Abstract
Background:
Primary ciliary dyskinesia (PCD) is a rare genetic disorder caused by structural or functional abnormalities of motile cilia, characterized by considerable clinical and genetic heterogeneity. Although exome sequencing (ES) can improve the diagnostic rate of PCD, more than 30% of patients with clinically suspected PCD remain undiagnosed by initial ES. The American College of Medical Genetics and Genomics (ACMG) recommends periodic reanalysis of ES data to increase the diagnostic yield.
Methods:
We investigated a 35-year-old female patient with bronchiectasis and a strong clinical suspicion of PCD from Peking Union Medical College Hospital. The patient’s ES data, which had initially yielded negative results in August 2024, was reanalyzed in early 2025 employing a “genotype-phenotype-inheritance pattern” strategy. A minigene assay was conducted to validate the pathogenicity of the identified CFAP54 splicing variant. Variant pathogenicity was classified according to the ACMG/AMP guidelines.
Results:
The patient had a history of rhinitis and neonatal pneumonia. Pulmonary function tests revealed moderate obstructive ventilatory dysfunction. ES reanalysis identified a homozygous variant, CFAP54 (NM_001306084.2):c.6965 + 5G >A, which was initially classified as a variant of uncertain significance. Minigene assays confirmed that this variant induced exon 50 skipping, resulting in a frameshift and a premature termination codon (loss-of-function). This variant was subsequently reclassified as “Likely Pathogenic”.
Conclusion:
This study is the first to describe CFAP54:c.6965 + 5G >A and confirm its pathogenicity. This finding brings the total number of CFAP54-associated PCD patients to eight and the number of distinct CFAP54 mutations to twelve, thereby enriching the phenotypic and genotypic spectrum of this gene. Furthermore, this effective strategy of “ES reanalysis + minigene verification” resolved the diagnostic dilemma in initially ES-negative PCD cases, providing a replicable molecular diagnostic framework for similar scenarios.
Introduction
Primary ciliary dyskinesia (PCD) is a rare genetic disorder caused by structural or functional abnormalities of motile cilia, characterized by significant clinical and genetic heterogeneity. It is predominantly inherited in an autosomal recessive manner, although X-linked recessive and autosomal dominant inheritance have also been reported (1, 2). To date, over 50 PCD-causing genes have been identified worldwide. The vast majority of these genes encode proteins associated with the axoneme of motile cilia or sperm flagella, the ciliary membrane, the basal body, or are key factors involved in proper cilium assembly (3). A small number of other causative genes regulate the processes of motile cilium biogenesis, differentiation, and maturation (4).
As a classic multisystem ciliopathy, PCD primarily manifests as chronic respiratory tract diseases (nose, sinuses, middle ear, and lungs). It can also lead to fertility issues, hydrocephalus (5) and situs inversus or congenital heart defects (6). It is reported that the global prevalence of PCD is at least 1/7554 (7). However, the incidence of PCD varies considerably across different regions, ethnicities, and data sources, with reported rates ranging from 1/10,000 to 1/40,000 (8, 9). Notably, the scarcity of reported PCD cases in China, coupled with the strong phenotypic heterogeneity of the disease, significantly increases the risk of underdiagnosis or misdiagnosis (10).
In clinical practice, the application of exome sequencing (ES) has substantially improved the diagnostic rate for PCD, with reported diagnostic yields ranging between 25% and 40% across different studies (11, 12). While diagnostic rates for PCD using ES have been reported to reach approximately 70% (3, 13), over 30% of patients with a clinical suspicion of PCD remain without a definitive molecular diagnosis following initial ES testing.
The continuous discovery of novel PCD-causing genes, the re-interpretation of Variants of Uncertain Significance (VUS), and advancements in bioinformatics technologies have made the reanalysis of initially negative ES data a crucial strategy for identifying potential pathogenic variants. Reanalysis of ES encompasses two primary approaches: phenotype-driven reanalysis and genotype-driven reanalysis (14). The value of phenotype-driven reanalysis resides in its capacity to conduct targeted reassessment of existing variants by incorporating updated phenotypic correlations, particularly when a patient’ s clinical manifestations or family history are revised (15). This process facilitates the identification of previously overlooked variants that may attain clinical relevance subsequent to refinement or expansion of the phenotypic profile.
Genotype-driven reanalysis derives its value from leveraging newly available evidence at the gene and variant levels, including recently established gene-disease relationships, functional study data, updated population frequency information, and enhanced bioinformatic pipelines (16). It is noteworthy that an improved understanding of the genetic etiology of the patient’ s condition enables the identification of newly reported disease-associated genes and variants that have emerged over time, even when there is no updated phenotypic information. In this study, we detected variants in CFAP54 through reanalysis, a gene newly listed in OMIM in 2025 as associated with PCD. These two reanalysis strategies are complementary in nature and are highly dependent on sustained collaboration between laboratories and clinicians. Currently, ES data reanalysis is formally recommended by the American College of Medical Genetics and Genomics (ACMG) and can be performed periodically by laboratories based on clinician requests, thereby leveraging the core role of ES technology in the clinical diagnosis of PCD (17).
In recent years, novel PCD-causing genes have been continuously identified, including CFAP54 (OMIM: 621121). In 2023, Tian et al. reported that biallelic deleterious mutations in CFAP54 cause severe macrozoospermia and multiple morphological abnormalities of the sperm flagella (MMAF) and non-obstructive azoospermia (NOA) in humans (18). They postulated that CFAP54 might directly or indirectly regulate the localization/expression of IFT20, IFT52, IFT122, and SPEF2, thereby affecting sperm flagella assembly and spermatogenesis. In September of the same year, our group reported two unrelated PCD pedigrees (19), further elucidating the disease association of CFAP54. The patients in both families carried compound heterozygous variants in CFAP54, whose pathogenicity was confirmed through relevant functional experiments. By generating and phenotypically validating a knock-in mouse model, CFAP54 was established as a novel PCD-causing gene. Its variants lead to PCD and reproductive abnormalities by reducing mRNA expression and disrupting the structure and function of cilia and sperm flagella, thus expanding the spectrum of PCD pathogenesis. In December 2024, Kai Wohlgemuth et al. identified biallelic variants in CFAP54 in four unrelated families affected by PCD (20), including nonsense, splice-site, and frameshift mutations, all meeting ACMG criteria for pathogenicity. They discovered that CFAP54 forms a C1d subcomplex of the ciliary central apparatus (CA) with CFAP46 and CFAP74. Variants in CFAP54 led to the absence of CFAP46 localization in the ciliary axoneme, while variants in CFAP74 reduced its axonemal localization, collectively disrupting the integrity of the C1d projection.
As of the initiation of this study, a total of 7 cases of CFAP54-related PCD have been reported globally, cumulatively involving 11 pathogenic variants (Figure 1A). This study reports a case with a rare CFAP54 variant identified through ES data reanalysis, with its pathogenicity confirmed by functional validation, thereby supplementing the mutational spectrum and evidence for the pathogenic mechanisms associated with this gene.
FIGURE 1
Mutation spectrum and schematic diagram of the functional domains of CFAP54.(A) Summary of the CFAP54 mutation spectrum reported prior to this study. The variant identified in this study is highlighted in red. (B) Schematic representation of the functional domains of the CFAP54 protein, which includes a Coiled-coil motif and a domain of unknown function (DUF).
Materials and methods
Patients and clinical materials
A 35-year-old female presented to the outpatient clinic of the Department of Pulmonary and Critical Care Medicine, Peking Union Medical College Hospital, due to bronchiectasis. At the age of 17, she underwent a chest computed tomography (CT) scan for cough and expectoration, which revealed bronchiectasis. Since then, her symptoms have been stable, and she denied a history of recurrent respiratory infections with normal exercise tolerance. A recent chest CT scan, performed due to aggravated cough and expectoration, revealed multiple bronchiectasis in both lungs (Figure 2). She was a full-term infant with a history of neonatal pneumonia and has had rhinitis for more than 10 years. She conceived naturally and has one son. Her parents are non-consanguineous and have no respiratory symptoms. Physical examination revealed moist rales in the left lower lung, with no situs inversus. Her nasal exhaled nitric oxide level was 149.6 nl/min, which was within the normal range. Pulmonary function tests revealed moderate obstructive ventilatory dysfunction, with a forced expiratory volume in 1 s (FEV1) of 1.9 L, FEV1 percentage of predicted value of 58%, and FEV1/forced vital capacity ratio of 56.83%. Sputum culture yielded Pseudomonas aeruginosa. Her antinuclear antibody, rheumatoid factor, immunoglobulin, lymphocyte count, eosinophil count, Aspergillus-specific IgE, and sweat chloride test were all normal, essentially ruling out bronchiectasis caused by connective tissue diseases, immunodeficiency, allergic bronchopulmonary aspergillosis, and cystic fibrosis.
FIGURE 2
Chest CT of the proband. (A) Chest CT showed multiple cystic and cylindrical bronchiectasis with wall thickening in the right middle lobe and left lingular lobe. (B) Chest CT showed multiple cystic and cylindrical bronchiectasis with wall thickening in the left lower lobe.
Peripheral blood samples were collected from the proband for subsequent experimental analysis. All study procedures were approved by the Institutional Review Board of Peking Union Medical College Hospital (I-23PJ390), and written informed consent was obtained from the patient.
Sample processing and ES sequencing
Genomic DNA was extracted from the patient’s EDTA-anticoagulated venous blood sample using the QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s standard protocol. Exome capture was performed on the gDNA using the Agilent SureSelect Human All Exon V6 probe (Agilent, USA), followed by ES.
Multi-dimensional reanalysis strategy for ES data
Genotype-driven analysis: We selected variants classified as pathogenic or likely pathogenic within the Phoenix platform1. Additionally, potentially pathogenic variants, including rare loss-of-function (LOF) variants and ClinVar/HGMD pathogenic variants, with a MAF <0.01 and a variant allele fraction (VAF) >0.2, were included. Following manual curation (e.g., assessing phenotype-inheritance mode compatibility), the VCF file was imported into the Franklin platform2 for secondary analysis. Results from both platforms were compared and integrated.
Inheritance mode-driven analysis: Filtering criteria were set based on inheritance patterns, including autosomal recessive, autosomal dominant, X-linked recessive, and X-linked dominant. Variants were filtered in conjunction with OMIM disease phenotypes and Human Phenotype Ontology terms. The match between the variant’s implied inheritance pattern and the patient’s clinical phenotype was assessed manually.
Phenotype-driven analysis: The Human Phenotype Ontology includes the following terms: HP:0002110 Bronchiectasis; HP:0012384 Rhinitis; HP:0012735 Cough; and HP:0031245 Productive Cough. Based on the Phoenix clinical phenotype results, variants with a phenotype score of H (or a custom threshold) and MAF <0.01 were selected, and their pathogenicity was preliminarily assessed according to the ACMG/AMP guidelines. Copy number variations (CNVs) with an AnnotSV (ClinGen) score >0.5 were also retained, with a focus on candidate genes associated with PCD and respiratory diseases.
Candidate variant filtering and sanger validation
Candidate variants were filtered against public databases (1000 Genomes, ExAC, gnomAD, and ESP) (21–23) to exclude those with a minor allele frequency (MAF) ≥0.01. Specific primers were designed using Primer 5 software, and Sanger sequencing was employed to validate the shortlisted candidate variants, confirming their presence.
Minigene plasmid construction
To validate the pathogenicity and splicing impact of the CFAP54 (NM_001306084.2):c.6965 + 5G > A variant, a minigene assay was performed using the pCAS2 vector (with a multiple cloning site located between the vector’s inherent exon A and B). Given the variant’s location in intron 50, genomic DNA fragments from both a control individual and the patient were PCR-amplified. These fragments spanned a complete region including exon 49, intron 49, exon 50, and partial segments of intron 48 (542 bp) and intron 50 (718 bp), resulting in a total fragment length of 3383 bp. The amplified fragments were directionally cloned into the BamHI-digested and linearized pCAS2 vector using the In-Fusion HD Cloning Kit (Takara, Japan). This process generated wild-type (c.6965 + 5G) and mutant (c.6965 + 5A) plasmids. The primer sequences used were:
-
CFAP54-BamHI-F: AAGAAGTGCAGGATCTTTGTTGTA AGAATCAGCTTCAGCC
-
CFAP54-BamHI-R: CTTTCTCCTGGGATCAACAGTTCAG TGCAATATGATGC
Transfection of minigene plasmids and cDNA sequencing
HEK293 cells were cultured in 6-well plates (1 × 106 cells per well) and transfected with the recombinant plasmids using Lipofectamine 3000 (Life Technologies, CA, USA). Transfections were performed in triplicate for each plasmid (wild-type, mutant, and empty vector), with the empty vector serving as a negative control to exclude interference from the vector’s own sequences on splicing outcomes. Forty-eight hours post-transfection, cells were harvested, and total RNA was extracted using TRIzol reagent (Gibco, San Francisco, CA, USA). RNA purity and concentration were measured using a NanoDrop 2000 spectrophotometer (Thermo, Lithuania) to ensure quality for subsequent steps. Qualified RNA was reverse-transcribed into cDNA using the PrimeScript RT Master Mix (Takara, Japan). Reverse transcription-polymerase chain reaction (RT-PCR) primers were designed to span the vector exons and the target gene exons, with the forward primer situated between vector exon A and target exon 49, and the reverse primer within vector exon B, to amplify the splicing products. The primer sequences were:
-
CFAP54-pCAS2-RT-F: GCTGCTGCTGCTGGCTGGGTCGA TG
-
CFAP54-pCAS2-RT-R: AGCCCCGAGCAGGACGTGGGTA AGG
The RT-PCR products were analyzed by agarose gel electrophoresis and UV imaging to assess differences in fragment size. Sanger sequencing was subsequently used to precisely characterize the type of splicing abnormality.
Pathogenicity analysis
All variants were classified according to the ACMG/AMP guidelines (24). These criteria are categorized into two groups: Pathogenic or Likely Pathogenic (P/LP) and Benign or Likely Benign (B/LB). Variants are classified as “VUS” when criteria are conflicting or not met. The standardized evaluation encompasses various data types, including population frequency, computational predictions, functional evidence, familial cosegregation data, de novo variant data, allelic data, and clinical relevance.
Results
ES data reanalysis
The patient developed bronchiectasis during childhood and had a history of rhinitis and neonatal pneumonia. According to the PCD diagnostic guidelines of the European Respiratory Society (25), these clinical manifestations strongly suggest a diagnosis of PCD.
The patient underwent singleton ES in August 2024 and the initial report did not identify any variants that could explain the patient’s phenotype. In early 2025, the laboratory initiated a reanalysis of the patient’s ES data. A novel PCD-associated homozygous variant, CFAP54 (NM_001306084.2):c.6965 + 5G > A, was identified via a genotype-driven reanalysis strategy (CFAP54 was included in OMIM as a pathogenic gene for PCD in March 2025). This homozygous variant was subsequently confirmed by Sanger sequencing, and it was inherited from both parents, who are both heterozygous carriers (Figure 3). The variant is located at a non-canonical splice site. It was absent from the 1000 Genomes Project and the Exome Aggregation Consortium (ExAC) databases, and its allele frequency in the East Asian population in gnomAD was 0.000, fulfilling the PM2 criterion (Supporting evidence of pathogenicity). Computational predictions yielded a SpliceAI score of 0.19 and a moderate phyloP conservation score of 0.82, suggesting a potential impact on splicing and moderate evolutionary conservation of the affected region. According to the ACMG guidelines, the variant was initially classified as VUS. This variant is located near exon 50 of CFAP54, which encodes part of a coiled-coil motif (Figure 1B). Therefore, the c.6965 + 5G > A variant is predicted to have the potential to disrupt the normal conformation of this coiled-coil domain, and thus potentially affect the overall function of the protein.
FIGURE 3
Pedigree of the proband and Sanger sequencing chromatograms of the variant. (A) The proband is indicated by a red arrow. Her parents, husband, and son show no respiratory-related phenotypes. (B) Bidirectional Sanger sequencing spanning the variant site (CFAP54:c.6965 + 5G > A) in the proband (II-1) confirmed a homozygous variant. Both of her parents (I-1, I-2) were identified as heterozygous carriers of this variant. While her son (III-1) did not undergo Sanger validation, he is necessarily a carrier.
Minigene functional validation
As the CFAP54:c.6965 + 5G > A variant is predicted to affect splicing, an in vitro minigene assay was performed to investigate its impact on RNA splicing. The constructed wild-type (c.6965 + 5G) and mutant (c.6965 + 5A) minigene plasmids were transfected into HEK293 cells (Figure 4A). Total RNA was extracted 48 h post-transfection and analyzed by RT-PCR. Agarose gel electrophoresis revealed a transcript of approximately 716 bp for the wild-type plasmid. In contrast, the mutant plasmid produced a significantly shorter transcript of approximately 553 bp, indicating an aberrant splicing pattern (Figure 4B). Sanger sequencing confirmed that the mutant transcript resulted from the complete skipping of exon 50 (161 bp in length) (Figures 4C, D). This 161-nucleotide deletion resulted in an out-of-frame shift in the reading frame, introducing a premature termination codon (PTC) downstream. This molecular mechanism is consistent with a LOF effect.
FIGURE 4
Construction of the Minigene vector and experimental results. (A) Schematic diagram of the mutant Minigene vector construction. The plasmid backbone is pCAS2, with BamHI used as the restriction site. The inserted fragment was amplified by PCR from the proband’s peripheral blood DNA. This fragment spans a complete genomic region including exon 49, intron 49, exon 50, plus partial segments of intron 48 (542 bp) and intron 50 (718 bp), with a total length of 3383 bp. The mutation site is indicated by a red arrow. (B) Agarose gel electrophoresis results. “HEK293” represents a transfection reagent-only control group, ruling out any effect of the reagent on cellular splicing. “EV” denotes the empty vector control group, excluding any impact of the vector itself on splicing. “Wild Type” represents the group transfected with the vector containing the PCR fragment from a control individual. “Mutant Type” represents the group transfected with the vector containing the PCR fragment from the patient. The amplified transcript from the wild-type plasmid is approximately 716 bp, while the mutant plasmid produces a shorter transcript of approximately 553 bp. (C) Reverse-strand Sanger sequencing chromatograms of the transfection products. “WT” represents the group with the control insert; “MUT” represents the group with the patient insert. (D) Schematic diagram illustrating the splicing patterns.
Pathogenicity assessment
Integrating the evidence from the functional minigene assay, the pathogenicity of the CFAP54 (NM_001306084.2):c.6965 + 5G > A variant was re-evaluated. According to the ACMG guidelines, its initial classification was VUS, supported by the PM2 criterion. The minigene experiment provided definitive functional evidence that the variant causes exon 50 skipping and introduces a PTC, leading to a loss of function of CFAP54 protein. This finding fulfills the PVS1 (Null variant in a gene where LOF is a known mechanism of disease; and non-canonical splice variants where RNA analysis confirms aberrant transcription.) criterion of the ACMG/AMP guidelines (26). With the addition of the PVS1 evidence, the variant’s pathogenicity classification was upgraded to Likely Pathogenic (Table 1).
TABLE 1
| Information | CFAP54 variant |
|---|---|
| cDNA alteration | NM_001306084.2:c.6965 + 5G > A |
| Zygosity | Homozygous |
| Variant type | Splicing variant |
| 1000 Genomes Project | N/A |
| Exome Aggregation Consortium | N/A |
| East Asians in gnomAD | 0.000 |
| Splice AI | Donor Loss 0.19; Donor Gain 0.19 |
| phyloP | Conserved (0.82) |
| Initial ACMG criteria | PM2 |
| Initial pathogenicity | VUS |
| Added ACMG criteria | PVS1 |
| Pathogenicity | Likely pathogenic |
Variant assessment information for the proband.
VUS, variant of uncertain significance.
Discussion
In this study, reanalysis of ES data from a previously negative PCD case led to the identification of a homozygous non-canonical splice variant in CFAP54 (NM_001306084.2:c.6965 + 5G > A). This variant was not reported initially, primarily because the patient’s sample was first submitted for testing in August 2024, before CFAP54 was officially listed as a PCD-causing gene in the OMIM database3. This finding directly underscores the critical value of dynamically updated disease knowledge bases and periodic ES reanalysis in overcoming the inherent lag in PCD diagnosis.
Since CFAP54 is a structural ciliary protein with extremely low expression in human peripheral blood, validating the splicing effect directly from the patient’s blood sample was not feasible. Consequently, we employed a minigene assay to simulate the splicing process in vitro. Our experiment confirmed that the c.6965 + 5G > A variant causes exon 50 skipping in CFAP54, leading to a frameshift and the introduction of a PTC, ultimately resulting in a loss of protein function. Our functional validation not only fills the evidence gap for the CFAP54:c.6965 + 5G > A variant but also brings the total number of reported CFAP54-associated PCD patients to 8 and the number of distinct mutations to 12 (18–20), thereby enriching the genotypic and phenotypic spectrum of this gene Furthermore, by identifying a pathogenic variant through the reanalysis of initially negative ES data, this study highlights the pivotal role of reanalyzing ES data in combination with functional experiments to resolve diagnostic dilemmas in clinically suspected cases. It provides a generalizable technical approach for the molecular diagnosis of genetically heterogeneous disorders like PCD.
CFAP54, a recently identified PCD-causing gene, encodes a protein that is integral to the formation of the C1d subcomplex within the ciliary axoneme. It works in conjunction with CFAP46 and CFAP74 to maintain ciliary structural integrity (20). The c.6965 + 5G > A variant identified is this study is located at a non-canonical splice site flanking exon 50 and leads to a loss of function through aberrant splicing. This pathogenic mechanism is consistent with those of previously reported CFAP54 variants (e.g., nonsense, frameshift), all of which disrupt the structure and function of the ciliary axoneme, thereby leading to PCD. Notably, CFAP54 was initially associated with male infertility due to MMAF and NOA (18). However, the patient in our study is a female and conceived naturally, suggesting potential sex-dependent differences or tissue specificity in the phenotypic expression of CFAP54 variants (27), which aligns with the multi-system nature of PCD-related genes. Additionally, the patient presented with bronchiectasis, rhinitis, and a history of neonatal pneumonia, but no situs inversus, and her nasal exhaled nitric oxide level was 149.6 nl/min, which fell within the normal range. This phenotype aligns with those of previously reported cases (18–20) (Table 2). Notably, embryonic nodal cilia, which have a 9 + 0 structure (characterized by nine peripheral microtubule doublets and absent central microtubules) (28) regulate organ positioning and lack the CA. This explains why these patients display situs solitus rather than situs inversus. Therefore, variants in genes such as CFAP46, CFAP54, CFAP74, and CFAP221 cause C1d defects of the central microtubules (20). Affected patients exhibit normal organ situs, as well as normal nNO, transmission electron microscopy (TEM), and high-speed video microscopy analysis (HSVA) results (Table 2). For such individuals, genetic testing is particularly crucial and represents almost the only diagnostic method available.
TABLE 2
| Clinical manifestation | Supplementary examination | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Patients | Cough, sputum production and bronchiectasis | Otitis media | Situs inversus | Fertility impairment | Neonatal symptoms | nNO (nl/min) |
TEM | HSVA | Genetic analysis |
| 1 (19) | + | / | - | / | / | 80 | Respiratory cilia: normal sperm flagellum: the “9 + 2” microtubule structure is incomplete | / | c.2649_2657delinC (p.E883Dfs*47); c.7312_7313insCGCAGGCTGAATTCTTGG (p.T2438delinsTQAEFLA) |
| 2 (19) | + | / | / | / | Neonatal pneumonia | / | / | / | c.2649_2657delinC (p.E883Dfs*47); c.7312_7313insCGCAGGCTGA ATTCTTGG (p.T2438delinsTQAEFLA) |
| 3 (19) | + | / | - | - | / | 114 | / | / | c.4112A > C (p.E1371A); c.6559C > T (p.P2187S) |
| 4 (20) | + | / | - | / | / | / | / | / | c.4688C > A (p.Ser1563Ter), homozygous |
| 5 (20) | + | / | - | / | / | 182.3 | Normal | Normal | c.3953C > A (p.Ser1318Ter); c.6264 + 5_6264 + 8del (p.Gly2028_Ile2088del) |
| 6 (20) | + | / | - | / | Neonatal respiratory distress with pneumonia | 176.4 | Normal | Normal | c.2283G > T (p.Lys761Asn_Arg762insTer7); c.5671C > T (p.Arg1891Ter) |
| 7 (20) | + | / | - | / | Neonatal respiratory distress | / | / | Normal | c.1852A > T (p.Lys618Ter); c.7220-1delG |
| 8# | + | - | - | - | Neonatal pneumonia | 149.6 | / | / | c.6965 + 5G > A, homozygous |
Summary of clinical manifestation and Supplementary Examination for all current CFAP54-related PCD patients.
nNo, nasal nitric oxide; TEM, transmission electron microscopy; HSVA, high-speed video microscopy analysis; “ + “ means positive; “-” means negative; “/” means unknown; “#” means the patient in this study.
This study has three main limitations that should be objectively acknowledged: (1) The absence of TEM of cilia or HSVA to directly validate ciliary ultrastructural and functional defects. However, normal results would be expected, as previously reported in CFAP54-related PCD. (2) Although the minigene assay effectively models splicing effects, this in vitro system cannot fully replicate the complex in vivo splicing environment. Factors such as cell- or tissue-specific splicing factors, transcription kinetics, chromatin state, isoform balance, and intron size are not perfectly captured (29). Nevertheless, it is important to emphasize that minigene assays remain a robust and widely accepted surrogate method for validating the pathogenicity of splicing variants when patient-derived affected tissues (e.g., respiratory epithelial cells) are unavailable, and their results hold significant clinical value, as recognized in the field (30).
Conclusion
Through ES reanalysis and functional validation, this study first identified the likely pathogenic CFAP54 variant (c.6965 + 5G > A) in a PCD patient. This finding brings the total number of reported CFAP54-related PCD cases to 8 and distinct mutations to 12, thereby broadening the genotypic and phenotypic spectrum of CFAP54-associated PCD. This case also reaffirms that for PCD patients with an initial negative genetic test result, ES data reanalysis guided by clinical phenotype, supplemented by targeted functional experiments, constitutes an effective strategy for improving diagnostic yield. With the continuous discovery of novel disease-causing genes and advancements in functional validation technologies, the molecular diagnostic rate for PCD is expected to increase further, laying a solid foundation for precision medicine in the near future.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The studies involving humans were approved by Institutional Review Board of Peking Union Medical College Hospital. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.
Author contributions
YLi: Conceptualization, Data curation, Investigation, Methodology, Validation, Writing – original draft, Writing – review & editing. WZ: Conceptualization, Data curation, Investigation, Methodology, Resources, Validation, Writing – original draft, Writing – review & editing. WL: Data curation, Formal analysis, Investigation, Validation, Writing – review & editing. QC: Investigation, Methodology, Validation, Writing – review & editing. YW: Investigation, Project administration, Validation, Writing – review & editing. XL: Investigation, Project administration, Supervision, Writing – review & editing. K-FX: Supervision, Writing – review & editing, Methodology, Resources, Validation. XZ: Supervision, Writing – review & editing. XT: Data curation, Methodology, Project administration, Resources, Supervision, Validation, Writing – review & editing. YLiu: Data curation, Methodology, Project administration, Resources, Supervision, Validation, Writing – review & editing.
Funding
The author(s) declare financial support was received for the research and/or publication of this article. This study was supported by the National High-Level Hospital Clinical Research Funding (2023-PUMCH-E-012), National Natural Science Foundation of China (82470041 and 82370056), Chinese Academy of Medical Sciences Innovation Fund for Medical Sciences (2023-I2M-C&T-A-002), and Capital’s Funds for Health Improvement and Research (2024-1-2093).
Acknowledgments
We thank all the patients who participated in this study. We also thank Ekitech Technology Inc., for technical support in data management. We would like to extend our sincere gratitude to the Biomedical Engineering Facility of National Infrastructures for Translational Medicine, Institute of Clinical Medicine, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, for their invaluable support, technical assistance, and access to facilities that contributed significantly to the completion of this work.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The authors declare that no Generative AI was used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1.
Knowles MR Zariwala M Leigh M . Primary Ciliary Dyskinesia.Clin Chest Med. (2016) 37:449–61. 10.1016/j.ccm.2016.04.008
2.
Wallmeier J Frank D Shoemark A Nöthe-Menchen T Cindric S Olbrich H et al De Novo Mutations in FOXJ1 result in a motile ciliopathy with hydrocephalus and randomization of left/right body asymmetry. Am J Hum Genet. (2019) 105:1030–9. 10.1016/j.ajhg.2019.09.022
3.
Pioch CO Connell DW Shoemark A . Primary Ciliary dyskinesia and bronchiectasis: new data and future challenges.Arch Bronconeumol. (2023) 59:134–6. 10.1016/j.arbres.2022.12.001
4.
Legendre M Zaragosi L-E Mitchison HM . Motile cilia and airway disease.Semin Cell Dev Biol. (2021) 110:19–33. 10.1016/j.semcdb.2020.11.007
5.
Wallmeier J Nielsen KG Kuehni CE Lucas JS Leigh MW Zariwala MA et al Motile ciliopathies. Nat Rev Dis Primers. (2020) 6:77. 10.1038/s41572-020-0209-6
6.
Shapiro AJ Davis SD Ferkol T Dell SD Rosenfeld M Olivier KN et al Laterality defects other than situs inversus totalis in primary ciliary dyskinesia: insights into situs ambiguus and heterotaxy. Chest. (2014) 146:1176–86. 10.1378/chest.13-1704
7.
Hannah WB Seifert BA Truty R Zariwala MA Ameel K Zhao Y et al The global prevalence and ethnic heterogeneity of primary ciliary dyskinesia gene variants: a genetic database analysis. Lancet Respir Med. (2022) 10:459–68. 10.1016/S2213-2600(21)00453-7
8.
Kuehni CE Frischer T Strippoli M-PF Maurer E Bush A Nielsen KG et al Factors influencing age at diagnosis of primary ciliary dyskinesia in European children. Eur Respir J. (2010) 36:1248–58. 10.1183/09031936.00001010
9.
O’Callaghan C Chetcuti P Moya E . High prevalence of primary ciliary dyskinesia in a British Asian population.Arch Dis Child. (2010) 95:51–2. 10.1136/adc.2009.158493
10.
Guan Y Yang H Yao X Xu H Liu H Tang X et al Clinical and genetic spectrum of children with primary ciliary dyskinesia in China. Chest. (2021) 159:1768–81. 10.1016/j.chest.2021.02.006
11.
Yang Y Muzny DM Xia F Niu Z Person R Ding Y et al Molecular findings among patients referred for clinical whole-exome sequencing. JAMA. (2014) 312:1870–9. 10.1001/jama.2014.14601
12.
Retterer K Juusola J Cho MT Vitazka P Millan F Gibellini F et al Clinical application of whole-exome sequencing across clinical indications. Genet Med. (2016) 18:696–704. 10.1038/gim.2015.148
13.
Lucas JS Davis SD Omran H Shoemark A . Primary ciliary dyskinesia in the genomics age.Lancet Respir Med. (2020) 8:202–16. 10.1016/S2213-2600(19)30374-1
14.
Austin-Tse CA Jobanputra V Perry DL Bick D Taft RJ Venner E et al Best practices for the interpretation and reporting of clinical whole genome sequencing. Npj Genomic Med. (2022) 7:27. 10.1038/s41525-022-00295-z
15.
Lin Z Liu L Li X Huang S Zhao H Zeng S et al Phenotype-driven reanalysis reveals five novel pathogenic variants in 40 exome-negative families with charcot-marie-tooth disease. J Neurol. (2024) 271:497–503. 10.1007/s00415-023-11991-w
16.
Wright CF McRae JF Clayton S Gallone G Aitken S FitzGerald TW et al Making new genetic diagnoses with old data: iterative reanalysis and reporting from genome-wide data in 1,133 families with developmental disorders. Genet Med. (2018) 20:1216–23. 10.1038/gim.2017.246
17.
Deignan JL Chung WK Kearney HM Monaghan KG Rehder CW Chao EC . ACMG Laboratory Quality AssuranceCommittee. Points to consider in the reevaluation and reanalysis of genomic test results: a statement of the American College of Medical Genetics and Genomics (ACMG).Genet Med. (2019) 21:1267–70. 10.1038/s41436-019-0478-1
18.
Tian S Tu C He X Meng L Wang J Tang S et al Biallelic mutations in CFAP54 cause male infertility with severe MMAF and NOA. J Med Genet. (2023) 60:827–34. 10.1136/jmg-2022-108887
19.
Zhao X Ge H Xu W Cheng C Zhou W Xu Y et al Lack of CFAP54 causes primary ciliary dyskinesia in a mouse model and human patients. Front Med. (2023) 17:1236–49. 10.1007/s11684-023-0997-7
20.
Wohlgemuth K Hoersting N Koenig J Loges NT Raidt J George S et al Pathogenic variants in CFAP46, CFAP54, CFAP74 and CFAP221 cause primary ciliary dyskinesia with a defective C1d projection of the central apparatus. Eur Respir J. (2024) 64:2400790. 10.1183/13993003.00790-2024
21.
1000 Genomes Project Consortium Abecasis GR Auton A Brooks LD DePristo MA Durbin RM et al An integrated map of genetic variation from 1,092 human genomes. Nature. (2012) 491:56–65. 10.1038/nature11632
22.
Kobayashi Y Yang S Nykamp K Garcia J Lincoln SE Topper SE . Pathogenic variant burden in the ExAC database: an empirical approach to evaluating population data for clinical variant interpretation.Genome Med. (2017) 9:13. 10.1186/s13073-017-0403-7
23.
Pio MG Siffo S Scheps KG Molina MF Adrover E Abelleyro MM et al Curating the gnomAD database: report of novel variants in the thyrogobulin gene using in silico bioinformatics algorithms. Mol Cell Endocrinol. (2021) 534:111359. 10.1016/j.mce.2021.111359
24.
Richards S Aziz N Bale S Bick D Das S Gastier-Foster J et al Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the american college of medical genetics and genomics and the association for molecular pathology. Genet Med. (2015) 17:405–24. 10.1038/gim.2015.30
25.
Lucas JS Barbato A Collins SA Goutaki M Behan L Caudri D et al European Respiratory Society guidelines for the diagnosis of primary ciliary dyskinesia. Eur Respir J. (2017) 49:1601090. 10.1183/13993003.01090-2016
26.
Durkie M Cassidy E-J Berry I Owens M Turnbull C Taylor RW et al ACGS Best Practice Guidelines for Variant Classification in Rare Disease 2024. Manchester, NH: ACGS (2024).
27.
Newman L Chopra J Dossett C Shepherd E Bercusson A Carroll M et al The impact of primary ciliary dyskinesia on female and Male fertility: a narrative review. Hum Reprod Update. (2023) 29:347–67. 10.1093/humupd/dmad003
28.
Satir P Christensen ST . Overview of structure and function of mammalian cilia.Annu Rev Physiol. (2007) 69:377–400. 10.1146/annurev.physiol.69.040705.141236
29.
Xiong Y Xia H Yuan L Deng S Ding Z Deng H . Identification of compound heterozygous DNAH11 variants in a han-chinese family with primary ciliary dyskinesia.J Cell Mol Med. (2021) 25:9028–37. 10.1111/jcmm.16866
30.
Sanoguera-Miralles L Valenzuela-Palomo A Bueno-Martínez E Esteban-Sánchez A Lorca V Llinares-Burguet I et al Systematic minigene-based splicing analysis and tentative clinical classification of 52 CHEK2 splice-site variants. Clin Chem. (2024) 70:319–38. 10.1093/clinchem/hvad125
Summary
Keywords
primary ciliary dyskinesia, exome sequencing reanalysis, CFAP54-related phenotype and genotype, minigene assay, splicing variant
Citation
Li Y, Zhou W, Lu W, Chen Q, Wang Y, Li X, Xu K-F, Zhang X, Tian X and Liu Y (2025) Exome sequencing reanalysis identifies a novel likely pathogenic CFAP54 variant and expands the phenotypic and genotypic spectrum of primary ciliary dyskinesia. Front. Med. 12:1712038. doi: 10.3389/fmed.2025.1712038
Received
24 September 2025
Accepted
14 November 2025
Published
28 November 2025
Volume
12 - 2025
Edited by
Anna Kostareva, Almazov National Medical Research Centre, Russia
Reviewed by
Guoliang Jiang, Central South University, China
Jelmer Legebeke, Leiden University Medical Center (LUMC), Netherlands
Updates
Copyright
© 2025 Li, Zhou, Lu, Chen, Wang, Li, Xu, Zhang, Tian and Liu.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yaping Liu, ypliu_pumc@163.comXinlun Tian, xinlun_t@sina.com
†These authors have contributed equally to this work and share first authorship
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.