ORIGINAL RESEARCH article

Front. Mol. Biosci., 03 May 2021

Sec. Protein Folding, Misfolding and Degradation

Volume 8 - 2021 | https://doi.org/10.3389/fmolb.2021.645831

WDR45 Mutation Impairs the Autophagic Degradation of Transferrin Receptor and Promotes Ferroptosis

  • Institutes of Biomedical Sciences, Key Laboratory of Chemical Biology and Molecular Engineering of Ministry of Education, Shanxi University, Taiyuan, China

Abstract

WDR45 is an autophagy-related protein that involves in the formation of autophagosome. Mutations in WDR45 lead to the impairment of autophagy which is associated with the human β-propeller protein-associated neurodegeneration (BPAN). However, the relationship between autophagy and brain iron accumulation in patients with BPAN remains unclear. Here, we demonstrated that transferrin receptor (TfRC) which is critical for the iron import of cells was degraded via autophagy. TfRC was accumulated after the inhibition of autophagy by treatment with autophagic inhibitor chloroquine or knockdown of ATG2A. The intracellular iron content was increased in cells overexpressing TfRC or mutant WDR45, however, ferritin H (FTH) chain was decreased. Increased TfRC and simultaneously decreased FTH consequently resulted in an elevated level of ferrous iron (Fe2+) which further promoted cell ferroptosis, demonstrated by the increased lipid peroxidation and reactive oxygen species (ROS) and the decreased glutathione peroxidase 4 (GPX4) and cell viability. Taken together, these findings provide a piece of important evidence that WDR45 deficiency impairs autophagic degradation of TfRC, therefore leading to iron accumulation, and the elevated iron promotes ferroptosis which may contribute to the progression of BPAN.

Introduction

Autophagy is an evolutionarily conserved lysosomal degradation pathway that plays an important role in maintaining cell homeostasis (). The first autophagy-related (ATG) gene was identified by the 2016 Nobel laureate Yoshinori Ohsumi in yeast in 1993. Now the number of ATG genes has increased to about 40 (). Among them, the autophagy gene WDR45 (also known as WIPI4) was critical for the formation of the autophagosome (, ). Mutations in WDR45 were found to be associated with a human neurodegenerative disorder, namely, β-propeller protein-associated neurodegeneration (BPAN, OMIM 300894), which is an X-linked neurodegenerative disorder characterized by a childhood onset of intellectual impairment followed by a second period of deterioration in adulthood (). Brain MRI of BPAN patient presents an iron accumulation in the globus pallidus and substantia nigra (). Studies have demonstrated that mutations in WDR45 result in the impairment of autophagy which indeed results in the pathogenesis of BPAN (; ). In a previous study, we identified a novel de novo mutation in WDR45 (NM_00128148.3, c.1037_1038del, pGlu346GlyfsTer7) in a Chinese girl. The deletion of these two base pairs led to a frameshift, which resulted in a truncated protein. We also confirmed that the overexpression of this mutant WDR45 in HeLa cells impaired autophagy (). Furthermore, WDR45 mutant fibroblasts showed reduced autophagy and elevated iron content (). In 2014, identified that the iron storage protein, namely ferritin, was degraded via autophagy in an NCOA4-dependent manner and suggested that autophagy also regulates iron homeostasis. However, how WDR45 deficiency leads to iron accumulation remains unclear.

The iron deposition played a key role in the pathogenesis of neurodegenerative diseases, excessive iron in rat hippocampus induced neuronal apoptosis accompanied by a decline in learning and memory function (), and elevated brain iron level in human increased the risk of the onset of neurodegenerative diseases (). Transferrin receptor (TfRC) is a membrane protein that is essential for most cells to import iron under physiological conditions (). TfRC binds one iron-laden transferrin (holoTF), then the complex of holoTF-TfRC is internalized through endocytosis mediated by clathrin, when the pH of endosome decreased to 5.5, ferric iron (Fe3+) is released from TF, and the iron-free TF (apoTF)-TfRC complex is recycled to the cell surface where the physiological pH allows apoTF disassociation with TfRC (). TfRC expression is correlated with poorer outcomes in several cancers, the overexpression of TfRC provided more irons to meet the metabolic needs of the cancer cells while downregulation of TfRC has inhibited the growth of tumor (; ; ; ).

Transferrin receptor could be degraded through both proteasomal and lysosomal pathways (; , ). identified that the ubiquitin ligase, membrane-associated RING-CH (MARCH) 8, ubiquitinates TfRC and promotes its lysosomal degradation (). However, whether WDR45 mutation impairs autophagic degradation of TfRC and TfRC involves in iron accumulation in patients with BPAN are still unknown. In this study, we confirmed that TfRC was indeed degraded via autophagy, WDR45 mutation resulted in TfRC accumulation, and ferritin H (FTH) chain reduction, therefore, led to Fe2+ overload which further promoted ferroptosis in HeLa cells.

Materials and Methods

Vector Construction

cDNAs encoding the full length of TfRC (NM_00128148.3) and of WDR45 (NM_00128148.3) were amplified by PCR and subcloned into the pEGFP-C3 or Flag-tagged lentiviral expression vectors, where all the tags are in the N-terminal of proteins. The mutant WDR45 was amplified by PCR using a specific reverse primer. shRNAs were cloned into pLKO.1 vector. The primers and shRNA sequence were listed in Table 1.

TABLE 1

Oligo nameSequence
GFP-TfRC FGCGGAATTCTGATGATGGATCAAGCTAGATCAGC
GFP-TfRC RGCGGGATCCTTAAAACTCATTGTCAATGTCCCAAAC
Flag-TfRC FGCGGAATTCATGATGGATCAAGCTAGATCAGC
Flag-TfRC RGCGGGATCCTTAAAACTCATTGTCAATGTCCCAAAC
Flag-WDR45 FCGCCTCGAGATGACTCAACAGCCACTTCGAG
Flag-WDR45 RCGCGAATTCCTTAAAAGTCATCATCATCACAG
Mutant WDR45 RCGCGAATTCTCAAGGTACACGTCGAAAGCCTCTGTTG CAGTTTCCATC
ATG2A qPCR FTCGCCCATCTCCGTCTACCTATTC
ATG2A qPCR RTCGCCCTCCTCTTCCCTTTCATC
shRNA_ATG2ACCGGCCTGGATAACACTGACCTCTTCT CGAGAAGAGGTCAGTGTTATCCAGGTTTTTTG

Oligos used in this study.

Cell Culture, Cell Line Establishment, and Compound Treatment

HeLa and HEK293T cells were maintained in Dulbecco’s modified Eagle medium (BOSTER, China; PYG0004) supplemented with 10% fetal bovine serum (Biological Industries, Israel; 04-011-1A/B) and 1% penicillin/streptomycin (Solarbio, China; P1400). The Flag-TfRC stably expressing cell line was generated by lentiviral transduction, and the WDR45WT/WDR45MT overexpressing cell line was generated as described previously (). The transient transfection of cells with GFP-TfRC was conducted using Lipofectamine 2000 (Invitrogen) according to the instructions by the manufacturer. The HeLa and HEK293T cells were cultured in the presence or absence of 100 μM chloroquine (CQ) for 8 h and 10 μM CQ for 24 h, respectively.

Western Blotting

Cell lysates were prepared and separated by sodium dodecyl sulfate (SDS) gel electrophoresis, electrotransferred to a nitrocellulose membrane (GE), blocked with 5% non-fat milk in 10 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1% Tween-20 (v/v) (TBS-T buffer) for 60 min at room temperature, and incubated with the primary antibodies. The primary antibodies used were anti-LAMP1 (Proteintech, China; 21997-1-AP), TfRC antibody (Proteintech; 10084-2-AP) was used at a 1:1,000 dilution, the GFP antibody (Abclonal, China; AE012) was used at a 1:1,000 dilution, Flag M2 antibody (Sigma, F3165) was used at a 1:3,000 dilution, FTH antibody (Abcam, ab75973) was used at a 1:1,000 dilution, glutathione peroxidase 4 (GPX4) antibody (Abcam, ab125066) was used at a 1:1,000 dilution, actin antibody (Absin, China; abs125702) were used at a 1:1,000 dilution, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (Proteintech; 60004-1-AP) was used at a dilution of 1:10,000. Secondary antibodies used were anti-mouse IgG conjugated with peroxidase (POD) (Proteintech; SA00001-1) at a 1:10,000 dilution or anti-mouse IgG, 800 (LI-COR Biosciences) at a 1:250,000 dilution, anti-rabbit IgG conjugated with POD (Proteintech; SA00001-2) at a 1:10,000 dilution or anti-mouse IgG, 800 (LI-COR Biosciences). Relative protein amounts were determined using ImageJ.

Immunofluorescence Staining and Image Analysis

Cells were grown on sterile coverslips and fixed in 4% formaldehyde for 15 min at room temperature, permeabilized, and blocked with PTB buffer (1× PBS containing 0.1% Triton X-100 and 0.1% BSA) for 1 h (). The fixed cells were incubated with LAMP1 antibody (Proteintech; 21997-1-AP) at a 1:100 dilution in PTB for 1 h, and secondary antibodies were Alexa-Fluor 568 conjugated donkey anti-rabbit IgG at a 1:1,000 dilution (Invitrogen). The nuclei were stained with 4′,6-Diamidino-2-phenylindole (DAPI) (Sigma). Images of fixed cells were taken using a Zeiss LSM710 Microscope with a 63 × 1.4 DIC Plan-Apochromat oil-immersion objective.

Quantification of Cellular Iron Content

Cellular iron content was measured using the Iron Assay Kit (Sigma, MAK025) according to the protocol as described previously (). The absorbance at 593 nm was recorded using a Synergy H1MD plate reader (BioTek, United States). Ferrous iron (Fe2+) was assessed using FerroOrange probe (DojinDo, Japan) according to the instructions by the manufacturer. Briefly, the cells were transferred to a glass bottom cell culture dish (NEST, China; 801002) and cultured overnight in a 37°C incubator equilibrated with 5% CO2, the supernatant was discarded, and the cells were washed with hank’s balanced salt solution (HBSS) three times, FerroOrange (1 μM) was added to the cells as HBSS solution, and cells were incubated for 30 min. Cells were observed under a Zeiss LSM710 Microscope with a 63 × 1.4 DIC Plan-Apochromat oil-immersion objective.

Measurement of Intracellular Reactive Oxygen Species Levels

The intracellular reactive oxygen species (ROS) levels were measured using a Reactive Oxygen Species Assay Kit (Beyotime Biotechnology, China; S0033S) according to the instructions by the manufacturer. Briefly, 1 × 104 cells were seeded in a 96-well plate, incubated at 37°C in a 5% CO2 incubator for 24 h, then incubated with DCFH-DA for 20 min at 37°C, and measured at 488 nm excitation and 525 nm emission by a Synergy H1MD plate reader (BioTek).

MTT Assay

Cell viability was measured using an 3-(4,5-Dimethyl-2-Thiazolyl)-2,5-Diphenyl Tetrazolium Bromide (MTT) assay as described previously (). Briefly, 3,000 cells per well were plated in a 96-well plate and incubated at 37°C in a 5% CO2 incubator for 24 h. Cells were changed with fresh medium, added with 20 μl MTT, and incubated for another 4 h. MTT was removed and 100 μl dimethyl sulfoxide (DMSO) was added to each well. The absorbance at 570 nm was recorded using a Synergy H1MD plate reader (BioTek).

Malondialdehyde Content Assay

Malondialdehyde (MDA) levels in the cells were measured using a commercial kit following the instructions by the manufacturer (Solarbio, China; BC0025). Briefly, 5 × 106 cells were harvested in 1 ml lysis buffer and sonicated for 30 times (amplitude 20%, pulse on 3 s, and pulse off 10 s). The cell suspension was centrifuged at 8,000 g at 4°C for 10 min, and then 100 μl of the sample was added for the measurement, followed by the addition of 400 μl of the MDA test solution. After mixing and heating it in a boiling water bath for 30 min, the mixture was cooled down on the ice and centrifuged at 10,000 g for 10 min. The supernatant was taken, and the absorbance was measured at 450, 532, and 600 nm using a Synergy H1MD plate reader (BioTek). According to the instructions by the manufacturer, the levels of MDA were evaluated and calculated by the following formula:

Statistical Analysis

The densitometry analysis was performed by using ImageJ. The differences were analyzed statistically using the t-test. The error bars indicate SD of the mean of N ≥ 3 independent experiments (p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001).

Results

TfRC Was Accumulated in WDR45-Deficient Cells

Earlier, we showed that the overexpression of this mutant WDR45 in HeLa cells resulted in the accumulation of LC3-II and p62, which suggested an impairment of autophagy (). Furthermore, consistent with previous studies that lysosome function was impaired in WDR45 mutant fibroblasts (), we found that the lysosomal protein LAMP1 was significantly lowered in WDR45MT expressing cells (Figure 1A), suggesting a reduced autophagic degradation rate in the WDR45MT cells. By using Western blotting, we confirmed that TfRC was accumulated in the WDR45MT expressing cells, compared with WDR45WT expressing and control cells (Figure 1B). Swarup and his colleagues have demonstrated that TfRC could be degraded via autophagy (, ); therefore, we hypothesized that impairment of autophagy by overexpressing WDR45MT causes the accumulation of TfRC. To confirm this, we investigated the expression of TfRC after treatment with autophagy inhibitor CQ. As we expected, the protein level of TfRC was significantly increased in WDR45WT expressing and control cells but not in WDR45MT expressing cells upon treatment with CQ (Figure 1B). Taken together, these results imply that WDR45 mutation led to the accumulation of TfRC.

FIGURE 1

Overexpression of WDR45MT Impaired the Autophagic Degradation of TfRC

To investigate the co-localization of TfRC and autophagy marker LC3, we expressed GFP-TfRC and mCherry-LC3 in HeLa cells which are stably expressed as WDR45WT or WDR45MT, and the immunofluorescence analysis showed that GFP-TfRC co-localized with mCherry-LC3 in control and WDR45WT expressing cells after treatment with CQ (Figure 2A). The co-localization of GFP-TfRC and mCherry-LC3 was even observed in the absence of CQ in WDR45MT expressing cells while the co-localization was rare in control and WDR45WT expressing cells (Figure 2A). Then, we considered determining whether TfRC is degraded within lysosome. The immunofluorescence results revealed that GFP-TfRC was indeed co-localized with the lysosomal marker LAMP1, suggesting that GFP-TfRC was localized in lysosome (Figure 2B). The autophagic degradation of substrates can be monitored with the GFP cleavage assay (). This assay is based on the observation that the GFP moiety is often cleaved as a whole from GFP-tagged autophagic substrates inside the autolysosome and accumulates because of its relative resistance to further digestion (). We expressed GFP-TfRC in HEK293T cells and found that upon treatment with CQ the release of free GFP was increased, suggesting that TfRC was degraded within lysosome (Figure 2C). WDR45 has a strong binding capacity for ATG2, thereby recruiting ATG2 to the nascent autophagosome (). ATG2 bridges membranes and therefore promotes autophagosome biogenesis upon the transfer of lipids from the endoplasmic reticulum (ER) or ATG9 vesicles (; ; ; ). Therefore, we inhibited the autophagosome formation by the knockdown of ATG2A, and the results showed that TfRC was also increased (Figures 2D,E). Taken together, these results suggest that TfRC was degraded via autophagy and WDR45 mutation impaired the autophagic degradation of TfRC.

FIGURE 2

Increased TfRC and Simultaneously Decreased FTH Elevated the Fe2+ Level

Overexpression of TfRC increased the cellular iron content (Figure 3A), which is consistent with the previous results (; , ). Since TfRC was accumulated in WDR45MT expressing cells which imply that the cells may uptake more irons into the cells, we examined the total cellular iron content in WDR45MT stably expressing cells. We observed an increase in the levels of iron content when comparing WDR45MT expressing cells with control cells (Figure 3B). Ferritin is the major intracellular iron storage protein that consists of two components, namely ferritin L (FTL) chain and FTH chain. Western blot analysis revealed reduced FTH in WDR45MT expressing cells (Figure 3C). The ferroxidase activity of FTH oxidates redox-active Fe2+ to redox-inactive Fe3+ (). The reduced FTH in WDR45MT expressing cells will lead to increased Fe2+. We evaluated the intracellular levels of Fe2+ using the specific fluorescent probe FerroOrange under confocal microscopy (). As expected, the fluorescent intensity of cells expressing WDR45MT was significantly increased, confirming that an increase in the concentration of intracellular Fe2+ occurs in the WDR45MT expressing cells (Figure 3D and Supplementary Figure 1). Taken together, these results suggest that WDR45 mutation resulted in increased TfRC but decreased FTH led to Fe2+ accumulation.

FIGURE 3

WDR45 Mutation Promoted Ferroptosis

Ferroptosis is a regulated cell death driven by iron-dependent lipid peroxidation (). Elevated Fe2+ promotes the generation of lipid peroxidation and ROS (). We found that in WDR45MT expressing cells, the content of MDA (an end product of lipid peroxidation) and ROS was significantly increased (Figures 4A,B). Moreover, we found that GPX4, which is an antioxidant defense enzyme to eliminate toxic lipid hydroperoxides, was also downregulated (Figure 4C). Increased LPO and decreased GPX4 are signatures of ferroptosis (; ). As expected, we detected a significantly reduced cell viability in WDR45MT expressing cells (Figure 4D). Taken together, these results suggest that WDR45 mutation promoted ferroptosis.

FIGURE 4

Discussion

The patients with BPAN are characterized by global developmental delay in early childhood that is essentially static, with slow motor and cognitive gains until adolescence or early adulthood. In young adulthood, the affected individuals develop progressive dystonia, parkinsonism, extrapyramidal signs, and dementia, resulting in severe disability (; ). In case of the same with other subtypes of neurodegeneration with brain iron accumulation (NBIA), iron accumulation was found in the basal ganglia (). first demonstrated that autophagy deficiency contributes to the pathogenesis of BPAN. The autophagy involves the sequestration of cytoplasm by autophagosome which ultimately fuse with lysosome where their contents are degraded. WDR45 is an ortholog of yeast ATG18 which promotes phagophore membrane expansion by recruiting ATG2 (, ; ; ; ; ). WDR45 mutation impairs autophagy by inhibiting the autophagosome formation and reexpression of BPAN-related mutations of WDR45 fails to rescue the autophagy defects in Wdr45-deficient cells (). Moreover, it showed that WDR45 mutation also diminished lysosomal function () by reducing the protein level of LAMP1 (Figure 1A). These findings suggest that WDR45 mutation in patients with BPAN resulted in reduced autophagic degradation rate by deceased autophagosome formation and lysosomal degradation ability.

Transferrin receptor is an iron import protein that is essential for most cells (). It has been previously shown that TfRC could be ubiquitinated and degraded in lysosome (; ). Previous results had revealed that TfRC was degraded via autophagy (, ), while in this study, we showed that TfRC co-localized with the autophagosome and lysosome markers, LC3 and LAMP1 (Figures 2A,B). GFP cleavage assay showed that GFP-TfRC was degraded within lysosome (Figure 2C). These findings confirmed that TfRC was indeed degraded through the autophagy pathway. Therefore, autophagic degradation of TfRC could be blocked by autophagy inhibitor bafilomycin A1 (; ) and also the lysosomal inhibitor CQ (Figure 1B). Furthermore, TfRC was also accumulated upon the inhibition of autophagosome biogenesis by knockdown of ATG2A (Figure 2E). In very recent studies, the results had showed that WDR45 is essential for the autophagosome maturation into autolysosome (), which is consistent with this study results that the co-localization of TfRC and LC3 was observed even in the absence of CQ in WDR45MT expressing cells (Figure 2A). Taken together, this study results suggested that WDR45 mutation blocked the autophagic degradation of TfRC, thus leading to the accumulation of TfRC in WDR45MT expressing cells.

Overexpression of TfRC led to iron overload (; , ); therefore, elevated TfRC in WDR45MT expression cells imported more iron (Figures 3A,B). Chelation of iron by the iron chelator, namely deferoxamine (DFO), induced the autolysosome formation (), while iron overload resulted in abnormal autophagosome accumulation and lysosomal loss which impaired autophagy (; ). Taken together, WDR45 mutation resulted in iron overload which may, in turn, impair autophagy.

Ferritin is the main iron storage protein that plays a critical role in the regulation of cellular iron metabolism (). The ferroxidase activity of FTH can prevent Fe2+ from partaking in the production of ROS (). However, we found that FTH was decreased in WDR45MT overexpression cells (Figure 3C) which is consistent with previous results (). Nuclear receptor coactivator 4 (NCOA4)-mediated ferritinophagy was found to regulate iron homeostasis, and acceleration of ferritin degradation increased cellular Fe2+ (; ). However, patients with BPAN with WDR45 mutation presented impaired autophagy and lysosomal function (Figure 1A; ; ; ; ), in whom ferritinophagy seems not to be the reason for decreased FTH.

Increased total iron content and reduced FTH consequently resulted in the accumulation of Fe2+ (Figure 3D and Supplementary Figure 1) which further promote the generation of LPO and ROS (Figures 4A,B). However, we detected a downregulated GPX4 in WDR45MT expression cells (Figure 4C). Increased LPO and ROS but decreased GPX4 are signatures of ferroptosis (; ). Inactivation or downregulation of GPX4 results in overwhelming LPO that causes cell ferroptosis (). Therefore, cell viability was reduced in WDR45MT expression cells which suggest that WDR45 mutation promoted ferroptosis (Figure 4D). Ferroptosis is implicated in the pathological cell death associated with the neurodegeneration diseases such as Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD), and amyotrophic lateral sclerosis (ALS; ; ; ; ; ). This is the first evidence that WDR45 mutation promotes ferroptosis which suggests that ferroptosis is involved in BPAN and may contribute to the progression of BPAN.

In summary, this study data showed that the mutation (NM_001029896.1, c.1037_1038del) in WDR45 impaired autophagy and lysosome function; therefore, overexpression of this mutant WDR45 in HeLa cells resulted in TfRC accumulation and decreased FTH which in turn consequently elevated intracellular iron and further promoted ferroptosis (Figure 5). This study provided a piece of important evidence that the autophagic degradation of TfRC regulates iron homeostasis. These findings will reveal the pathogenesis of brain iron accumulation in patients with BPAN. Further studies are needed to explore whether the induction of autophagy or the inhibition of ferroptosis is a potential strategy for the treatment of BPAN and other NBIAs as well.

FIGURE 5

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.

Author contributions

QX, PL, and CW conceptualized the study, designed the experiments, and supervised the study. QX, XL, and WL performed the experiments and wrote the original manuscript. GC and HX analyzed the screen data and revised the manuscript. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by the Scientific and Technological Innovation Programs of Higher Education Institutions in Shanxi Province, China (2019L0096 and 2019L0007), the Natural Science Foundation of Shanxi Province, China (201801D221248), and the National Natural Science Foundation of China (31801972).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmolb.2021.645831/full#supplementary-material

References

Summary

Keywords

WDR45, autophagy, TfRC, iron accumulation, ferroptosis, BPAN

Citation

Xiong Q, Li X, Li W, Chen G, Xiao H, Li P and Wu C (2021) WDR45 Mutation Impairs the Autophagic Degradation of Transferrin Receptor and Promotes Ferroptosis. Front. Mol. Biosci. 8:645831. doi: 10.3389/fmolb.2021.645831

Received

24 December 2020

Accepted

06 April 2021

Published

03 May 2021

Volume

8 - 2021

Edited by

Vladimir N. Uversky, University of South Florida, United States

Reviewed by

Leonid Breydo, St. Jude Children’s Research Hospital, United States; Vibhor Mishra, St. Jude Children’s Research Hospital, United States

Updates

Copyright

*Correspondence: Qiuhong Xiong, Ping Li, Changxin Wu,

This article was submitted to Protein Folding, Misfolding and Degradation, a section of the journal Frontiers in Molecular Biosciences

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics