compound heterozygous mutation of BRCA2 was locked as the cause of carcinogenesis. One allele was BRCA2-S871X (stop-gain) from the siblings’ mother, the other was BRCA2-N372H (missense) from their father. This novel compound heterozygous mutations of the BRCA2 gene associated with PNTs by disordering DNA damage and response (DDR) signal pathway. Moreover, chemosensitivity was reduced in the NB cell line due to the BRCA2-N372H mutant.
Conclusion:
In summary, these results revealed a novel germline compound heterozygous mutation of the BRCA2 gene associated with familial PNTs.
Introduction
Peripheral neuroblastic tumors (PNTs), which account for 7–10% of all tumors in children, arise from primitive sympathogonia (). The PNTs encompass the histologic variants neuroblastoma (NB), ganglioneuroblastoma (GNB), and ganglioneuroma (GN). As tumors of the sympathetic nervous system, they arise wherever sympathetic tissue exists with a predilection for the adrenal gland and retro peritoneum. The biggest difference among these three tumors is the differentiation of tumor cells and prognosis. NB is the most undifferentiated and malignant tumor of the three. As a rare pediatric cancer, NB affects 10.2 per million children under 15 years of age and accounts for 15% of cancer deaths in children (). The most benign tumor is GN, which is composed of well-differentiated gangliocytes and mature stroma (). A familial history of NB is very rare, which is reported in about 1% of patients (). Missense and frameshift mutations of PHOX2B and activating mutations of ALK have been identified in NB families firstly (; ). Furthermore, an increasing number of susceptibility genes have been observed in NB families, such as NBPF1, NBPF23, BARD, and BRCA2 ().
BRCA2 was first revealed to be involved in the homologous recombination (HR) repair pathway depending on interacting with the recombination protein RAD51. For DNA double-strand breaks (DSBs), HR is a high-fidelity mechanism of repair. As one of fifteen Fanconi anemia (FA) genes, BRCA2 also participates in the HR step in inter-strand crosslinks (ICLs) repair depending on RAD51. According to a previous study, about half of the cases of early-onset breast cancer are due to different inherited mutations in the BRCA2 gene (). In pediatrics, two BRCA2 germline mutations associated with NB have been reported to date. One is BRCA2 p. W2830_E20splice detected from 56 children with NB (); the other is BRCA2 p. Y2215fs∗ identified from one NB family ().
In this study, a new compound heterozygous mutation of the BRCA2 gene was discovered in two siblings with PNTs by applying WGS technology. One of the biallelic mutations was BRCA2 rs397507634 chr13: 32911104C > A (S871Ter), which was previously found from the screening of the BRCA1/2 genes (). However, there are no reports on the relationship between this stop-gain mutant and diseases including PNTs. The other was a missense mutant BRCA2 rs144848 chr13:32906729A > C (N372H). Although it was identified as highly related to breast cancer (), ovarian cancer (), and other many kinds of cancers (; ), there is no report on whether this missense mutant is associated with PNTs. The healthy parents harbored one different allele mutant of BRCA2 separately. Unfortunately, the two children both inherited the two mutants from their parents and the novel compound heterozygous mutant of BRCA2 led to PNTs. The evidence in this study may explain how both of the children suffer from the disease despite the absence of PNTs in their parents.
Materials and Methods
Patients and Samples
This study included two young patients who were an elder sister (age at diagnosis was 30 months, II-1), and younger brother (age at diagnosis was 36 months, II-2), and their healthy parents (age at 30 s, I-1 and I-2), as shown in Figure 1A. All patients’ parents signed informed consent and this study obtained approval from the Institution’s Research Ethics Board of Hospital. DNeasy Blood and Tissue Kit (QIAGEN) was used for extracting genomic DNA from blood samples of the younger brother (II-2) and the parents (I-1 and I-2), and the tumor tissue of the siblings (II-1 and II-2). The elder sister’s tissue DNA was substituted for her genomic DNA from blood to analyze germline mutants accompanying other family members because her blood was unavailable because she had passed away when this study was conducted. DNA concentration was measured by Qubit® DNA Assay Kit in Qubit® 2.0 Fluorometer (Life Technologies, Carlsbad, CA, United States). RNA of the two patients’ tumor tissue was extracted by TRzol ().
FIGURE 1
Whole Genome Sequencing
A total of 0.5 μg of DNA per sample was used as input material for the DNA library preparations. Genomic libraries were prepared using the Illumina Truseq Nano DNA HT Sample Prep Kit following the manufacturer’s instructions. Libraries were analyzed for size distribution by Agilent 2100 Bioanalyzer. The clustering of the index-coded samples was performed on a cBot Cluster Generation System using Hiseq X PE Cluster Kit V2.5 (Illumina, San Diego, CA, United States) according to the manufacturer’s instructions. Then, the DNA libraries were sequenced on the Illumina Hiseq platform and 150 bp paired-end reads were generated.
Read Mapping and Variant Calling
Reads after quality control were aligned to the UCSC human reference genome (GRCh37/hg19 assembly) using BWA 0.7.12-r1039 mem mode. Samtools-0.1.18 was used for sorting and removing PCR duplicates, and building an index for the bam files. Variants were called using the VarScan (version 2.3.9) pipeline ().
Variant Annotation and Prioritization
The resulting variants were annotated and prioritized by ANNOVAR (). A threshold of minor allele frequency (MAF < 0.01) from the 1000 Genomes Project Asian () and ExAC () non-TCGA cohorts was used to screen rare variants. The pathogenicity of rare missense variants was evaluated by SIFT (), PolyPhen2 (), MutationTaster (), and M-CAP (; ). Other rare variants, including frameshift, prematurely truncating, and initial codon variants were also retained for further analysis.
Amplification and Sanger Sequencing of Mutation Sites
The two mutations in BRCA2 were amplified by PCR with a Veriti 96-well Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific). The primer sequences used were as follows: BRCA2-N372H (rs144848) F: 5′-CTGAAGTGGAACCAAATGATACTGA-3′, R: 5′-AGACGGTACAACTTCCTTGGAGAT-3′ ); and BRCA2–S871X (rs397507634) F: 5′- AGTGGAATACAGTGATACTGAC -3′, R: 5′- TCGTTTACACAAGTCAAGTCTG -3′. Mutations were confirmed by Sanger sequencing ().
Differential Expression Analysis and KEGG Pathway Enrichment Analysis
RNA-seq data were aligned to the UCSC human reference genome (GRCh37/hg19 assembly) using Hisat2 2.0.1 (). Expression of genes (raw count) was quantified by StingTie 1.3.5 (). Differentially expressed genes between different conditions were selected using R package DESeq2 based on the criteria of parameter: fold change > 2 and FDR < 0.05 (). KEGG pathway enrichment analysis of differentially expressed genes was carried out using the R package clusterProfiler (). Only those pathways with adjusted P-value < 0.05 were considered statistically significant.
Plasmids and Reagents
The p3xFlag-GV141-P/CAF plasmid was purchased from Shanghai GeneChem Co., Ltd. The fragment of BRCA2-290-453aa-wildtype was cloned from pDEST26 -BRCA2 gifted from Dr. Dongyi Xu (Peking University). Using BM seamless cloning kit (Biomed, China), the truncation was cloned into pXJ40-HA. The construct with a mutation in BRCA2-290-453aa-N372H was generated as described previously ().
Anti-Flag M2 agarose affinity gel and mouse monoclonal antibody against Flag was purchased from Sigma (St. Louis, MO, United States). Antibody against HA and antibody against 53BP1 were from Abcam.
Cell Culture and Reagents
SH-SY5Y cells were obtained from the American Type Culture Collection (Rockville, MD, United States). The cell line was grown in DMEM medium supplemented with 10% fetal bovine serum at 37°C in the presence of 5% CO2. For transient transfection experiments, cells were transfected with indicated constructs, using Lipofectamin 3000 (Invitrogen) following the manufacturer’s protocols.
Coimmunoprecipitation and Western Blotting
SH-SY5Y cells transfected with p3xFlag-GV141-P/CAF and pXJ40-HA- BRCA2-290-453aa-WT or pXJ40-HA-BRCA2-290-453aa-N372H were harvested and immunoprecipitation with anti-Flag M2 agarose was performed using whole cell lysates as described previously (). For the drug treatment group, 1 μM final concentration of Adriamycin (ADR) (Sigma) was added into the cell culture medium for 6 h before harvesting the whole cell lysis. Samples were separated by SDS-PAGE and detected by immunoblotting with indicated antibodies.
Results
Clinical Features
A 30-month-old Chinese girl (the proband, elder sister, and II-1; Figure 1) was diagnosed with NB, which primary site was retroperitoneum, in Shanghai Children’s Medical Center (SCMC) Affiliated to Shanghai Jiao Tong University. Serum neuron-specific enolase (NSE), serum lactate dehydrogenase (LDH), urinary vanillylmandelic acid (VMA), and urinary homovanillic acid (HVA) were all significantly elevated. The patient was diagnosed with high risk NB at stage M, with metastasis to bone and bone marrow, according to the international Neuroblastoma Risk Group (INRG) staging and risk system. Complying with SCMC-NB-2009 treatment protocol (), the proband was treated with chemotherapy before removing the primary tumor. After surgery, the proband was determined to be NB by pathological examination (Figure 1B) according to international Neuroblastoma Pathology Classification (INPC). MYCN status, 1p36, and 11q23 were all normal without amplification or deletion. Although the myeloablative therapy, autologous stem cell transplant, radiation, and isotretinoin were following applied, the girl was recurrent after 26 months from the first diagnosis with NB. Then the proband accepted additional chemotherapy and allogeneic hematopoietic stem cell transplantation. Unfortunately, the patient died 53 months after the final onset of illness (Table 1).
TABLE 1
| Patient 1 | Patient 2 | |
| (Older, II 1) | (Younger, II 2) | |
| Gender | Female | Male |
| Age at diagnosis (months) | 30 | 36 |
| Primary site | Retroperitoneal | Adrenal |
| Serum NSE | Elevated | Normal |
| Serum LDH | Elevated | Normal |
| Urinary VMA and HVA | Elevated | Normal |
| INRG stage | M (bone marrow, bone) | L1 |
| INPC | Neuroblastoma | Ganglioneuroma |
| MYCN status | Not amplified | Not amplified |
| 1p36 | Normal | Normal |
| 11q23 | Normal | Normal |
| INRG risk | High | Very low |
| Treatment schedules | Chemotherapy, surgery, myeloablative therapy and autologous stem cell transplant, radiation, and isotretinoin | Surgery and observation |
| Recurrent time (months) | 26 | − |
| Rescue therapies | Additional chemotherapy, and allogeneic hematopoietic stem cell transplantation | − |
| Prognosis | Died of disease recurrence and progression | Alive without disease |
| Follow-up time (months) | 53 | So far |
Clinical characteristics of two patients with peripheral neuroblastic tumors.
NSE, neuron-specific enolase; LDH, lactate dehydrogenase; VMA, vanillylmandelic acid; HVA, homovanillic acid; INRG, International Neuroblastoma Risk Group; INPC, International Neuroblastoma Pathology Classification.
The second case was the proband’s younger brother (63 months younger than his sister, II-2, and Figure 1). He was 36 months old at the time of diagnosis with GN, which is the same origin as NB but one benign type of PNTs in Beijing Children Hospital Affiliated with Capital Medical University. Unlike his sister, the tumor was in the adrenal gland. Serum NSE, serum LDH, urinary VMA, and urinary HVA were all normal. Besides, MYCN status, 1p36, and 11q23 were also normal without amplification or deletion, which was the same as his sister. The patient was diagnosed with very low risk GN at stage L1, according to the INRG staging and risk system. On account of this being a benign tumor, the treatment schedule only included surgery and observation, and no recurrence as yet (Table 1).
Information on the three generations of this family was collected. The grandfather of the proband died from liver cancer, and the grandmother is alive but suffering from gastric carcinoma and thyroid cancer. The maternal grandfather of the proband had Alzheimer’s, and the maternal grandmother lives with benign thyroid nodules. Other family members are healthy, including the father’s sister and her two children. The parents stated normal pregnancies and deliveries without any adverse event for the siblings.
Whole-Genome Sequencing Analysis and Pathogenic Variants Validating
The fact that the siblings in the same family suffered from PNTs strongly suggested that their carcinogenesis was caused by germline variants. Therefore, to identify the causative variants contributing to the carcinogenesis, we performed high-coverage and high-quality WGS of all family members (father, mother, sister, and brother). Specifically, more than 91.4% of the whole genome had 10-fold coverage and showed high consistency among the experiments. In addition, more than 89% of sequenced bases reached Q30 based on the analysis of the Phred-scaled quality score (Supplementary Tables 1, 2).
The variant calling analysis identified about 4.4 million variants in each family member (Supplementary Table 2). Of these, a total of shared 47088 rare variants of the siblings and their mother were selected based on MAF < 0.01. Furthermore, exonic non-synonymous variants were analyzed and 185 rare variants inherited from the mother were selected. Finally, among rare variants from the mother, as cancer driver genes, a missense mutant ALK (chr2: 30143039G > T, V163L, rs55697431), and a stop-gain mutant BRCA2 (chr13: 32911104C > A, S871Ter, rs397507634) were focused through screening using the IntOGen database (Figure 2A). For ALK-V163L, multiple databases predicted that it was a benign mutation although ALK is one of the most famous susceptibility genes for NB (Supplementary Table 3).
FIGURE 2
Meanwhile, the same strategy was performed to select shared rare variants of the siblings and their father (Figure 2A). However, there was no same gene between the mother and father by this strategy (data not shown). Knudson’s “two-hit” theory, one susceptibility gene carried different mutants from mother and father separately. Further analysis revealed that they shared total variants gained from father (no MAF value limitation), and a missense mutant BRCA2 (chr13:32906729A > C, N372H, rs144848) was selected. Although BRCA2-N372H is a common variant (C = 0.279642, GnomAD_exome) inherited from the father, it induced a novel compound heterozygous mutation of BRCA2, and combining with a stop-gain mutant BRCA2-S871Ter inherited from the mother. In other words, one allele was BRCA2-S871Ter (stop-gain) from the sibling’s mother, and the other was BRCA2-N372H (missense) from the father (Figure 2B and Supplementary Table 3). These two mutants of BRCA2 were confirmed in the four persons by Sanger sequencing (Figure 3A). In a word, the novel compound heterozygous mutation BRCA2 gene was locked as the cause of carcinogenesis.
FIGURE 3
BRCA2-S871Ter Mutant Mechanistic Association With PNTs
As a stop-gain mutation, rs397507634 (S871Ter) in BRCA2 was found first by quantitative polymerase chain reaction and high-resolution melting curve analysis (). This variation resulted in premature truncation at the 871st amino acid of the BRCA2 protein, which only includes the PALB2 and P/CAF binding domains (Figure 3B). Based on ClinVar annotation, rs397507634 in BRCA2 is related to hereditary breast and ovarian cancer syndrome (RCV000590670.1), breast-ovarian cancer, familial 2 (RCV000077282.4), and hereditary cancer-predisposing syndrome (RCV000213349.1).
By mining for the potential impact of stop-gain mutant BRCA2-S871Ter, differentially expressed genes were obtained from RNA-seq data of patients’ tumor tissue (Supplementary Table 4) and the GEO database GSE62564. There are four samples carrying BRCA2-N372H without BRCA2-S871Ter in the GSE62564 database, including three samples with homozygous mutant (NB_380, NB_390, and NB_438) and one sample with heterozygous mutant (NB_459). KEGG pathway enrichment analysis based on differential genes was performed between siblings and these four samples from the GSE62564 database. The result showed that the significant enriched KEGG pathway included DNA replication, cell cycle, and HR, which were identified with the molecular functions of BRCA2 (Figure 4A).
FIGURE 4
Besides, BRCA2-S871Ter led to early termination during BRCA2 protein translation and produced a 1–871 amino acid truncation of BRCA2 or even led to degradation of BRCA2. To simulate the functions of BRCA2-S871Ter, the GSE62564 dataset (498 samples) was analyzed. Samples with the top 25% (BRCA2 high group) and the lowest 25% (BRCA2 low group) expression of BRCA2 were taken separately. KEGG pathway enrichment analysis based on these two groups was performed (Supplementary Figure 1). The results also revealed that pathways of the cell cycle, DNA replication, and HR were enriched significantly.
BRCA2-N372H Mutant Mechanistic Association With PNTs
In addition to the BRCA2 premature truncating mutant, a missense variant rs144848 (N372H) of BRCA2 inherited from proband’s mother was considered a pathogenic variant. It has been reported to increase the risk of many kinds of cancers, especially breast and epithelial ovarian, and indicating that the variant could increase cancer susceptibility. However, there was no report that BRCA2-N372H was associated with neuroblastic tumors. This mutant locates in the P/CAF binding domain (residues 290–453) of BRCA2 (Figure 3B). This domain has been shown to mediate the interaction between BRCA2 and the histone acetyltransferase P/CAF. The formation of the BRCA2-P/CAF complex is essential for the transcriptional activation of other genes (). Co-IP was performed and showed that BRCA2-N372H substitution did not affect the interaction between BRCA2 and P/CAF absenting chemotherapeutics drug (Figure 5B). To determine the optimum concentration and time of treatment with ADR, SH-SY5Y was treated with 1 μM ADR at a different time and then detected the expression of 53BP1 by WB. The results showed that 1 μM ADR treated for 6 h could induce the expression of 53BP1, which was enhanced significantly (Figure 5A). Remarkably, after the same condition of ADR treatment (1 μM, 6 h), the interaction between BRCA2 and P/CAF was reduced significantly due to the N372H mutant in the SH-SY5Y cell line (Figure 5B). The results suggest that the BRCA2-N372H mutant could destroy the function of P/CAF in the context of DNA damage.
FIGURE 5
Dysfunctional BRCA2 Due to BRCA2 Mutants
To reveal the compound heterozygous of BRCA2 was contributed to PNTs’ carcinogenesis, KEGG pathway enrichment analysis was performed between the siblings’ RNA-seq data and 494 cases without either BRCA2-S871Ter or BRCA2-N372H mutants from the GSE62564 database. It was shown that the pathways of the cell cycle, DNA replication, FA pathway, and HR were enriched. (Figure 4B). It indicated that the compound heterozygous of BRCA2 resulted in the disordering of BRCA2 protein’s function of DNA damage and response (DDR), which was the reason two child patients suffered PNTs.
To simulate the functions of the new compound heterozygous of BRCA2, the GSE62564 dataset (498 samples) was analyzed and the one intersection of samples with the top 25% expression of both BRCA2 and P/CAF (BRCA2-P/CAF high group, 36 samples) was taken. Meanwhile, samples with the lowest 25% expression of both BRCA2 and P/CAF were taken as the other intersection from GSE62564 (BRCA2-P/CAF low group, 39 samples). KEGG pathway enrichment analysis was performed between the two intersections (Supplementary Figure 2). The results also revealed that pathways of the cell cycle, DNA replication, FA pathway, and HR pathways were enriched significantly, which was similar to our previous results (Figure 4B).
Discussion
BRCA2, a principal tumor suppressor gene, is involved in DNA damage repair and related to many types of cancer susceptibility, especially breast cancer, and ovarian cancer in adults (; ). Meanwhile, as one of the FA DNA repair-related genes, some specific BRCA2 mutants lead to a severe subset FA accompanying the early onset of cancer, including acute myeloid leukemia, brain tumors, Wilms tumor, and so on (). In pediatrics, BRCA2 p. W2830_E20splice and p. Y2215fs∗ are the only two BRCA2 germline mutations to have been reported to associate with NB (; ).
This study revealed a new compound heterozygotes mutant of BRCA2 by employing WGS of germline DNA in two siblings with PNTs and their unaffected parents. A stop-gain mutant BRCA2-S871Ter inherited from the mother and a missense mutant BRCA2-N372H inherited from the father were validated by Sanger sequencing (Figure 3A). According to Knudson’s “two-hit” theory () and KEGG pathway enrichment analysis (Figure 4B and Supplementary Figure 2), our results provide useful information that this novel compound heterozygotes mutant of BRCA2 could be the cause of carcinogenesis and a potential biomarker for PNTs.
For the stop-gain mutant, inherited from the mother of the siblings, BRCA2-S871Ter is a rare frequency variation, which has been found through qPCR-HRM based on 210 patients (). Moreover, this variation is included in some panels to detect breast cancer or ovarian cancer in clinical settings. It can lead to early termination during BRCA2 protein translation and produce a 1–871 amino acids truncation of BRCA2. In this study, western blotting was performed to detect BRCA2 expression in the siblings’ tumor tissue. Unfortunately, there was no specific signal of BRCA2 in WB (data not shown). The reason for failing to detect BRCA2 might be protein degradation for its large molecular weight. Although it is not certain whether this truncation is expressed or degraded after translation, the fact is that the functions of BRCA2 should be impacted to a great extent. As Figure 3B shows, the majority of the important domains, including BRCTs domain, helical domain, OB folds, and the TR2 domain, are not in the BRCA2 stop-gain truncation. These domains all play key roles in DNA double strand breaks repair. The BRCTs and OB fold domain are essential to BRCA2 binding to RAD51. Then the BRCA2-RAD51 complex will further promote RAD51 assembly onto single-strand DNA to carry forward HR repair. KEGG pathway enrichment analysis also confirmed the above results about BRCA2-S871Ter (Figure 4A and Supplementary Figure 1).
In addition, BRCA2-N372H is a variant associated with breast cancer and epithelial ovarian cancer (; ). Recently, an increasing number of studies have been performed to prove that the BRCA2-N372H variant is related to susceptibility to many other cancers, including multiple lymphoma, prostate cancer, advanced esophageal squamous cell carcinoma, familial colorectal tumors, and so on. Moreover, previous research has shown that BRCA2-N372H is located in the P/CAF binding domain of BRCA2. The domain from residues of amino acid 290–453 in the N-terminus of BRCA2 specifically interacts with the histone acetyltransferase P/CAF (). P/CAF belongs to the type three family of lysine acetyl transferases (KAT3) (). As a transcriptional co-activator, P/CAF binds to transcription factors and performs lysine acetyltransferases activity to acetylate these transcription factors and histones to lose condensed chromosomes. N terminus of BRCA2 is equipped with HAT activity when it bounds to P/CAF. The BRCA2-N372H variation weakens BRCA2 expression and BRCA2-P/CAF interaction and further reduces sensitivity to paclitaxel in breast cancer cells (). It indicates that BRCA2 372-His substitution induces sequential changes of BRCA2-P/CAF interaction and HAT activity, which is important in paclitaxel resistance (). ADR as the first-line chemotherapy drug to NB therapy could induce DSBs to NB cells. In our study, with ADR treatment, the interaction between BRCA2, and P/CAF was reduced significantly due to the N372H mutant in SH-SY5Y cells (Figure 5). Meanwhile, BRCA2-N372H substitution could not affect the interaction between BRCA2 and P/CAF without drugs. The results suggested that the BRCA2-N372H mutant could destroy the HAT activity of BRCA2-P/CAF in the context of DNA damage. Furthermore, like the paclitaxel resistance, this mutant could induce ADR resistance to NB cells due to lack of HAT activity. This indicates that the BRCA2-N372H mutant could be a new potential drug target in NB chemotherapy.
This study explored the reason for different malignant degrees between these two child patients. Firstly, the BRCA2-N372H variant was reported to affect fetal survival in a sex-dependent manner. With the same BRCA2-N372H variant, the survival rate of newborn females was significantly lower than males (). Secondly, WGS of the two children’s tumor tissue did not show enrichment of any distinct carcinogenesis related pathway in specific somatic variants in the siblings, respectively (Supplementary Figure 2). There were 721 individual mutant genes in the elder sister and 701 individual mutant genes in the brother. However, screening the IntOGen database revealed that the elder sister harbored more specific cancer driver genes than a brother (20 vs. 14 genes), indicating that the sister had a greater chance of developing a malignant tumor (Supplementary Tables 6,7). Furthermore, RNA-seq analysis based on the two siblings’ tissue RNA revealed that the row counts of BRCA2 mRNA expression were 91 in the sister and 898 in the brother (Supplementary Table 5). Real-time PCR was performed to confirm the relative expression of BRCA2 in the siblings’ tumor tissue. It was verified that the expression of BRCA2 in the sister was significantly lower than in the younger brother (Supplementary Figure 3). Although the sample size was limited in this study, the siblings harbored similar genetic backgrounds and the same compound heterozygous mutation of BRCA2. This indicated that as tumor suppressor genes, a low amount of BRCA2 may lead to cancer susceptibility, and therefore the malignancy degree in the sister was higher than the younger brother. However, the mechanism of different malignant degrees between the siblings needs further study.
Conclusion
Our data revealed that a novel compound heterozygous mutation of the BRCA2 gene is associated with PNTs by disordering DDR signal pathway. One allele was stop-gain mutant BRCA2-S871Ter, inherited from their mother. The other was a missense mutant BRCA2-N372H inherited from their father, which was confirmed to impair the interaction between BRCA2 and P/CAF, and induced ADR resistance in NB. Moreover, these results provided potential laboratory evidence for the clinical and prenatal diagnosis of PNTs. These results could also potentially guide clinical precision medication. For further investigation of the genotype-phenotype relationship in PNTs, future efforts should be made to recruit more families affected by this disease, and despite its rarity.
Limitations
There were some limitations in the present study. Firstly, the sample size was small, due to the study object was only one family with two siblings harboring PNTs. Secondly, we needed to make a credible conclusion by incorporating prior knowledge, because of the rarity of samples. Therefore, to further investigate the genotype-phenotype relationship in PNTs, efforts should be made to recruit more families affected by this disease. Furthermore, to decipher the molecular mechanism of the compound heterozygous of BRCA2 mutations, more studies, including cell level and animal models, and need to be performed in the future.
Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.biosino.org/node/analysis/detail/OEZ005703, OEZ005703.
Ethics statement
The studies involving human participants were reviewed and approved by Ethics Committee of the Beijing Children’s Hospital, Capital Medical University. Written informed consent to participate in this study was provided by the participants’ legal guardian/next of kin. Written informed consent was obtained from the individual(s), and minor(s)’ legal guardian/next of kin, for the publication of any potentially identifiable images or data included in this article.
Author contributions
YrY, JC, and HQ conducted the experiments, analyzed the data, and wrote the manuscript. YJ and LZ analyzed the data, reviewed, and edited the manuscript. SY, HW, LF, EH, YbY, JL, YC, and XN conducted the experiments. MX, TS, and YG designed the study, wrote, reviewed, and edited the manuscript, and administrated the project. All authors contributed to the article and approved the submitted version.
Funding
This study was supported by the National Natural Science Foundation of China (81702787, 81702463, and 31671377), the Special Fund of the Pediatric Medical Coordinated Development Center of Beijing Hospitals Authority (No. XTCX201806), Beijing Hospitals Authority Clinical Medicine Development of Special Funding Support (XMLX202121), Beijing Hospitals Authority’ Ascent Plan (DFL20191201), and Shanghai Municipal Science and Technology Major Project (2017SHZDZX01).
Acknowledgments
We are grateful to the child patients and their parents for their participation in this study.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fgene.2021.652718/full#supplementary-material
Supplementary Figure 1KEGG pathway enrichment analysis of differentially expressed genes between BRCA2 high group and BRCA2 low group from GSE62564 dataset.
Supplementary Figure 2KEGG pathway enrichment analysis of differentially expressed genes between BRCA2-P/CAF high group and BRCA2-P/CAF low group from GSE62564 dataset.
Supplementary Figure 3KEGG pathway enrichment analysis of specific somatic variants. (A) KEGG pathway enrichment of 721 individual mutant genes in elder sister. (B) KEGG pathway enrichment of 701 individual mutant genes in brother.
Supplementary Figure 4Expression of BRCA2 in the siblings. Real-time PCR to detect expression of BRCA2 in the siblings’ RNA from tumor tissue.
References
1
AdzhubeiI.JordanD. M.SunyaevS. R. (2013). Predicting functional effect of human missense mutations using PolyPhen-2.Curr. Protoc. Hum. Genet.Chapter 7:Unit7.20.
2
AlterB. P. (2014). Fanconi anemia and the development of leukemia.Best Pract. Res. Clin. Haematol.27214–221.
3
BaoY.SuoL.QianP.HuangH.YangY.TangJ.et al (2019). Clinical and genetic analysis of Dent disease with nephrotic range albuminuria in Shaanxi, China.Sci. China Life Sci.621590–1593. 10.1007/s11427-018-9829-0
4
CaiJ.PanC.TangY.ChenJ.ZhouM.LiB.et al (2017). Multivariate analysis of risk factors for patients with stage 4 neuroblastoma who were older than 18 months at diagnosis: a report from a single institute in Shanghai, China.J. Cancer Res. Clin. Oncol.1431327–1335. 10.1007/s00432-017-2379-5
5
CheungN. K.DyerM. A. (2013). Neuroblastoma: developmental biology, cancer genomics and immunotherapy.Nat. Rev. Cancer13397–411. 10.1038/nrc3526
6
CouletF.PiresF.RouleauE.LefolC.MartinS.ColasC.et al (2010). A one-step prescreening for point mutations and large rearrangement in BRCA1 and BRCA2 genes using quantitative polymerase chain reaction and high-resolution melting curve analysis.Genet. Test Mol. Biomark.14677–690. 10.1089/gtmb.2009.0183
7
DevuystO. (2015). The 1000 genomes project: welcome to a new world.Perit. Dial. Int.35676–677. 10.3747/pdi.2015.00261
8
FlaumN.CrosbieE. J.EdmondsonR. J.SmithM. J.EvansD. G. (2019). Epithelial ovarian cancer risk: a review of the current genetic landscape.Clin. Genet.9754–63. 10.1111/cge.13566
9
FuksF.MilnerJ.KouzaridesT. (1998). BRCA2 associates with acetyltransferase activity when bound to P/CAF.Oncogene172531–2534. 10.1038/sj.onc.1202475
10
GengJ.LiuY.GuoY.WangH.TaiJ.JinY.et al (2019). Correlation between TERT C228T and clinic-pathological features in pediatric papillary thyroid carcinoma.Sci. China Life Sci.621563–1571. 10.1007/s11427-018-9546-5
11
GoodmanR. H.SmolikS. (2000). CBP/p300 in cell growth, transformation, and development.Genes Dev.141553–1577.
12
HealeyC. S.DunningA. M.TeareM. D.ChaseD.ParkerL.BurnJ.et al (2000). A common variant in BRCA2 is associated with both breast cancer risk and prenatal viability.Nat. Genet.26362–364. 10.1038/81691
13
JagadeeshK. A.WengerA. M.BergerM. J.GuturuH.StensonP. D.CooperD. N.et al (2016). M-CAP eliminates a majority of variants of uncertain significance in clinical exomes at high sensitivity.Nat. Genet.481581–1586. 10.1038/ng.3703
14
Janoueix-LeroseyI.SchleiermacherG.DelattreO. (2010). Molecular pathogenesis of peripheral neuroblastic tumors.Oncogene291566–1579. 10.1038/onc.2009.518
15
KimD.LangmeadB.SalzbergS. L. (2015). HISAT: a fast spliced aligner with low memory requirements.Nat. Methods12357–360. 10.1038/nmeth.3317
16
KnudsonA. G. (1996). Hereditary cancer: two hits revisited.J. Cancer Res. Clin. Oncol.122135–140. 10.1007/bf01366952
17
KwonW. S.RhaS. Y.JeungH. C.KimT. S.ChungH. C. (2017). Modulation of HAT activity by the BRCA2 N372H variation is a novel mechanism of paclitaxel resistance in breast cancer cell lines.Biochem. Pharmacol.138163–173. 10.1016/j.bcp.2017.04.015
18
LekM.KarczewskiK. J.MinikelE. V.SamochaK. E.BanksE.FennellT.et al (2016). Analysis of protein-coding genetic variation in 60,706 humans.Nature536285–291.
19
LiH.DurbinR. (2009). Fast and accurate short read alignment with Burrows-Wheeler transform.Bioinformatics251754–1760. 10.1093/bioinformatics/btp324
20
LiZ.ZhuP.HuangH.PanY.HanP.CuiH.et al (2019). Identification of a novel COL4A5 mutation in the proband initially diagnosed as IgAN from a Chinese family with X-linked Alport syndrome.Sci. China Life Sci.621572–1579. 10.1007/s11427-018-9545-3
21
LonerganG. J.SchwabC. M.SuarezE. S.CarlsonC. L. (2002). Neuroblastoma, ganglioneuroblastoma, and ganglioneuroma: radiologic-pathologic correlation.Radiographics22911–934. 10.1148/radiographics.22.4.g02jl15911
22
LoveM. I.HuberW.AndersS. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.Genome Biol.15:550.
23
LukschR.CastellaniM. R.ColliniP.De BernardiB.ConteM.GambiniC.et al (2016). Neuroblastoma (Peripheral neuroblastic tumours).Crit. Rev. Oncol. Hematol.107163–181.
24
McKennaA.HannaM.BanksE.SivachenkoA.CibulskisK.KernytskyA.et al (2010). The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.Genome Res.201297–1303. 10.1101/gr.107524.110
25
MosseY. P.LaudenslagerM.LongoL.ColeK. A.WoodA.AttiyehE. F.et al (2008). Identification of ALK as a major familial neuroblastoma predisposition gene.Nature455930–935. 10.1038/nature07261
26
PerteaM.PerteaG. M.AntonescuC. M.ChangT. C.MendellJ. T.SalzbergS. L. (2015). StringTie enables improved reconstruction of a transcriptome from RNA-seq reads.Nat. Biotechnol.33290–295. 10.1038/nbt.3122
27
RamusS. J.VierkantR. A.JohnattyS. E.PikeM. C.Van Den BergD. J.WuA. H.et al (2008). Consortium analysis of 7 candidate SNPs for ovarian cancer.Int. J. Cancer.123380–388.
28
RitenourL. E.RandallM. P.BosseK. R.DiskinS. J. (2018). Genetic susceptibility to neuroblastoma: current knowledge and future directions.Cell Tissue Res.372287–307. 10.1007/s00441-018-2820-3
29
Rousset-JablonskiC.GompelA. (2017). Screening for familial cancer risk: focus on breast cancer.Maturitas10569–77. 10.1016/j.maturitas.2017.08.004
30
RuddM. F.SellickG. S.WebbE. L.CatovskyD.HoulstonR. S. (2006). Variants in the ATM-BRCA2-CHEK2 axis predispose to chronic lymphocytic leukemia.Blood108638–644. 10.1182/blood-2005-12-5022
31
SchwarzJ. M.CooperD. N.SchuelkeM.SeelowD. (2014). MutationTaster2: mutation prediction for the deep-sequencing age.Nat. Methods11361–362. 10.1038/nmeth.2890
32
TrochetD.BourdeautF.Janoueix-LeroseyI.DevilleA.de PontualL.SchleiermacherG.et al (2004). Germline mutations of the paired-like homeobox 2B (PHOX2B) gene in neuroblastoma.Am. J. Hum. Genet.74761–764. 10.1086/383253
33
ValenciaO. M.SamuelS. E.ViscusiR. K.RiallT. S.NeumayerL. A. (2017). The role of genetic testing in patients with breast cancer: a review.JAMA Surg.152589–594. 10.1001/jamasurg.2017.0552
34
WangK.LiM.HakonarsonH. (2010). ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data.Nucleic Acids Res.38:e164. 10.1093/nar/gkq603
35
WenhamR. M.SchildkrautJ. M.McLeanK.CalingaertB.BentleyR. C.MarksJ.et al (2003). Polymorphisms in BRCA1 and BRCA2 and risk of epithelial ovarian cancer.Clin. Cancer Res.94396–4403.
36
YangY.LiuZ.WangF.TemviriyanukulP.MaX.TuY.et al (2015). FANCD2 and REV1 cooperate in the protection of nascent DNA strands in response to replication stress.Nucleic Acids Res.438325–8339. 10.1093/nar/gkv737
37
YuG.WangL. G.HanY.HeQ. Y. (2012). clusterProfiler: an R package for comparing biological themes among gene clusters.OMICS16284–287. 10.1089/omi.2011.0118
38
ZhangJ.WalshM. F.WuG.EdmonsonM. N.GruberT. A.EastonJ.et al (2015). Germline mutations in predisposition genes in pediatric cancer.N. Engl. J. Med.3732336–2346.
Summary
Keywords
peripheral neuroblastic tumors, neuroblastoma, ganglioneuroma, whole-genome sequencing, RNA-Seq, BRCA2, cancer predisposition gene
Citation
Yang Y, Chen J, Qin H, Jin Y, Zhang L, Yang S, Wang H, Fu L, Hong E, Yu Y, Lu J, Chang Y, Ni X, Xu M, Shi T and Guo Y (2021) A Novel Germline Compound Heterozygous Mutation of BRCA2 Gene Associated With Familial Peripheral Neuroblastic Tumors in Two Siblings. Front. Genet. 12:652718. doi: 10.3389/fgene.2021.652718
Received
13 January 2021
Accepted
31 May 2021
Published
23 July 2021
Volume
12 - 2021
Edited by
Nadeem Abbas, Riphah International University, Pakistan
Reviewed by
Yifan Zhang, University of Arkansas at Little Rock, United States; Ting Li, University of Arkansas at Little Rock, United States
Updates
Copyright
© 2021 Yang, Chen, Qin, Jin, Zhang, Yang, Wang, Fu, Hong, Yu, Lu, Chang, Ni, Xu, Shi and Guo.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Min Xu, jackxm1236@126.comTieliu Shi, tieliushi@yahoo.com; tlshi@bio.ecnu.edu.cnYongli Guo, guoyongli@bch.com.cn; jackxm1236@126.com
†These authors have contributed equally to this work
This article was submitted to Genetics of Common and Rare Diseases, a section of the journal Frontiers in Genetics
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.