BRIEF RESEARCH REPORT article

Front. Genet., 29 September 2021

Sec. Genetics of Common and Rare Diseases

Volume 12 - 2021 | https://doi.org/10.3389/fgene.2021.717294

A Founder Pathogenic Variant of PPIB Unique to Chinese Population Causes Osteogenesis Imperfecta IX

  • 1. Women’s Reproductive Health Research Key Laboratory of Zhejiang Province and Department of Reproductive Endocrinology, Women’s Hospital, Zhejiang University School of Medicine, Hangzhou, China

  • 2. Department of Reproductive Endocrinology, Women’s Hospital, Zhejiang University School of Medicine, Hangzhou, China

  • 3. Department of Genetics and Reproduction, Women’s Hospital, Zhejiang University School of Medicine, Hangzhou, China

  • 4. Department of Genomic Medicine and Center for Medical Genetics, Changhua Christian Hospital, Changhua, Taiwan

  • 5. MyGenostics Inc., Beijing, China

  • 6. Division of Genetics and Genomics, Department of Neurology, Boston Children’s Hospital and Harvard Medical School, Boston, MA, United States

  • 7. Key Laboratory of Reproductive Genetics, Zhejiang University, Ministry of Education, Hangzhou, China

Abstract

Background: Osteogenesis imperfecta (OI) is a heterogeneous genetic disorder characterized by bone fragility. PPIB pathogenic variants cause a perinatal lethal form of OI type IX. A limited number of pathogenic variants have been reported so far worldwide.

Methods: We identified a rare pedigree whose phenotype was highly consistent with OI-IX. Exome sequencing was performed to uncover the causal variants. The variant pathogenicity was classified following the ACMG/AMP guidelines. The founder effect and the age of the variant were assessed.

Results: We identified a homozygous missense variant c.509G > A/p.G170D in PPIB in an affected fetus. This variant is a Chinese-specific allele and can now be classified as pathogenic. We estimated the allele frequency (AF) of this variant to be 0.0000427 in a Chinese cohort involving 128,781 individuals. All patients and carriers shared a common haplotype, indicative of a founder effect. The estimated age of variant was 65,160 years. We further identified pathogenic variants of PPIB in gnomAD and ClinVar databases, the conserved estimation of OI type IX incidence to be 1/1,000,000 in Chinese population.

Conclusion: We reported a founder pathogenic variant in PPIB specific to the Chinese population. We further provided our initial estimation of OI-IX disease incidence in China.

Introduction

Osteogenesis imperfecta (OI) is a group of hereditary connective tissue disorders that are caused by gene mutations that affect the quantity and/or quality of collagen which constitute the main framework of bones (Brusin, 2008; Hackley and Merritt, 2008; Forlino and Marini, 2016). Thus, OI has major manifestations in bone, leading to skeletal fragility, bowing deformities of long bones, and substantial growth deficiency (Marini et al., 2007). More than 20 different genetic types of OI had been reported, resulting in five clinical types (Zhytnik et al., 2020). The overall incidence of OI was estimated as from 1:5,000 to 1:20,000 per live birth without gender preference (Rauch and Glorieux, 2004; Forlino et al., 2011). The clinical presentation of OI-IX ranged from perinatal lethal to moderate osteogenesis imperfecta phenotypes (Pyott et al., 2011). Homozygous or compound heterozygous mutations in the PPIB gene had been indicated to cause OI-IX (8–9). To date, only a few pathogenic variants in PPIB have been reported. Initially, homozygous c.556–559delAAGA (p.Lys186GlnfsX8) and c.451C > T (p.Gln151X) variants were uncovered in two families (Van Dijk et al., 2009). Barnes et al. subsequently identified a homozygous c.2T > G (Barnes et al., 2010) and a homozygous c.563_566delACAG (p.Asp188Alafs*6) in OI-IX patients and their siblings. Jiang et al. reported the first Chinese OI-IX case with a compound heterozygous variant in PPIB (Jiang et al., 2017). Chang et al. reported two fetuses with a homozygous PPIB variant (c.509G > A/p.G170D) from the Taiwan region) (Chang et al., 2020).

Type IX is a severe form of OI; the PPIB gene encodes a 21-kDa protein cyclophilin B (CyPB), which catalyzes the rate-limiting step in collagen folding (Steinmann et al., 1991). CyPB also plays a role as a component of the collagen 3-hydroxylation complex and is involved in modification of types I, II, V, and XI collagen (Weis et al., 2010). CyPB deficiency would result in decreased 3-prolyl hydroxylation, post-translational overmodification, and slow collagen folding, leading to an autosomal-recessive OI (Krane, 2008).

In this study, we reported a rare but recurrent pathogenic variant in PPIB in the Chinese population. We further estimated the age of the founder mutation and the incidence of OI type IX in the Chinese population.

Subjects and Methods

Subjects

Two fetuses of similar prenatal ultrasonic phenotypes including bowed long bone of both the upper and lower limbs and short limbs from a Chinese couple were identified. Fetal femur and humerus lengths of the first fetus at 18+-week gestation were equivalent to those of a fetus at 14 + weeks, while the head circumference was equivalent to 17 + weeks. The fetal femur and humerus lengths of the second fetus at 24+-week gestation were equivalent to those of a fetus at 18 + weeks, while the head circumference was equivalent to 23 + weeks. Both parents and grandparents were normal and with no other family history of genetic bone disease. The pedigree and the results of prenatal ultrasonic examinations are shown in Figures 1, 2, respectively. This study was approved by the ethics committee of The Women’s Hospital affiliated to Zhejiang University (IRB-20210025-R).

FIGURE 1

FIGURE 2

Whole-Exome Sequencing

WES was performed on the second fetus. DNA was extracted from the umbilical cord blood. The sample from the first fetus was not available. The average cover was 242.36X. Sequence data in the form of BAM files were generated via the Picard data-processing pipeline and contained well-calibrated reads aligned to the GRCh37/hg19 human genome reference. Samples across projects were then jointly called via the Genome Analysis Toolkit (GATK, http://www.broadinstitute.org/gatk) best-practice pipeline. The pathogenicity of the variants was interpreted according to the American College of Medical Genetics and Genomics/Association for Molecular Pathology (ACMG/AMP) guidelines (Richards et al., 2015). The variant detected by WES was validated by Sanger sequencing in the whole pedigree.

Allele Frequency of the Variant

We examined the exome data of 128,781 Chinese anonymous individuals who took whole-exome sequencing test for various genetic conditions. We excluded the individuals biallelically affected for calculating AF.

Haplotype Analysis and Statistical Analysis

Shared haplotype was delineated by identifying the homozygous SNPs surrounding the pathogenic variant detected in the proband. We included data reported in patients from the Taiwan region (Chang et al., 2020) as well as the SNP data of the 11 carriers found in the Chinese cohort. The founder effect was identified by taking individuals without the c.509G > A variant from the Chinese WES cohort as control. The Fisher’s exact test was used for statistical analysis (p < 0.001 was considered significant).

Mutation Dating

We estimated the mutation age with a mutation dating web tool (https://shiny.wehi.edu.au/rafehi.h/mutation-dating), which uses the lengths of shared regions using an algorithm that makes use of recombination rates to predict the age of the most recent common ancestor (Gandolfo et al., 2014).

Incidence of OI Type IX in Chinese Population

We further identified likely pathogenic or pathogenic variants of PPIB in gnomAD and ClinVar databases. The incidence of OI type IX was estimated in the Chinese population.

Results

Detection of a Pathogenic Variant

A homozygous variant (c.509G > A/p.G170D) was identified in PPIB by WES in the proband, and the variant was in heterozygous state in both parents and grandparents. The variant was validated by Sanger sequencing (Supplementary Figure S1). It is at the genomic location of chr15:64448943 and the exon 4 of PPIB. This variant had been detected in two fetuses in homozygous status (14) and in one fetus in compound heterozygous status (19), all in Chinese families.

The following evidence applies to the pathogenicity assessment according to the ACMG/AMP guideline (Table 1); thus, there is sufficient evidence supporting this variant as “Pathogenic.”

TABLE 1

VerdictApplied rulesEvidence
PathogenicPM3Three homozygous individuals reported (= a score of 1.5) (Chang et al., 2020)
PM1Change at the pro-isomerase domain
PM2_PPresent only in the Eastern Asian population at a frequency of 17/18,394 (0.000924)
PS3_PGene expression data (Jiang et al., 2017)
PP3REVEL score 0.94
PP4Consistent with OI-IX

Pathogenicity assessment.

Estimation of the Allele Frequency, Founder Effect Analysis, and Mutation Dating

We identified 11 heterozygous carriers in the cohort of 128,781 Chinese (none suffered from any OI disorder). Thus, the overall AF of this variant in the Chinese population is 0.0000427.

We took advantage of our case with regions of homozygosity both at the upstream and downstream of the genomic location of the PPIB pathogenic variant c.509G > A and delineated the mutation-associated haplotype (Table 2). The two families reported from the Taiwan region and the 11 heterozygous carriers all shared the same SNPs surrounding the c.509G > A variant with our proband. The shared haplotypes were highlighted with blue color (Table 2). It appears there is a common breakpoint at Chr15: 64448365 in the two families from the Taiwan region, while breakpoints on the other side differed from case to case. As the coverage of WES was different, some positions of the haplotype of our proband were not tested in other patients and carriers. but the minimum common haplotype is certain, Chr15: 64448365–64792532.

TABLE 2

Chr15 positionREFALTP1P2P3P4P5P6M1M2M3M4M5M6M7M8M9M10M11
59548475CTTTTTTTTTTTTTTTTTT
59548821GAAAAA
59557518CAA
59567634TCCCCT
59572821CCACCC
59606956AGAA
59607007CTTC
59654217AGGG
59655532ATTTAT
59655578CTTT
59663443GAAAGG
59664479AGGGGGGG
59664607CAAAAAAAAAAAAAAA
59664963GCCCCCCCCC
63340647AGGGGGGGGGGGGGGGG
63349096GAAAAAAAAAAAAAAAAA
63349564CTTTTTTTTT
63351488GAAAAAAA
63351687AGGGGGGGGGGGGGGGG
63351840CAAAAAAAAAAAAAAAAAA
63352092GAAAGAA
63353760CAAAAAAAAAAAAAAAAA
63355275ATTTTTTT
63357852TGGGGGGG
63360564GAAA
63363401CCATTTTGTTTTCCCCCCCATTTTGTTTTCATTTTGTTTTCATTTTGTTTTCATTTTCATTTTGTTTTCATTTTGTTTTCATTTTGTTTTCATTTTGTTTTCATTTTGTTTTCATTTTGTTTTCATTTT
63363654AGGGGGGGGGGG
63618110ACCCCCCCCCCCC
63631327GTGGGGGG
63634405GTTTTTTTT
63639016AGGGGGGGGGGGGGGGG
63659262CCCC
63660537GAAAAAA
63666420CAAAAA
64448019TTATTTTTTTATATATATATA
64448365CTTTTTTTTTTTTTTTTTT
64448943CTTTTTTTTTTTTTTTTTT
64792532GTTTTTTTTTTTTTTTTTT
64808137CAACCAACC
64835645CTCCC
64910945GTTTT
64966403GTGGGGGG
65261931TCTTTTT
65270512GAAAA
65273075CAACACCCCCCCCCCCCCC
65273399TCCCCCCCCCCCCCCCCCC
65273595GAAAG
65298672GAAAAAAAAAA
65315961TCCCCCCCCCCCCCCCCC

The shared haplotypes at the PPIB mutation site (position 6448943).

REF indicates GRCh37/hg19 human genome reference. ALT indicates the cDNA alteration. P1–P3 indicate patient, mother, and father of family 1 from Taiwan, respectively. P4–P6 indicate patient, mother, and father of family 2 from Taiwan, respectively. M1–M11 indicate the 11 carriers in the Chinese cohort of 128,781 individuals. “—” indicates not detected. The shared haplotypes are highlighted with blue color.

This variant is not present in other populations in the gnomAD database, but are present both in the Taiwan region and the Mainland of China, thus, a Chinese specific mutation. All patients and carriers shared a common haplotype. The deCODE genetic map shows there is no recombination hot spot in the region of common haplotype. A significant linkage disequilibrium (p < 0.001, Fisher’s exact probability test) was observed in the common haplotype. Together, these data suggested that the c.509G > A variant originated from a single founder.

We utilized the shared haplotypes for estimating the oldest age of founder mutation using the mutation dating software (https://shiny.wehi.edu.au/rafehi.h/mutation-dating/) (Gandolfo et al., 2014). The result showed that the founder mutation is estimated to be 3,258 generations old (95% confidence interval: 834–16,086 generations), or 65,160 years old (95% confidence interval: 16,680–321,720 years) assuming 20 years per generation.

Estimation of the Incidence of Osteogenesis Imperfecta IX

We ascertained reported PPIB P/LP variants from databases (gnomAD and ClinVar) and recorded their AF in the Eastern Asian (EA) population (Table 3) the additive AF is 0.0010874; thus, the estimated disease incidence is about 1/1,000,000.

TABLE 3

NoNameAF in EAPathogenicity
Missence
 1c.509G > A0.000924Pathogenic
 2c.313G > A (p.Gly105Arg)0.0000544Pathogenic
 3c.26T > G (p.Met9Arg)∼0Pathogenic
Frameshit
 4c.559_562ACAG(p.Asp188fs)∼0Pathogenic
 5c.556_559del (p.Lys186fs)∼0Pathogenic
 6c.414_417dup (p.Met140fs)∼0Likely pathogenic
 7c.120del (p.Val42fs)∼0Pathogenic
Nonsense
 8c.451C > T (p.Gln151Ter)∼0Pathogenic
Splice site
 9c.343+1G > A0.000109Pathogenic

Reported P/LP variants in database and their allele frequency in Eastern Asia.

Discussion

We identified a mainland Chinese family with the recurrent homozygous c.509G > A variant in PPIB that causes OI type IX. This variant can now be classified as “Pathogenic.” Including our case, this variant has been detected in four independent families, all of Chinese origin, and the variant is absent from other populations in gnomAD; thus, this is likely a Chinese-specific pathogenic variant.

Ethnic specific variants had been reported for other autosomal recessive OI genes. For example, c.321_353del in FKBP10 was only detected in Turkish OI individuals in homozygous status as a founder mutation (Alanay et al., 2010). Essawi et al. found a recurrent exon 4 deletion p. (Gly152Alafs*5) in TMEM38B with a shared haplotype in 12 probands indicating a founder alteration (Essawi et al., 2018). Besides, LEPRE1 c.1080+1G > T mutation was also identified as a founder mutation carried by 1.5% of the West Africans and 0.4% of the African Americans (Cabral et al., 2012). The identification of ethnic specific founder mutation can help to determine screening strategy for disease prevention.

By estimating the age of the mutation, we demonstrate that the mutation originated from a founder who could be traced to Chinese ancestors over 60,000 years ago. The mutation was very old. With high AF of two flanking SNVs (chr15:g.64448365 and 64792532), this rare variant is predicted to have occurred on a common haplotype block. Since the average cover of WES for other candidates is smaller than that of the proband. Some positions on the proband’s allele were not detected for the cases from Taiwan and 11 carriers. The shared haplotypes between each of the candidates and proband maybe longer. The estimation of the age of the mutation may be younger, but the minimum shared haplotype is certain (Chr15: 64448365–64792532). This mutation will still be very old and much older than that founder mutation reported in the Chinese population. The Fabry disease-causing mutation, the GLA IVS4+919G > A, was estimated to be originated from a founder mutation that occurred in a Chinese chromosome more than 800 years ago (Liang et al., 2020).

OI is a highly heterogeneous collagen-related disorder whose phenotype ranges from barely detectable to perinatal lethal with dominant. OI-IX is one of the recessive forms due to mutations in peptidyl prolyl cis–trans isomerase PPIB gene. PPIB plays a vital role in 3-prolyl hydroxylation/rate-limiting complex of collagen I post-translational modification and folding (Marini et al., 2010). Cabral WA et al. found collagen folds more slowly in the absence of CyPB in PPIB KO cells and tissues (Cabral et al., 2014).

We estimated the additive PPIB pathogenic variants in EA population based on reported P/LP variant in database to be over 1/1,000. This is certainly a conservative estimation since some missense variants that are eventually found to be pathogenic are not ascertained, and the current data suggest that the PPIB gene can be included in expended carrier screening so that this severe condition can be prevented at an early stage.

We concluded that the recurrent c.509G > A/p.G170D variant in PPIB is pathogenic, and likely, a Chinese founder mutation can be traced back to over 60,000 years ago. Identification of such founder mutation provides important information to preventive testing and genetic counseling.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.

Ethics statement

The studies involving human participants were reviewed and approved by this study was approved by the ethics committee of The Women’s Hospital affiliated to Zhejiang University (IRB-20210025-R). Written informed consent to participate in this study was provided by the participants’ legal guardian/next of kin. Written informed consent was obtained from the individual(s), and minor(s)’ legal guardian/next of kin, for the publication of any potentially identifiable images or data included in this article.

Author contributions

WTZ, YS, and DZ designed the study. WTZ wrote the first draft of the manuscript. KY, XC, and WZ organized the database. YW, HT, and RZ performed the statistical analysis. MC collected the medical data of the patients from the Taiwan region. JW and PW collected the exome data of the Chinese population. YS and DZ extensively edited the manuscript and took the overall responsibility for the study. All authors read and approved the final manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (No. 2018YFC1005003), Primary Research and Development Plan of Zhejiang Province (No. 2021C03098) and National Natural Science Foundation of China (No. 81771535, 81974224, 82003470).

Acknowledgments

We gratefully acknowledge the patients and their families for participating in this study.

Conflict of interest

JW and PW were employed by the complany MyGenostics Inc.

The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fgene.2021.717294/full#supplementary-material

References

  • 1

    AlanayY.AvayganH.CamachoN.UtineG. E.BodurogluK.AktasD.et al (2010). Mutations in the Gene Encoding the RER Protein FKBP65 Cause Autosomal-Recessive Osteogenesis Imperfecta. Am. J. Hum. Genet.86, 551559. 10.1016/j.ajhg.2010.02.022

  • 2

    BarnesA. M.CarterE. M.CabralW. A.WeisM.ChangW.MakareevaE.et al (2010). Lack of Cyclophilin B in Osteogenesis Imperfecta with normal Collagen Folding. N. Engl. J. Med.362, 521528. 10.1056/nejmoa0907705

  • 3

    BrusinJ. H. (2008). Osteogenesis Imperfecta. Radiol. Technol.79, 535551.

  • 4

    CabralW. A.BarnesA. M.AdeyemoA.CushingK.ChitayatD.PorterF. D.et al (2012). A Founder Mutation in LEPRE1 Carried by 1.5% of West Africans and 0.4% of African Americans Causes Lethal Recessive Osteogenesis Imperfecta. Genet. Med.14, 543551. 10.1038/gim.2011.44

  • 5

    CabralW. A.PerdivaraI.WeisM.TerajimaM.BlissettA. R.ChangW.et al (2014). Abnormal Type I Collagen post-translational Modification and Crosslinking in a Cyclophilin B KO Mouse Model of Recessive Osteogenesis Imperfecta. Plos Genet.10, e1004465. 10.1371/journal.pgen.1004465

  • 6

    ChangT. Y.ChungI. F.WuW. J.ChangS. P.LinW. H.GinsbergN. A.et al (2020). Whole Exome Sequencing with Comprehensive Gene Set Analysis Identified a Biparental-Origin Homozygous c.509G>A Mutation in PPIB Gene Clustered in Two Taiwanese Families Exhibiting Fetal Skeletal Dysplasia during Prenatal Ultrasound. Diagnostics (Basel)10, 286. 10.3390/diagnostics10050286

  • 7

    EssawiO.SymoensS.FannanaM.DarwishM.FarrajM.WillaertA.et al (2018). Genetic Analysis of Osteogenesis Imperfecta in the Palestinian Population: Molecular Screening of 49 Affected Families. Mol. Genet. Genomic Med.6, 1526. 10.1002/mgg3.331

  • 8

    ForlinoA.CabralW. A.BarnesA. M.MariniJ. C. (2011). New Perspectives on Osteogenesis Imperfecta. Nat. Rev. Endocrinol.7, 540557. 10.1038/nrendo.2011.81

  • 9

    ForlinoA.MariniJ. C. (2016). Osteogenesis Imperfecta. The Lancet387, 16571671. 10.1016/s0140-6736(15)00728-x

  • 10

    GandolfoL. C.BahloM.SpeedT. P. (2014). Dating Rare Mutations from Small Samples with Dense Marker Data. Genetics197, 13151327. 10.1534/genetics.114.164616

  • 11

    HackleyL.MerrittL. (2008). Osteogenesis Imperfecta in the Neonate. Adv. Neonatal. Care8, 2130. 10.1097/01.anc.0000311013.71510.41

  • 12

    JiangY.PanJ.GuoD.ZhangW.XieJ.FangZ.et al (2017). Two Novel Mutations in the PPIB Gene Cause a Rare Pedigree of Osteogenesis Imperfecta Type IX. Clinica Chim. Acta469, 111118. 10.1016/j.cca.2017.02.019

  • 13

    KraneS. M. (2008). The Importance of Proline Residues in the Structure, Stability and Susceptibility to Proteolytic Degradation of Collagens. Amino Acids35, 703710. 10.1007/s00726-008-0073-2

  • 14

    LiangK.-H.LuY.-H.NiuC.-W.ChangS.-K.ChenY.-R.ChengC.-Y.et al (2020). The Fabry Disease-Causing Mutation, GLA IVS4+919G>A, Originated in Mainland China More Than 800 Years Ago. J. Hum. Genet.65, 619625. 10.1038/s10038-020-0745-7

  • 15

    MariniJ. C.CabralW. A.BarnesA. M. (2010). Null Mutations in LEPRE1 and CRTAP Cause Severe Recessive Osteogenesis Imperfecta. Cell Tissue Res339, 5970. 10.1007/s00441-009-0872-0

  • 16

    MariniJ. C.ForlinoA.CabralW. A.BarnesA. M.San AntonioJ. D.MilgromS.et al (2007). Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align with Collagen Binding Sites for Integrins and Proteoglycans. Hum. Mutat.28, 209221. 10.1002/humu.20429

  • 17

    PyottS. M.SchwarzeU.ChristiansenH. E.PepinM. G.LeistritzD. F.DineenR.et al (2011). Mutations in PPIB (Cyclophilin B) Delay Type I Procollagen Chain Association and Result in Perinatal Lethal to Moderate Osteogenesis Imperfecta Phenotypes. Hum. Mol. Genet.20, 15951609. 10.1093/hmg/ddr037

  • 18

    RauchF.GlorieuxF. H. (2004). Osteogenesis Imperfecta. The Lancet363, 13771385. 10.1016/s0140-6736(04)16051-0

  • 19

    RichardsS.AzizN.AzizN.BaleS.BickD.DasS.et al (2015). Standards and Guidelines for the Interpretation of Sequence Variants: a Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med.17, 405423. 10.1038/gim.2015.30

  • 20

    SteinmannB.BrucknerP.Superti-FurgaA. (1991). Cyclosporin A Slows Collagen Triple-helix Formation In Vivo: Indirect Evidence for a Physiologic Role of Peptidyl-Prolyl Cis-Trans-Isomerase. J. Biol. Chem.266, 12991303. 10.1016/s0021-9258(17)35315-2

  • 21

    Van DijkF. S.NesbittI. M.ZwikstraE. H.NikkelsP. G. J.PiersmaS. R.FratantoniS. A.et al (2009). PPIB Mutations Cause Severe Osteogenesis Imperfecta. Am. J. Hum. Genet.85, 521527. 10.1016/j.ajhg.2009.09.001

  • 22

    WeisM. A.HudsonD. M.KimL.ScottM.WuJ.-J.EyreD. R. (2010). Location of 3-hydroxyproline Residues in Collagen Types I, II, III, and V/XI Implies a Role in Fibril Supramolecular Assembly. J. Biol. Chem.285, 25802590. 10.1074/jbc.m109.068726

  • 23

    ZhytnikL.SimmK.SalumetsA.PetersM.MärtsonA.MaasaluK. (2020). Reproductive Options for Families at Risk of Osteogenesis Imperfecta: a Review. Orphanet J. Rare Dis.15, 128. 10.1186/s13023-020-01404-w

Summary

Keywords

osteogenesis imperfecta type IX, PPIB gene, founder mutation, pathogenic variant, Chinese

Citation

Zhu W, Yan K, Chen X, Zhao W, Wu Y, Tang H, Chen M, Wu J, Wang P, Zhang R, Shen Y and Zhang D (2021) A Founder Pathogenic Variant of PPIB Unique to Chinese Population Causes Osteogenesis Imperfecta IX. Front. Genet. 12:717294. doi: 10.3389/fgene.2021.717294

Received

30 May 2021

Accepted

08 September 2021

Published

29 September 2021

Volume

12 - 2021

Edited by

Przemko Tylzanowski, KU Leuven, Belgium

Reviewed by

Zirui Dong, The Chinese University of Hong Kong, China

Manogari Chetty, University of the Western Cape, South Africa

Updates

Copyright

*Correspondence: Yiping Shen, ; Dan Zhang,

†These authors have contributed equally to this work and share last authorship

This article was submitted to Genetics of Common and Rare Diseases, a section of the journal Frontiers in Genetics

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics