ORIGINAL RESEARCH article

Front. Genet., 21 August 2024

Sec. Genomics of Plants and Plant-Associated Organisms

Volume 15 - 2024 | https://doi.org/10.3389/fgene.2024.1465540

Allelic variations of HMW-GS and LMW-GS and quality analysis in Yannong series wheat cultivars/derivative lines

  • 1. Institute of Grain and Oil Crops, Yantai Academy of Agricultural Sciences, Yantai, China

  • 2. Yantai Key Laboratory of Characteristic Agricultural Biological Resources Conservation and Germplasm Innovative Utilization, College of Life Sciences, Yantai University, Yantai, China

Abstract

Introduction:

Gluten quality is one of the most important traits of the common wheat (Triticum aestivum L.). In Chinese wheat production, Yannong series cultivars/derivative lines possess unique characteristics and play an important role in both yield and quality contribution.

Methods:

To dissect their genetic basis of the gluten quality, in this study, allelic variations of high-molecular-weight glutenin subunit (HMW-GS) and low-molecular-weight glutenin subunit (LMW-GS) in 30 Yannong series wheat cultivars/derivative lines and three check cultivars were evaluated using the allele-specific molecular markers, and six crucial quality indexes were also further measured and analyzed.

Results:

The results demonstrated that the frequencies of HMW-GSs By8, Dx5+Dy10 and Dx5+Dy10+Dy12 in these 30 genotypes and three check cultivars accounted for 87.9%, 24.2% and 9.1%, respectively. For the allelic variations of LMW-GSs, Glu-A3a, Glu-A3b, Glu-A3c, Glu-A3f, and Glu-A3g were identified in 18, 9, 13, 11, and 2 genotypes, respectively; Glu-B3d, Glu-B3g and Glu-B3f were identified in 13, 23 and 4 genotypes, respectively. Notably, Yannong 999, containing By8 + Dx5 + Dy10, and Jinan 17 containing By8 + Dy12 both meet the national standard for high-quality wheat and belong to the category of first-class high-quality strong gluten wheat.

Discussion:

These findings can provide reference for wheat quality improvement and popularization in the production.

Introduction

Wheat (Triticum aestivum L.) is an important food crop that provides about 20% of the calories for human consumption in the world (; ). Protein is one of the organic compounds in wheat seeds, which accounts for 10%–12% of seed weight (). The glutenin proteins play a key role in determining the quality of the wheat flour (; ). They can be divided into four types based on the solubility: albumin dissolving in water and diluted buffer; globulin soluble dissolving in salt solution; gliadins dissolving in 70%–90% ethanol, and glutinin dissolving in dilute acid or alkali (). Under normal condition, albumin and globulin are considered as the metabolic proteins, accounting for about 15% of the glutenin proteins; whereas the remaining gliadins and glutinin are referred as the storage proteins, accounting for approximate 85%. It is reported that gliadin proteins mainly influence dough viscosity and extensibility, whereas the glutenin proteins were mainly involved in the process of dough cohesiveness and elasticity; and their relative proportions determine the distinct characteristics of the wheat gluten (; ; ).

In wheat breeding and production, the quality trait is complex which is often influenced by multiple quality indexes, such as crude protein content, wet gluten content, water absorption, stability time, maximum resistance, stretch area, and bulk density (). The content and composition of the glutenin proteins are important in determining various quality traits (). According to the molecular weight, wheat glutenin could be divided into high-molecular-weight glutenin subunits (HMW-GSs) and low-molecular-weight glutenin subunits (LMW-GSs), accounting for 7%–15% and 20%–35% of the storage protein, respectively (). The diversified allelic variations of HMW-GS and LMW-GS play a crucial role in determining different processing quality of wheat flour, particularly affecting gluten strength and dough extensibility (; ; ; ; ).

HMW-GSs are encoded by the Glu-1 locus located on the long arms of homoeologous Group I chromosomes 1A, 1B and 1D, which were designated as Glu-A1, Glu-B1 and Glu-D1, respectively (). There are two closely linked genes at each locus: x-type and y-type subunits, and the molecular weight of x-type is higher than that of y-type (). Theoretically, there are six HMW-GSs in common wheat, however, 3-5 loci were usually expressed because of allelic variations and gene silencing (). Different types of HMW-GSs have different impacts on the gluten quality (; ). It was reported that variations in Glu-D1 provided a greater contribution than that in Glu-B1 or Glu-A1 (). The LMW-GSs are encoded by Glu-3 locus that mapped on the short arms of homoeologous Group I chromosomes 1A, 1B and 1D, which were designated as Glu-A3, Glu-B3 and Glu-D3, respectively (). The LMW-GSs in 222 wheat genotypes were analyzed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and a total of 20 LMW-GS alleles were identified, including six alleles a-f at Glu-A3 locus, nine alleles a-i at Glu-B3 locus, and five alleles a-e at Glu-D3 locus (). Due to the similar migration or overlap of LMW-GS alleles in SDS-PAGE detection, accurate identification of the LMW-GS is extremely difficult. With the development of molecular markers, the gene-specific markers were developed at Glu-A3 and Glu-B3 loci (; ), but not at Glu-D3 locus due to the rarely variations of the alleles (; ). Previous studies also showed that HMW-GS can explain 18%–55% of the variations in gluten strength and elasticity, while LMW-GS can explain 20% (; ). For example, the HMW-GSs 1Ax1, 1Ax2*, 1Bx17+1By18, and 1Dx5+1Dy10 have been widely regarded as the high-quality subunits or subunit combinations, with positive effects on gluten strength and elasticity (; ). The Glu-A3b, Glu-B3b, and Glu-D3e of LMW-GSs are the alleles that mainly contribute to wheat gluten strength ().

Yannong series wheat cultivars, developed by Shandong Yantai Academy of Agricultural Sciences (Yantai, China), have unique characteristics in Chinese wheat production due to the unique ecological and climatic conditions in Yantai, China. Their promotion areas have reached 39.69 million hm2 in production (). Lots of wheat cultivars have been developed using Yannong series cultivars as parents. For instance, the backbone parent Youbaomai is the first semi-dwarf high-yield cultivar with a yield exceeding 7,500 kg/hm2 in China; Yannong 15, as a high-yield and high-quality wheat cultivar, has been used in production more than 40 years; Yannong 999, a super-high yield and strong-gluten wheat cultivar, produced 12,255 kg/hm2 in the high-yield establishment of wheat and created the highest record of wheat yield in Shandong province and the highest winter wheat yield record in the national acceptance test ().

To dissect the genetic basis of the gluten quality in Yannong series wheat cultivars/derivative lines, this study investigated the allelic variations of three key loci Glu-1, Glu-A3, and Glu-B3 affecting gluten quality using molecular markers, measured their main quality related indexes, such as protein content, wet gluten content, development time and stability time, and also explored the relationship between the allelic variations and index of gluten quality. This study could provide insights in wheat quality improvement and popularization in the production.

Materials and methods

Plant materials and field trials

Thirty Yannong series wheat cultivars/derivative lines and three check cultivars were provided by Shandong Yantai Academy of Agricultural Sciences, Yantai, China. All these genotypes were sown at Yantai National Crop Variety Regional Test Station (37° 65′59″N, 120° 47′01″E) from 2022 to 2023 in a randomized complete block design with three replicates, and among them, wheat cultivars Chinese Spring, Jimai 22 and Jinan 17 which carried subunits By8 and Dy12 at Glu-B1 and Glu-D1 locus, respectively, were used as positive controls. Each cultivar/line was planted as a plot with three rows (1.5 m length and 0.25 m between rows) and 30 seeds per row. The field management was the same as the local field production at Yantai National Crop Variety Regional Test Station. After normal maturity, each wheat genotype was separately harvested. After the grains moisture were less than 13%, phenotypes of the quality traits were gained with three replicates for each genotype.

Quality index determination

The wet gluten content, protein content, and stability time, water absorption, development time, and sedimentation value traits were set as the key factors which significantly influenced wheat quality. These six crucial quality indexes of the 30 Yannong series wheat cultivars/lines and three check cultivars were determined using the near-infrared instrument Infratec TM 1241 (Foss, Denmark) to scan NIR spectra. WinISI II v1.50 (InfraSoft International LLC, 2000) software was used to find out the final reading (). All the experiments were repeated three times.

Genotying of gluten quality related genes using gene-specific molecular markers

Genomic DNA of the 33 wheat genotypes were extracted from their young leaf using the modified cetyltrimethylammonium bromide (CTAB) method (). Then, they were tested by using 20 diagnostic markers for 21 gluten quality trait genes or gene combinations (HMW-GSs subunit alleles By8, Bx14, Dx5, Dy10 and Dy12; LMW-GSs subunit alleles Glu-A3a, Glu-A3b, Glu-A3ac, Glu-A3d, Glu-A3e, Glu-A3f, Glu-A3g, Glu-B3a, Glu-B3b, Glu-B3c, Glu-B3d, Glu-B3e, Glu-B3f, Glu-B3g, Glu-B3h, and Glu-B3i) (Table 1).

TABLE 1

GenesMarkersPrimer sequence (5’→3’)Target bands (bp)References
By8ZSBy8F5/ZSBy8R5F: TTAGCGCTAAGTGCCGTCT
R: TTGTCCTATTTGCTGCCCTT
527
Bx14AQBx14-FIAQBx14-RF: GCAGCAACTCCAACAAATG
R: CTTGGCCTGGATAGTATGAC
407
Dx5Dx5-F/Dx5-RF: CGTCCCTATAAAAGCCTAGC
R: AGTATGAAACCTGCTGCGGAC
478
Dy10UMN26-F/UMN26-RF: CGCAAGACAATATGAGCAAACT
R: TTGCCTTTGTCCTGTGTGC
397
Dyl2UMN26-F/UMN26-RF: CGCAAGACAATATGAGCAAACT
R: TTGCCTTTGTCCTGTGTGC
415
Glu-A3aLAlF/SAlRF: AAA​CAG​AAT​TAT​TAA​AGC​CGG
R: GGTTGTTGTTGTTGCAGCA
529
Glu-A3bLA3F/SA2RF: TTC​AGA​TGC​AGC​CAA​ACA​A
R: GCTGTGCTTGGATGATACTCTA
894
Glu-A3acLAlF/SA3RF: AAA​CAG​AAT​TAT​TAA​AGC​CGG573
R: GTG​GCT​GTT​GTG​AAA​ACG​A
Glu-A3dLA3F/SA4RF: TTCAGATGCAGCCAAACAA967
R: TGG​GGT​TGG​GAG​ACA​CAT​A
Glu-A3eLAlF/SA5RF: AAA​CAG​AAT​TAT​TAA​AGC​CGG
R: GGCACAGACGAGGAAGGTT
158
Glu-A3fLAlF/SA6RF: AAACAGAATTATTAAAGCCGG552
R: GCT​GCT​GCT​GCT​GTG​TAA​A
Glu-A3gLAlF/SA7RF: AAACAGAATTATTAAAGCCGG1,345
R: AAA​CAA​CGG​TGA​TCC​AAC​TAA
Glu-B3aSB1F/SB1RF: CAC​AAG​CAT​CAA​AAC​CAA​GA1,095
R: TGG​CAC​ACT​AGT​GGT​GGT​C
Glu-B3bSB2F/SB2RF: ATC​AGG​TGT​AAA​AGT​GAT​AG1,570
R: TGC​TAC​ATC​GAC​ATA​TCC​A
Glu-B3cSB3F/SB3RF: CAAATGTTGCAGCAGAGA472
R: CAT​ATC​CAT​CGA​CTA​AAC​AAA
Glu-B3dSB4F/SB4RF: CAC​CAT​GAA​GAC​CTT​CCT​CA662
R: GTT​GTT​GCA​GTA​GAA​CTG​GA
Glu-B3eSB5F/SB5RF: GAC​CTT​CCT​CAT​CTT​CGC​A669
R: GCAAGACTTTGTGGCATT
Glu-B3fgSB6F/SB6RF: TAT​AGC​TAG​TGC​AAC​CTA​CCA​T
R: CAACTACTCTGCCACAACG
812
Glu-B3gSB7F/SB7RF: CCAAGAAATACTAGTTAACACTAGTC
R: GTTGGGGTTGGGAAACA
853
Glu-B3hSB8F/SB8RF: CCA​CCA​CAA​CAA​ACA​TTA​A1,022
R: GTG​GTG​GTT​CTA​TAC​AAC​GA
Glu-B3iSB9F/SB9RF: TATAGCTAGTGCAACCTACCAT621
R: TGG​TTG​TTG​CGG​TAT​AAT​TT

Molecular markers for the detection of high and low molecular weight glutenin subunits.

The PCR amplification system was referred to the reported ones (; ) with moderate modifications: a 10 μL volume was used for PCR amplification, including 1 μL 50 ng/μL template DNA, 5 μL 2 × Taq Master Mix (Vazyme P112-03, China) and 0.5 μL 10 μM/μL primers, adding ddH2O to 10 μL. The PCR amplification procedure was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 50°C–65°C for 1 min (depending on different primers), extension at 72°C for 40–120 s (depending on different target bands); 30-36 cycles were performed in total; PCR amplification was prolonged for 10 min at 72°C and stored at 4°C. The PCR products were separated in either 8% non-denaturing polyacrylamide gels with 19:1, 29:1 or 39:1 ratios of acrylamide and bis-acrylamide, then silver stained and visualized as previously described (; ), or 1.5% agarose gel, then visualized using the Gel Documentation System (Gel Doc XR+, BIO-RAD, Hercules, CA, United States) ().

Descriptive statistics and correlation analysis

The phenotype and genotype data were analyzed using the SPSS 19.0 software (IBM, Chicago, United States). Descriptive statistics were employed to assess the variability of the examined parameters (i.e., the means, maximum, minimum, and standard deviations). Coefficients of variation (CV) also were calculated as part of the analysis of variation.

Results

Allelic variations of HMW-GS

The types of HMW-GS loci in the 30 Yannong series wheat genotypes were identified and analyzed using diagnostic markers using Chinese Spring, Jimai 22 and Jinan 17 as positive checks. Among the 33 tested wheat genotypes, the marker ZSBy8F5/ZSBy8R5 amplified the 527 bp band in 26 genotypes except for Yannong 15, Yannong 999/LS4223, Yannong 999/DH5133 and Yannong 5158/Yannong 15, suggesting the predominant subunit By8 at Glu-B1 locus (86.7%). At the Glu-D1 locus, Dx5-F/Dx5-R amplified 281 bp band in 18 genotypes, UMN26-F/UMN26-R amplified 397 bp and 415 bp bands in 18 and 15 genotypes, respectively. Therefore, 60.0%, 50.0% and 60.0% of these genotypes carry the subunits Dx5, Dy10 and Dy12, respectively (Figure 1; Table 2). The Dx5+Dy10 alleles on Glu-D1 locus was an elite allele composition for improving bread-making quality. In addition, none of genotypes carry the subunit Bx14 at the Glu-B1 locus.

FIGURE 1

TABLE 2

Cultivars/derivative linesSubunits
Yannong 999By8, Dx5, Dy10, Glu-A3a, Glu-B3f
Yannong 215By8, Dyl2, Glu-A3a, Glu-B3d, Glu-B3f
Yannong 199By8, Dx5, Dy10, Glu-A3d, Glu-B3f
Yannong 377By8, Dyl2, Glu-A3a, Glu-B3g
Yannong 836By8, Dyl2, Glu-A3c, Glu-B3d
Yannong 5158By8, Dx5, Dy10, Glu-A3c, Glu-B3d
YanBlu14-15By8, Dyl2, Glu-A3a, Glu-B3g
Yannong 672By8, Dx5, Dy10, Glu-A3c, Glu-A3d
Yannong 9292By8, Dx5, Dy10, Glu-A3d
Hang 2By8, Dyl2, Glu-A3a, Glu-B3d
Yannong 1212By8, Dy12, Glu-A3b, Glu-A3c, Glu-A3d, Glu-B3d, Glu-B3g
Yannong 15Dyl2, Glu-A3b, Glu-A3c, Glu-B3g
Yannong 999/Huaimai 33By8, Dx5, Dy10, Dyl2, Glu-A3a, Glu-A3b, Glu-A3d, Glu-A3f, Glu-B3g
Yannong 999/Jinai 176By8, Dx5, Dy10, Glu-A3a, Glu-B3g
Yannong 999/Kongmai 181By8, Dx5, Dy10, Dyl2, Glu-A3a, Glu-B3g
Yannong 999/LS4223Dx5, Dy10, Glu-A3c, Glu-A3d, Glu-A3f, Glu-A3g, Glu-B3g
Yannong 999/Jimai 22By8, Dyl2, Glu-A3a, Glu-A3b, Glu-A3d, Glu-A3f, Glu-B3d, Glu-B3g
Yannong 999/Zhoumai 28By8, Dx5, Dy10, Glu-A3a, Glu-A3b, Glu-A3d, Glu-A3f, Glu-A3g, Glu-B3d
Yannong 999/DH5133Dyl2, Glu-A3a, Glu-A3b, Glu-A3d, Glu-B3d, Glu-B3g
Zhengmai 366/Yannong 999By8, Dx5, Dy10, Dyl2, Glu-A3a, Glu-A3b, Glu-A3d, Glu-B3d, Glu-B3g
Taishan 4241/Yannong 999By8, Dx5, Dy10, Glu-A3a, Glu-A3d, Glu-A3f, Glu-B3g
Yannong 999/BY18By8, Dx5, Dy10, Glu-A3a, Glu-B3d, Glu-B3g
Yannong 999/Jinong 19By8, Dx5, Dy10, Glu-A3a, Glu-A3f, Glu-B3g
Yannong 999/Zhoumai 27By8, Dyl2, Glu-A3a, Glu-A3f, Glu-B3g
Zhoumai 27/Yannong 999By8, Dyl2, Glu-A3c, Glu-A3d, Glu-A3f, Glu-B3g
Qianhemai 17/Yannong 999By8, Dx5, Dy10, Glu-A3a, Glu-A3f, Glu-B3g
Yannong 999/Xu 748By8, Dx5, Dy10, Glu-A3c, Glu-A3d, Glu-A3f, Glu-B3g
Yannong 836/Jimai 22By8, Dx5, Dy10, Glu-A3c, Glu-A3f, Glu-B3d, Glu-B3g
Yannong 5158/Jimai 22By8, Dx5, Dy10, Glu-A3b, Glu-A3c, Glu-A3d, Glu-B3d, Glu-B3g
Yannong 5158/Yannong 15Dyl2, Glu-A3c, Glu-B3d, Glu-B3g
Chinese SpringBy8, Dyl2, Glu-A3a, Glu-A3d, Glu-B3g
Jinan 17By8, Dyl2, Glu-A3c, Glu-A3d, Glu-B3f
Jimai 22By8, Dyl2, Glu-A3b, Glu-A3c, Glu-A3d, Glu-B3g

Distribution of high and low molecular weight glutenin subunits in 30 Yannong wheat cultivars/derivative lines and three check cultivars Chinese Spring, Jinan 17 and Jimai 22.

Allelic variations of LMW-GS

At the Glu-A3 locus, seven markers were used to detect 30 Yannong series wheat genotypes using Chinese Spring, Jimai 22 and Jinan 17 as positive checks. The results showed that the markers LA1F/SA1R for Glu-A3a, LA3F/SA2R for Glu-A3b, LA1F/SA3R for Glu-A3c, LA1F/SA6R for Glu-A3f, and LA1F/SA7R for the Glu-A3g locus amplified the target bands in 18, 9, 13, 11, and 2 genotypes, respectively, indicating that they carried the responding alleles at the Glu-A3 locus (Figures 2A, B, E; Table 2). Additionally, no target bands were detected using the marker LA1F/SA5R for Glu-A3e in all the tested genotypes.

FIGURE 2

At the Glu-B3 locus, nine markers were also used to test 30 Yannong series wheat genotypes using Chinese Spring, Jimai 22 and Jinan 17 as positive checks. Among them, the marker SB4F/SB4R for Glu-B3d amplified 662 bp band in 13 genotypes. The marker SB7F/SB7R for Glu-B3g amplified 853 bp band in 23 genotypes and SB6F/SB6R for Glu-B3fg amplified 812 bp band in 27 genotypes. It was concluded that four wheat cultivars Yannong 999, Yannong 215, Yannong 199 and Jinan 17 carried Glu-B3f allele. The markers SB1F/SB1R for Glu-B3a, SB2F/SB2R for Glu-B3b, SB3F/SB3R for Glu-B3c, SB5F/SB5R for Glu-B3e, SB8F/SB8R for Glu-B3h did not amplify the target bands in all the tested wheat genotypes, suggesting that these alleles were absent in these genotypes (Figures 2C–E; Table 2).

Index of the gluten quality traits

For these 30 Yannong series wheat genotypes and three check cultivars, the protein content ranged from 11.1% to 19.2%; wet gluten content from 27.9% to 38.9%; development time from 2.7 to 8.8 min, and stability time from 3.8 to 12.5 min, respectively. Water absorption and sedimentation value ranged from 50.8 to 64.8 mL/g and 26.3–41.2 mg, respectively. The variance analysis revealed that these indexes were significantly different among 30 Yannong series wheat genotypes and three check cultivars (Figure 3; Table 3). Notably, Yannong 999 with the protein content 17.3%, wet gluten content 36.2%, water absorption 58.6 mL/g, development time 8.6 min, and stability time 11.6 min, and Jinan 17 with these indexes of 19.2%, 38.9%, 63.1 mL/g, 8.8 min and 12.5 min, both meet the national standards for high-quality wheat and belong to the category of first-class high-quality strong gluten wheat.

FIGURE 3

TABLE 3

Cultivars/linesProtein content (%)Wet gluten content (%)Sedimentation
Value (mL)
Water absorption (mL/g)Development time (min)Stability time (min)
Yannong 99917.336.236.658.68.611.6
Yannong 21514.133.629.652.83.77.6
Yannong 19914.633.239.663.84.69.3
Yannong 37713.831.532.861.23.17.9
Yannong 83611.936.328.959.73.64.1
Yannong 515815.633.935.660.25.37.8
YanBlu14-1515.834.833.559.65.35.4
Yannong 67211.128.531.260.54.86.5
Yannong 929212.527.931.260.23.96.5
Hang 213.931.534.560.23.17.6
Yannong 121213.829.732.354.23.73.8
Yannong 1516.235.430.650.83.98.6
Yannong 999/Huaimai 3315.634.635.661.24.35.9
Yannong 999/Jinan 107614.129.833.760.82.96.5
Yannong 999/Kongmai 18113.929.831.862.82.76.9
Yannong 999/LS422314.531.834.561.75.56.9
Yannong 999/Jimai 2217.134.636.560.27.29.8
Yannong 999/Zhoumai 2814.732.829.256.85.46.6
Yannong 999/DH5130314.328.934.261.83.15.9
Zhengmai 366/Yannong 99915.835.936.864.84.59.7
Taishan 4241/Yannong 99913.329.628.959.75.48.2
Yannong 999/BY1813.432.833.164.63.38.6
Yannong 999/Jimai 1914.636.734.260.54.27.2
Yannong 999/Zhoumai 271330.226.363.84.86.3
Zhoumai 27/Yannong 99913.530.528644.96.9
Qianhemai 17/Yannong 99913.833.42761.64.88.4
Yannong 999/Xu 704812.931.430.162.15.17.3
Yannong 836/Jimai 2213.632.129.260.44.88.5
Yannong 5158/Jimai 2216.937.932.160.84.99.2
Yannong 5158/Yannong 1514.829.634.259.84.89.8
Chinese Spring14.531.533.458.93.34.1
Jinan 1719.238.941.263.18.812.5
Jimai 2214.432.131.261.34.53.9

Quality indexes of 30 Yannong wheat cultivars/derivative lines and three check cultivars Chinese Spring, Jinan 17 and Jimai 22.

Relationship between the genotypes and phenotypes

The Dx5+Dy10 composition has been identified as an elite alleles composition for improving bread-making quality. In the present study, 18 of 30 Yannong series wheat cultivars or derivative lines carried Dx5+Dy10 composition, indicating it will be necessary to strengthen positive selection for the Dx5+Dy10 composition for the genetic improvement of high-quality wheat cultivars. Wheat cultivars Yannong 999, Jinan 17, Yannong 377 and Yannong 199 were identified to possess Glu-B3f locus for LMW-GS, and their protein and wet gluten contents were more than 15% and 35% (the first-class high-quality gluten standard), respectively, suggesting their elite gluten characteristics (Figure 3; Table 3). Additionally, the stability time of these genotypes containing Dx5 locus for HMW-GS and Glu-B3g locus for LMW-GS were longer than the others, such as Yannong 999 (11.6 min), Yannong 199 (9.3 min), and Yannong 5158 (7.8 min). So, they meet the second-class high-quality gluten standard of 7.0 min.

Discussion

For a long time, wheat breeding mainly focused on improving the yield, and hence neglected the pursuit of developing high quality cultivars, leading to the disconnect between wheat supply and demand and the lacking coexistence of high yield and high quality. Therefore, strengthening the breeding and production ability of high-quality wheat cultivars is of great significance for improving food security, solving food conflicts, and enhancing people’s sense of happiness. In China, Yannong series wheat cultivars have unique characteristics, such as super-high yield and the harmonious improvement between the yield and quality traits. For instance, Yannong 999, one of the representatives of the Yannong series wheat cultivars, concurrently possesses elite super-high yield and high quality performance, which reached the Chinese strong gluten wheat standard for two consecutive years in the regional test of the national Huang Huai southern winter water group. To explore genetic basis of the high quality in Yannong series wheat cultivars and their derivative lines, molecular markers for the related genes to quality were used to detect their HMW-GSs and LMW-GSs, and we also combined with the main quality phenotype indexes to dissect the grain quality traits. Determining the alleles composition conferring the quality traits could contribute to both wheat quality breeding and popularization using Yannong series wheat cultivars/derivative lines.

In wheat grain quality traits, although HMW-GS accounts for only 10% of the storage protein content, it is a key factor affecting wheat processing quality (; ). Previous studies proved that the Glu-D1 locus has the greatest effect on the processing quality of the wheat flour, while Glu-B1 and Glu-A1 have relatively less effect. The different protein subunit compositions showed diversified effects on the processing quality of wheat flour. Among them, 1, 2*, 5 + 10 are high-quality protein subunits or subunit compositions for improving the quality of gluten (; ); 2 + 12 subunit composition associated with poor quality were the most common subunit composition in 123 regional and modern bread wheat cultivars, accounting for 63.4%, and 5 + 10 subunit composition associated with strong gluten bread wheat were found in 22 wheat cultivars, accounting for only 17.8%. Besides, 2.1 + 12, 2 + 12′, and 2 + 12* subunit compositions were also found among these wheat cultivars (). Meanwhile, a previous study showed that Glu-B1 had the highest effect on the variations for the gluten, dough and end-use quality traits, whereas Glu-A1 and Glu-D3 had the lowest impact. The Glu-D1 locus had a strong impact on gluten strength but its contribution to either SDS-Sedimentation volume, gluten extensibility and bread loaf volume was minimal (). found that HMW-GS has a positive effect on dough strength, percentage of insoluble gluten aggregates, and total score of bread. Wheat genotypes containing subunits By9, Bx17, and Dx5 have the highest dough strength and percentage of insoluble gluten aggregates; the genotypes carrying Ax1, Ax2, and Dx5 have the highest total score for the bread. In this present study, the frequencies of subunit compositions Dx5+Dy10 and Dx5+Dy10+Dy12 in 30 Yannong series wheat genotypes and three check cultivars accounted for 24.2% and 9.1%, respectively. Further analysis revealed significant greater ratings for stability time among wheat cultivars carrying Dx5+Dy10, which was consistent with the report by . Despite an increasing trend in the selection frequency of Dx5+Dy10 in recent years, there is still potential for further improvement. Notably, Yannong 999 containing subunit composition By8+Dx5+Dy10 and Jinan 17 with subunit composition By8+Dy12 both meet the national standard for high-quality wheat and belong to the category of first-class high-quality strong gluten wheat. Therefore, they can be popularized in large area for high quality wheat production, and also used as elite breeding parents for high quality wheat breeding.

In analyzing the constitution of the protein subunits, there are certain difficulties in using traditional SDS-PAGE to analyze LMW-GS in hexaploid common wheat: firstly, there are more allelic variations in LMW-GS; secondly, LMW-GS exhibits similar electrophoretic mobility or overlap with alcohol content proteins (). With the development of molecular markers, a set of STS markers, including seven alleles (Glu-A3a-g) and nine alleles (Glu-B3a-i) have been successively developed (; ). Meanwhile, six alleles at Glu-D3 locus have not been developed the detected markers due to their small variations (; ). Using these markers, LMW-GS variations in 343 wheat cultivars from Xinjiang, China were analyzed, and two new types at the Glu-A3 locus, named Glu-A3new1 and Glu-A3new2, two new types at the Glu-B3 locus, named Glu-B3new3 and Glu-B3new4, were identified (). In the present study, we revealed the allelic variations of LMW-GS in 30 Yannong series wheat genotypes and three check cultivars. At the Glu-A3 locus, Glu-A3a, Glu-A3b, Glu-A3c, Glu-A3f, and Glu-A3g were identified in 18, 9, 13, 11 and two wheat cultivars/lines, respectively. At the Glu-B3 locus, Glu-B3d, Glu-B3g and Glu-B3f were identified in 13, 23 and four genotypes, respectively. Glu-A3d, Glu-A3e, Glu-B3a, Glu-B3b, Glu-B3c, Glu-B3e, and Glu-B3h were absent in all the tested 33 genotypes. These information are valuable for the popularization of these genotypes and breeding improvement using these genotypes as parents.

In the present study, allelic variations of Glu-1, Glu-A3, Glu-B3, and six crucial quality indexes were identified in 30 Yannong series wheat cultivars/derivative lines and three check cultivars. However, the quality traits are complex which are often influenced by multiple quality indexes (). In future, more quality related genes should be analyzed to identify the genetic basis of the high quality in Yannong series wheat cultivars/derivative lines, such as wheat yellow pigment, polyphenol oxidase activity, and grain (LOX) activity. Additionally, during the process of wheat high-quality breeding, more attention could be paid to combine different high quality subunits, evaluate the impact of different combinations on wheat quality and other breeding traits, and finally, find the optimal combinations for high-quality breeding.

Conclusion

In conclusion, the present study determined the allelic variations of Glu-1, Glu-A3, and Glu-B3, measured the quality related traits, and explored the relationship between allelic combinations and quality performance in 30 Yannong series wheat cultivars/derivative lines and three check cultivars. Therefore, this study could provide reference information for modern wheat quality improvement and popularization in the production.

Statements

Data availability statement

The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.

Author contributions

NS: data curation, formal analysis, investigation, methodology, resources, software, validation, visualization. YM: data curation, formal analysis, investigation, methodology, resources, software, validation, visualization, and writing–review and editing. DW: data curation, formal analysis, investigation, methodology, resources, software, validation, visualization, and writing–review and editing. JL: data curation, formal analysis, investigation, methodology, validation, visualization, and writing–review and editing. TY: formal analysis, investigation, methodology, validation, visualization, and writing–review and editing. WL: formal analysis, investigation, methodology, validation, visualization, and writing–review and editing. NY: formal analysis, investigation, methodology, validation, visualization, and writing–review and editing. XX: formal analysis, investigation, methodology, validation, visualization, and writing–review and editing. LL: conceptualization, funding acquisition, project administration, validation, visualization, and writing–review and editing. YJ: conceptualization, project administration, validation, visualization, writing–original draft, and writing–review and editing. PM: conceptualization, project administration, validation, visualization, and writing–review and editing.

Funding

The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This research was financially supported by the research and application of rapid and accurate breeding technology system for wheat (2023CXPT016), and National Modern Wheat Industry Technology System, Yantai Comprehensive Experimental Station project(CARS-03-62).

Acknowledgments

We are grateful to the editor and reviewers for handling our manuscript and providing critical suggestions.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1

    BiesiekierskiJ. (2017). What is gluten?J. Gastroenterol. Hepatol.32, 78–81. 10.1111/jgh.13703

  • 2

    ChenG.EhmkeL.MillerR.FaaP.SmithG.LiY. (2018). Effect of sodium chloride and sodium bicarbonate on the physicochemical properties of soft wheat flour doughs and gluten polymerization. J. Agric. Food Chem.66, 6840–6850. 10.1021/acs.jafc.8b01197

  • 3

    DaiY.XuD.YanY.WenZ.ZhangJ.ChenH.et al (2020). Characterization of high- and low-molecular-weight glutenin subunits from Chinese Xinjiang wheat landraces and historical varieties. J. Food Sci. Technol.57, 3823–3835. 10.1007/s13197-020-04414-5

  • 4

    GaoX.LiuT.YuJ.LiL.FengY.LiX. (2016). Influence of high-molecular-weight glutenin subunit composition at Glu-B1 locus on secondary and micro structures of gluten in wheat (Triticum aestivum L.). Food Chem.197, 1184–1190. 10.1016/j.foodchem.2015.11.085

  • 5

    GaoY.AnK. X.GuoW. W.ChenY. M.ZhangR. J.ZhangX.et al (2021). The endosperm-specific transcription factor TaNAC019 regulates glutenin and starch accumulation and its elite allele improves wheat grain quality. Plant Cell33, 603–622. 10.1093/plcell/koaa040

  • 6

    GebrewahidT.ZhangP.YaoZ.LiZ.LiuD. (2020). Identification of leaf rust resistance genes in bread wheat cultivars from Ethiopia. Plant Dis.104, 2354–2361. 10.1094/pdis-12-19-2606-re

  • 7

    GianibelliM.LarroqueO.MacritchieF.WrigleyC. (2001). Biochemical, genetic, and molecular characterization of wheat glutenin and its component subunits. Cereal Chem.78, 635–646. 10.1094/cchem.2001.78.6.635

  • 8

    GoesaertH.BrijsK.VeraverbekeW.CourtinC.GebruersK.DelcourJ.et al (2005). Wheat flour constituents: how they impact bread quality, and how to impact their functionality. Trends Food Sci. Technol.16, 12–30. 10.1016/J.TIFS.2004.02.011

  • 9

    GuptaR.MacRitchieF. (1991). A rapid one-step one-dimensional SDS-PAGE procedure for analysis of subunit composition of glutenin in wheat. J. Cereal Sci.14, 105–109. 10.1016/S0733-5210(09)80130-6

  • 10

    GuzmánC.CrossaJ.MondalS.GovindanV.HuertaJ.Crespo-HerreraL.et al (2022). Effects of glutenins (Glu-1 and Glu-3) allelic variation on dough properties and bread-making quality of CIMMYT bread wheat breeding lines. Field Crops Res.284, 108585. 10.1016/J.FCR.2022.108585

  • 11

    HanG.LiuH.ZhuS.GuT.CaoL.YanH.et al (2024a). Two functional CC-NBS-LRR proteins from rye chromosome 6RS confer differential age-related powdery mildew resistance to wheat. Plant Biotechnol. J.22, 66–81. 10.1111/pbi.14165

  • 12

    HanG.WangJ.YanH.CaoL.LiuS.LiX.et al (2023). Development and molecular cytogenetic identification of a new wheat-rye 6RL ditelosomic addition and 1R (1B) substitution line with powdery mildew resistance. J. Integr. Agric.10.1016/j.jia.2023.10.004

  • 13

    HanG.WangJ.YanH.GuT.CaoL.LiuS.et al (2024b). Development and identification of two novel wheat-rye 6R derivative lines with adult-plant resistance to powdery mildew and high-yielding potential. Crop J.12, 308–313. 10.1016/j.cj.2023.09.003

  • 14

    IrshadA.GuoH.XiongH.XieY.JinH.GuJ.et al (2023). Evaluation of altered starch mutants and identification of candidate genes responsible for starch variation in wheat. BMC Plant Biol.23, 377. 10.1186/s12870-023-04389-3

  • 15

    JacksonE.MorelM.Sontag-StrohmT.BranlardG.MetakovskyE.RedaelliR. (1996). Proposal for combining the classification systems of alleles of Gli-1 and Glu-3 loci in bread wheat (Triticum aestivum L.). J. Genet. Breed.50, 321–336.

  • 16

    JiangP.XueL.DuanY.GuY.MuJ.HanS.et al (2019). Effects of high-molecular-weight glutenin subunit combination in common wheat on the quality of crumb structure. J. Sci. Food Agric.99, 1501–1508. 10.1002/jsfa.9323

  • 17

    JinH.WangZ.LiD.WuP.DongZ.RongC.et al (2015). Genetic analysis of chromosomal loci affecting the content of insoluble glutenin in common wheat. J. Genet. Genomics42, 495–505. 10.1016/j.jgg.2015.04.010

  • 18

    JinY.HanG.ZhangW.BuB.ZhaoY.WangJ.et al (2024). Evaluation and genetic dissection of the powdery mildew resistance in 558 wheat accessions. New Crops1, 100018. 10.1016/j.ncrops.2024.100018

  • 19

    LeiZ.GaleK.HeZ.GianibelliC.LarroqueO.C. XiaX.et al (2006). Y-type gene specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat. J. Cereal Sci.43, 94–101. 10.1016/j.jcs.2005.08.003

  • 20

    LiS.LiuY.TongJ.YuL.DingM.ZhangZ.et al (2019). The overexpression of high-molecular-weight glutenin subunit Bx7 improves the dough rheological properties by altering secondary and micro-structures of wheat gluten. Food Res. Int.130, 108914. 10.1016/j.foodres.2019.108914

  • 21

    LiuJ.YuJ.WangP.SunL.SunN.FengY.et al (2019). Research progress and prospect of Yannong series wheat. China Seed Ind.11, 18–22. 10.19462/j.cnki.1671-895x.20191023.021

  • 22

    LiuL.HeZ.YanJ.ZhangY.XiaX.PenaR. (2005). Allelic variation at the Glu-1 and Glu-3 loci, presence of the 1B.1R translocation, and their effects on mixographic properties in Chinese bread wheats. Euphytica142, 197–204. 10.1007/s10681-005-1682-4

  • 23

    LiuS.ChaoS.AndersonJ. (2008). New DNA markers for high molecular weight glutenin subunits in wheat. Theor. Appl. Genet.118, 177–183. 10.1007/s00122-008-0886-0

  • 24

    LuJ.PangL.ChaiS. (2017). Effects of HMW-GS on quality properties of spring wheat and e-valuation of subunit score system. J. Nucl. Agric. Sci.31, 80–87. 10.11869/j.issn.100-8551.2017.01.0080

  • 25

    NagamineT.KaiY.TakayamaT.YanagisawaT.TayaS. (2000). Allelic variation at the Glu-1 and Glu-3 loci in southern Japanese wheats, and its effects on gluten properties. J. Cereal Sci.32, 129–135. 10.1006/jcrs.2000.0323

  • 26

    OomsN.DelcourJ. (2019). How to impact gluten protein network formation during wheat flour dough making. Curr. Opin. Food Sci.25, 88–97. 10.1016/j.cofs.2019.04.001

  • 27

    PayneP.LawC.MuddE. (1980). Control by homoeologous group 1 chromosomes of the high molecular-weight subunits of glutenin, a major protein of wheat endosperm. Theor. Appl. Genet.58, 113–120. 10.1007/BF00263101

  • 28

    PayneP.NightingaleM.KrattigerA.HoltL. (1987). The relationship between HMW glutenin subunit composition and the bread-making quality of British-grown wheat varieties. J. Sci. Food Agric.40, 51–65. 10.1002/jsfa.2740400108

  • 29

    PengZ.GaoY.ChenP.LvC.ZhaoG. (2022). Recent advances in the study of wheat protein and other food components affecting the gluten network and the properties of noodles. Foods11, 3824. 10.3390/foods11233824

  • 30

    RasheedA.JinH.XiaoY.ZhangY.HaoY.ZhangY.et al (2019). Allelic effects and variations for key bread-making quality genes in bread wheat using high-throughput molecular markers. J. Cereal Sci.85, 305–309. 10.1016/J.JCS.2018.12.004

  • 31

    SantosF.PenaS. J.EpplenJ. (1993). Genetic and population study of a Y-linked tetranucleotide repeat DNA polymorphism with a simple non-isotopic technique. Hum. Genet.90, 655–656. 10.1007/bf00202486

  • 32

    SharpP.KreisM.ShewryP.GaleM. (1988). Location of β-amylase sequences in wheat and its relatives. Theor. Appl. Genet.75, 286–290. 10.1007/BF00303966

  • 33

    ShermanJ.VarellaA.LanningS.MartinJ.HeoH.NashD.et al (2018). Effect of a gene for high dough strength on whole wheat baking parameters of hard white spring wheat. Cereal Chem.95, 411–417. 10.1002/cche.10042

  • 34

    ShewryP.HalfordN.TathamA.PopineauY.LafiandraD.BeltonP. (2003). The high molecular weight subunits of wheat glutenin and their role in determining wheat processing properties. Adv. Nutr.45, 219–302. 10.1016/s1043-4526(03)45006-7

  • 35

    ShwryP.TathamA.BarroF.BarceloP.LazzeriP. (1995). Biotechnology of breadmaking: unraveling and manipulating the multi-protein gluten complex. Nat. Biotechnol.13, 1185–1190. 10.1038/nbt1195-1185

  • 36

    SönmezM.GüleçT.DemirB.BayraçC.ÇakmakM.AydinN. (2023). Molecular screening of the landraces from Turkey and modern bread wheat (Triticum aestivum L) cultivars for HMW-GS, wbm, waxy genes and Lr34 gene. Genet. Resour. Crop Evol.70, 775–788. 10.1007/s10722-022-01460-0

  • 37

    WangB.MengT.XiaoB.YuT.YueT.JinY.et al (2023). Fighting wheat powdery mildew: from genes to fields. Theor. Appl. Genet.136, 196. 10.1007/s00122-023-04445-4

  • 38

    WangD.ZhangK.DongL.DongZ.LiY.HussainA.et al (2018). Molecular genetic and genomic analysis of wheat milling and end-use traits in China: progress and perspectives. Crop J.6, 68–81. 10.1016/j.cj.2017.10.001

  • 39

    WangL.LiG.PeñaR.XiaX.HeZ. (2010). Development of STS markers and establishment of multiplex PCR for Glu-A3 alleles in common wheat (Triticum aestivum L.). J. Cereal Sci.51, 305–312. 10.1016/j.jcs.2010.01.005

  • 40

    WangL.ZhaoX.HeZ.MaW.AppelsR.PeñaR.et al (2009). Characterization of low-molecular-weight glutenin subunit Glu-B3 genes and development of STS markers in common wheat (Triticum aestivum L.). Theor. Appl. Genet.118, 525–539. 10.1007/s00122-008-0918-9

  • 41

    WeegelsP.vande PijpekampA.GravelandA.HamerR.SchofieldJ. (1996). Depolymerisation and re-polymerisation of wheat glutenin during dough processing.1. Relationships between glutenin macropolymer content and quality parameters. J. Cereal Sci.23, 103–111. 10.1006/jcrs.1996.0082

  • 42

    XinQ.YinY.LiuX.LiL.ZhaoQ.JiangH.et al (2019). New wheat variety‘Yannong 999’: characteristics and breeding strategy. Chin. Agric. Univ.35, 6–10. 10.11924/j.issn.1000-6850.casb18020078

  • 43

    XuT.ZhangX.DongY. (2006). Expression analysis of HMW-GS 1Bx14 and 1By15 in wheat varieties and transgenic research of 1By15 gene. Agr. Sci. China.5, 725–735. 10.1016/S1671-2927(06)60117-X

  • 44

    YuZ.PengY.IslamM.SheM.LuM.LafiandraD.et al (2019). Molecular characterization and phylogenetic analysis of active y-type high molecular weight glutenin subunit genes at Glu-A1 locus in wheat. J. Cereal Sci.86, 9–14. 10.1016/j.jcs.2019.01.003

  • 45

    ZhangY.TangJ.YanJ.ZhangY.ZhangY.XiaX.et al (2009). The gluten protein and interactions between components determine mixograph properties in an F6 recombinant inbred line population in bread wheat. J. Cereal Sci.50, 219–226. 10.1016/j.jcs.2009.05.005

  • 46

    ZhaoX.XiaX.HeZ.GaleK.LeiZ.AppelsR.et al (2006). Characterization of three low-molecular-weight Glu-D3 subunit genes in common wheat. Theor. Appl. Genet.113, 1247–1259. 10.1007/s00122-006-0379-y

Summary

Keywords

wheat, gluten quality, high-molecular-weight glutenin subunit, low-molecular-weight glutenin subunit, molecular markers

Citation

Sun N, Mu Y, Wang D, Li J, Yuan T, Liu W, Yu N, Xu X, Li L, Jin Y and Ma P (2024) Allelic variations of HMW-GS and LMW-GS and quality analysis in Yannong series wheat cultivars/derivative lines. Front. Genet. 15:1465540. doi: 10.3389/fgene.2024.1465540

Received

16 July 2024

Accepted

07 August 2024

Published

21 August 2024

Volume

15 - 2024

Edited by

Jun Zheng, Shanxi Academy of Agricultural Sciences, China

Reviewed by

Jindong Liu, Chinese Academy of Agricultural Sciences, China

Jiajia Zhao, Shanxi Agricultural University, China

Zhu-Qing Shao, Nanjing University, China

Updates

Copyright

*Correspondence: Pengtao Ma, ; Yuli Jin, ; Linzhi Li,

† These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics