Abstract
Functionally mature neural circuits are shaped during postnatal development by eliminating redundant synapses formed during the perinatal period. In the cerebellum of neonatal rodents, each Purkinje cell (PC) receives synaptic inputs from multiple (more than 4) climbing fibers (CFs). During the first 3 postnatal weeks, synaptic inputs from a single CF become markedly larger and those from the other CFs are eliminated in each PC, leading to mono-innervation of each PC by a strong CF in adulthood. While molecules involved in the strengthening and elimination of CF synapses during postnatal development are being elucidated, much less is known about the molecular mechanisms underlying CF synapse formation during the early postnatal period. Here, we show experimental evidence that suggests that a synapse organizer, PTPĪ“, is required for early postnatal CF synapse formation and the subsequent establishment of CF to PC synaptic wiring. We showed that PTPĪ“ was localized at CF-PC synapses from postnatal day 0 (P0) irrespective of the expression of Aldolase C (Aldoc), a major marker of PC that distinguishes the cerebellar compartments. We found that the extension of a single strong CF along PC dendrites (CF translocation) was impaired in global PTPĪ“ knockout (KO) mice from P12 to P29-31 predominantly in PCs that did not express Aldoc [Aldoc (ā) PCs]. We also demonstrated via morphological and electrophysiological analyses that the number of CFs innervating individual PCs in PTPĪ“ KO mice were fewer than in wild-type (WT) mice from P3 to P13 with a significant decrease in the strength of CF synaptic inputs in cerebellar anterior lobules where most PCs are Aldoc (ā). Furthermore, CF-specific PTPĪ“-knockdown (KD) caused a reduction in the number of CFs innervating PCs with decreased CF synaptic inputs at P10-13 in anterior lobules. We found a mild impairment of motor performance in adult PTPĪ“ KO mice. These results indicate that PTPĪ“ acts as a presynaptic organizer for CF-PC formation and is required for normal CF-PC synaptic transmission, CF translocation, and presumably CF synapse maintenance predominantly in Aldoc (ā) PCs. Furthermore, this study suggests that the impaired CF-PC synapse formation and development by the lack of PTPĪ“ causes mild impairment of motor performance.
Introduction
Neural circuits are known to be remodeled and become functionally mature during postnatal development. Extensive synapse formation (or synaptogenesis) occurs during the perinatal period, and excess synaptic connections are present in the nervous system of newborn animals compared to mature animals. During postnatal development, some synapses are strengthened functionally and/or morphologically, while other synapses are weakened and finally eliminated. This process is called āsynapse eliminationā and is thought widely to be a fundamental process for the developmental refinement of neural circuits (Kano and Hashimoto, 2009).
In newborn mice, Purkinje cells (PCs) receive excitatory inputs from multiple climbing fibers (CFs) (more than 4 CFs) with similar strength of synaptic inputs. Thereafter, synaptic inputs from a single CF become progressively stronger than those from the other CFs from postnatal day 3 (P3) to around P7 (Hashimoto and Kano, 2003). Then, only the strengthened CF extends its synaptic territory along the PC dendrites from around P9 (Hashimoto et al., 2009a). In parallel, synapses of the other weaker CFs are eliminated from PC soma from P7 to around P11. Finally, remaining somatic CF synapses are eliminated from P12 to P17 in a manner dependent on parallel fibers (PFs)-PC synapse formation (Hashimoto and Kano, 2013). Although many molecules involved in CF synapse elimination and strengthening/maintenance of CF synapses in postnatal life have been identified, much less is known about the molecular mechanism of CF synapse formation during the early postnatal period before the sequence of developmental CF synapse elimination is initiated.
Synapse formation is induced by trans-synaptic interactions between selective pairs of pre- and post-synaptic cell adhesion molecules, called āsynapse organizerā (Shen and Scheiffele, 2010; Siddiqui and Craig, 2011; Takahashi and Craig, 2013; Um and Ko, 2013; de Wit and Ghosh, 2016; Südhof, 2017; Yuzaki, 2018). Among synapse organizers, Neurexins (NRXNs: Nrxn1-3) and leukocyte common antigen-related receptor tyrosine phosphatases (LAR-RPTPs) have been reported as presynaptic organizers. LAR-RPTPs consist of LAR (also known as Ptprf), PTPĪ“ (Ptprd), and PTPĻ (Ptprs) (Takahashi and Craig, 2013). NRXNs and LAR-RPTPs with their alternative splicing variants are known to interact with different postsynaptic ligands (Südhof, 2017). For example, Neuroligins (NLGNs: NLGN1-4), Cblns (Cbln1-4)-GluRĪ“s (GluD1 and 2) and LRRTMs (LRRTM1-4) have been reported as postsynaptic ligands for NRXN variants (Südhof, 2017). On the other hand, interleukin-1 receptor accessory protein (IL1RAcP also known as IL1RAP), IL1RAcP-like1 (IL1RAPL1), TrkC, Slitrks (Slitrk1-5), synaptic adhesion-like molecule family (SALM3 and SALM5), TrkC, and NGL-3 have been reported as postsynaptic ligands for LAR-RPTPs variants (Takahashi and Craig, 2013; Fukai and Yoshida, 2021). However, a recent report identified NLGN3, known as the postsynaptic ligand for NRXNs, as a novel postsynaptic ligand of PTPĪ“ (Yoshida et al., 2021). Moreover, Nrxns have been reported as not being required for presynaptic formation to bind directly to intracellular proteins (Gokce and Südhof, 2013), while LAR-RPTPs are shown to induce presynaptic differentiation via direct interaction with several synaptic proteins (Serra-PagĆØs et al., 1998; Wakita et al., 2020), suggesting that Nrxns and LAR-RPTPs mediate presynaptic assembly by distinct molecular mechanism. Several studies also reported that Nrxns and LAR-RPTPs are not essential for synapse formation but are involved in regulating synapse properties (Uetani et al., 2000; Horn et al., 2012; Anderson et al., 2015; Chen et al., 2017).
The roles of synapse organizers in the cerebellum have recently been revealed. For example, presynaptic NRXNs in PFs interact with postsynaptic GluD2 via Cbln1 to induce PF-PC synapse formation (Matsuda et al., 2010; Uemura et al., 2010). Knockout of all NRXNs (Nrxn1-3) in mouse CFs showed a reduction of CF territories along PC dendrites and a decrease in the amplitude of CF-EPSCs at P24. However, the contribution of NRXNs in the formation and elimination of CF to PC synapses during postnatal development remained unknown (Chen et al., 2017). NLGN3 knock-in mice harboring the ASD-related R451C mutation (R451C) reduced the expression of NLGN3 protein in the cerebellum, resulting in the impairment of CF synapse elimination transiently from P10 to P15, associated with the enhancements of inhibitory synaptic transmission on PCs (Lai et al., 2021). PTPĪ“, which also binds NLGN3, is expressed in various regions of the brain, including the cerebellum, inferior olivary nucleus, hippocampus, and cerebral cortex (Shishikura et al., 2016). PTPĪ“ knockout (KO) mice exhibit impaired spatial learning, memory, and motor function. While a previous study has shown that PTPĪ“ is involved in the regulation of synaptic activity in the hippocampus (Uetani et al., 2000), its role in the cerebellum has not been investigated.
This study aimed at investigating whether and how PTPĪ“ is involved in the formation and development of CF-PC synapses in the cerebellum. The results to be presented collectively suggest that PTPĪ“ functions as a presynaptic organizer for the formation of CF to PC synapses during the perinatal period, maintenance of CF to PC synapses and thereby antagonizing their elimination during postnatal development, and establishment of normal strength of CF to PC synaptic transmission predominantly in Aldolase C-negative PCs.
Materials and methods
Animal
C57BL/6NCr wild-type mice (male and female, SLC, Japan) were used for knockdown (KD) experiments. PTPĪ“ knockout (KO) mice used by Uetani et al. (2000) had a mixed genetic background of C57BL/6J;129/SvJ, and they were subsequently crossed with the C57BL/6N mice during frozen embryo creation. Therefore, they had a mixed genetic background of C57BL/6J, C57BL/6N, and 129/SvJ. In this study, we used wild-type and PTPĪ“ KO mice that were born by crossing PTPĪ“ heterozygous mice with this genetic background. We used both male and female mice for morphological, electrophysiological, and behavioral analyses. All the experiments were performed in accordance with the guidelines of the animal welfare committees of the University of Tokyo and the Japan Neuroscience Society.
Preparation of viral vector constructs
We constructed virus vectors as previously described (Uesaka et al., 2012). Vesicular stomatitis virus G (VSVG) pseudotyped lentiviral vectors were used (Hanawa et al., 2002). The vectors were designed to express mOrange2, microRNA (miRNA) for PTPĪ“ KD, and/or cDNA for PTPĪ“ expression under the control of the murine embryonic stem cell virus (MSCV) (pCL20c-MSCV) for their expression in CFs.
The following engineered microRNAs were designed by the BLOCK-iT Pol II miR RNAi expression vector kit guidelines (Thermo Fisher Scientific, Japan):
5ā²-TGCTGTTTAGTGGCTGCCCTGGTACTGTTTTGGCCA CTGACTGACAGTACCAGCAGCCACTAAATā3ā²
for PTPĪ“-microRNA 1;
5ā²-TGCTGATTGGAGGATGGCTAGCCATAGTTTTGGCCA CTGACTGACTATGGCTACATCCTCCAATā3ā²
for PTPĪ“-microRNA 2
5ā²-TGCTGCAACTGCACCAAGGAAGCTGTTTTGGCCACT GACTGACAGCTTCCTTGTCGTGCAGTTGā3ā²
for PTPĪ“-scramble 1
5ā²-TGCTGGAGAAGCTCGATTGGAATGCTGTTTTGGCCA CTGACTGAC AGCATTCCAATCGAGCTTCTC-3ā²
for PTPĪ“-scramble 2.
The cDNA for PTPĪ“ expression was obtained using RT-PCR of a cDNA library from the cerebellum of P12 mice (Uesaka et al., 2018). RNAi-resistant forms of PTPĪ“ (PTPĪ“ RES) were generated using the QuikChange Lightning site-directed mutagenesis kit (#210518, Agilent Technologies, USA). The mutations of 5ā6 nucleotides in the miRNA targeted sites of PTPĪ“ were introduced without changing the amino acid sequence. PTPĪ“ RES was linked in-frame to GFP interposed by a picornavirus āself-cleavingā P2A peptide sequence to enable efficient bicistronic expression, and the cDNA was subcloned into pCL20c-MSCV (Uesaka et al., 2018). All constructs were confirmed by DNA sequencing.
Preparation and injection of lentivirus into the inferior olive
We produced lentivirus as previously described (Uesaka et al., 2012). A lentivirus vector (pCL20c-MSCV of 10 μg) was mixed with an envelope vector (3.5 μg of pCAG-VSV-G) and a packaging vector (7 μg of psPAX2) and transfected into cultured human embryonic kidney (HEK) 293T cells. The lentivirus produced from the HEK293T cells was collected and mixed in phosphate buffer saline (PBS). The head of a C57BL/6 mouse at P0-2 was fixed under isoflurane (0.6ā2.5%) anesthesia. The solution containing the lentivirus (1.5 μl) was injected into the inferior olive using a conventional Hamilton syringe at the speed of 80 nl/min.
Electrophysiological recordings from PCs
The electrophysiological recordings were performed as described previously (Hashimoto and Kano, 2003; Uesaka et al., 2012). Mice anesthetized by CO2 inhalation were decapitated and their brains were removed. The acute parasagittal slices of 250 μm thickness were prepared from the cerebellar vermis of mice and were incubated in a reservoir chamber filled with artificial cerebrospinal fluid (ACSF) (125 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 1 mM MgSO4, 1.25 mM NaH2PO4, 26 mM NaHCO3, and 20 mM glucose oxygenated with 95% O2 and 5% CO2) for at least 30 min at room temperature. For recording, the cerebellar slices were placed in a recording chamber at the stage of an Olympus BX51WI microscope (Olympus, Japan) perfused continuously with oxygenated ACSF at 32°C. Whole-cell patch clamp recordings were conducted from visually identified PCs or PCs associated with fluorescent protein-labeled CFs using an upright fluorescence microscope (Olympus BX51WI) (Hashimoto and Kano, 2003; Uesaka et al., 2014, 2018). For recording climbing fiber-induced excitatory postsynaptic currents (CF-EPSCs) and parallel fiber-induced EPSCs (PF-EPSCs), picrotoxin (100 μM, Nacalai, Japan) was added to the bath solution. For recording miniature inhibitory postsynaptic currents (mIPSCs), NBQX (10 μM, Tocris, UK), D-AP5 (50 μM, Tocris), and tetrodotoxin (1 μM, Nacalai, Japan) were added to the bath solution. Ionic currents were recorded with an EPC10 patch clamp amplifier (HEKA, USA) with the holding potential being ā10 mV for CF-EPSCs and ā70 mV for PF-EPSCs, asynchronous quantal CF-EPSCs, and mIPSCs. Liquid junction potential was corrected. The resistance of patch pipettes was 1.5ā2.5 MĪ© when filled with an intracellular solution composed of 60 mM CsCl, 10 mM D-gluconate, 20 mM TEA-Cl, 20 mM BAPTA, 4 mM MgCl2, 4 mM Na2-ATP, 0.4 mM Na2-GTP, and 30 mM HEPES (pH 7.3), adjusted with CsOH.
CF-EPSCs were evoked by electrically stimulating CFs with pairs of pulses (duration, 0.1 ms; interval, 50 ms; current intensity, 0ā100 μA) through a stimulating pipette placed in the granule cell layer (GCL). When a CF was stimulated, EPSCs with a clear amplitude step and showing depression to the second stimulus pairs were elicited (Konnerth et al., 1990; Aiba et al., 1994). To search all CFs innervating the recorded PC, the stimulus pipette was systematically moved in the GCL around the PC soma and the stimulus strength was gradually increased from 0 to 100 μA at each stimulation site (Hashimoto and Kano, 2003). The number of CFs innervating the recorded PC was estimated as the number of discrete CF-EPSC steps elicited in that PC (Hashimoto and Kano, 2003). PF-EPSCs were elicited by stimulating PFs in the middle of the molecular layer (ML) with pairs of pulses whose parameters were similar to those used for CF stimulation. PF-EPSCs exhibited facilitation to the second of stimulus pairs and their amplitudes were graded to the intensity of PF stimulation (Konnerth et al., 1990). The position of the PF stimulating pipette was adjusted so that the maximum response was elicited with the stimulus current of 10 μA (Uesaka et al., 2018). The stimulus intensity was gradually decreased from 10 to 1 μA to obtain inputāoutput relations. For recording quantal CF-EPSCs, 2 mM Ca2+/1 mM Mg2+ was replaced with 2 mM Sr2+/1 mM Mg2+(Hashimoto and Kano, 2003; Uesaka et al., 2018). For recording mIPSCs, the recording was started 3 min after the PC membrane was breached (Uesaka et al., 2018). Online data acquisition was performed using Patch Master (HEKA), and offline data analysis was performed using Fit Master (HEKA) and MATLAB (MathWorks, USA) software.
Quantification of disparity ratio and disparity index of multiple CF-EPSCs
To quantitatively evaluate the disparity among the amplitudes of multiple CF-EPSCs in individual PCs, we calculated the disparity ratio and the disparity index as shown previously (Hashimoto and Kano, 2003).
To calculate the disparity ratio and disparity index, the amplitudes of individual CF-EPSCs in a given PC with multiple CF innervations were measured at the same holding potential and numbered in the order of their amplitudes (A1, A2, ..., AN, N ā„ 2; N is the number of CFs innervating a given PC. AN represents the largest CF-EPSC) (Hashimoto and Kano, 2003). The smaller the difference in the amplitude between AN and other weak CF-EPSCs, the larger the value of the disparity ratio. If all CFs innervating a PC exhibit similar amplitude of CF-EPSCs, the disparity ratio approaches 1. The disparity index is the coefficient of variation for all CF-EPSC amplitudes recorded in a PC (Hashimoto and Kano, 2003). The larger the difference in the amplitude of CF-EPSCs, the larger the value of the disparity index.
Immunohistochemistry
Mice from P0 to P31 of age were deeply anesthetized with pentobarbital (100 μg/g of body weight) by intraperitoneal injection and perfused with 4% paraformaldehyde in 0.1 M phosphate buffer for immunostaining a CF terminal marker, vesicular glutamate transporter VGluT2, to evaluate CF translocation, with 3% glyoxal solution (3% glyoxal and 0.3% acetic acid, pH 4.0 with NaOH) for immunostaining PTPΓ (Richter et al., 2018) or with 9% glyoxal solution (9% glyoxal and 8% acetic acid, pH 4.0) for immunostaining RIM1/2. Fixed brains were placed in the same fixative overnight, and then parasagittal sections (100 or 150 μm in thickness) were prepared with a microslicer. The sections were incubated in 1 or 0.1% TritonX-100/PBS for permeabilization and blockade of non-specific binding. Primary antibodies against the following molecules were added overnight at 4°C: Car8 (Car8-GP-Af500, diluted 1:300, Frontier Institute, Japan) and Calbindin (Calbindin-Go-Af1040, 1 μg/ml, Frontier Institute) for immunostaining PCs, VGluT2 (VGluT2-GO-Af310, 1:300 and VGluT2-GP-Af810, 1 μg/ml, Frontier Institute) for immunostaining CF terminals, VGluT1 (VGluT1-Rb-Af500, 1 μg/ml, Frontier Institute) for immunostaining PF terminals, PTPΓ (Anti-PTPRD, clone F34a6,f 1:300, Merck, Germany), Aldolase C (Aldolase C-Rb-Af1390, Frontier Institute), and RIM1/2 (RIM1/2 Zn-finger domain, Cat. No. 140 203, 1 μg/ml, Synaptic systems, Germany). Then, the sections were incubated with species-specific secondary antibodies (an anti-guinea pig Alexa Fluor 405 antibody, an anti-rat Alexa Fluor 488 antibody, an anti-goat Alexa Fluor 647, and an anti-rabbit Cy3 antibody, 1:200, Jackson Immuno-Research, USA) at room temperature for 2 or 4 h. The immunolabeled cerebellar sections were observed under a confocal laser scanning microscope (FV1200, Olympus). For evaluation of CF translocation, the thickness of the molecular layer containing Car8-positive PC dendrites and the height of CF terminals visualized by VGluT2 immunostaining at P12 and P29-30 were measured. Images were captured from all cerebellar lobules at the same microscopic settings (field of view: 186.2 μm à 186.2 μm for P12, 317.2 μm à 317.2 μm for P29-31). The degree of CF translocation was quantified as the ratio of the height of CF terminals to the thickness of the molecular layer. Z stacks of 12.2 μm images were analyzed using ImageJ (NIH, USA) software. For the morphological analysis of CF synapses, images were taken from anterior lobules of WT and PTPΓ KO mice at the same microscopic settings (field of view: 20 μm à 20 μm for P4 (Figure 2C), 10 μm à 30 μm for P11 (Figures 3C, D), 10 μm à 50 μm for P30 (Figures 3J, K) and were compared using a MetaMorph software (Molecular Devices, USA).
Fluorescence in situ hybridization
For the detection of mRNA, fluorescence in situ hybridization (FISH) was performed using Invitrogen ViewRNA ISH (Tokushima Molecular Pathology Institute, Inc., Japan). The ViewRNA⢠probe set of PTPΓ (2620-3556, GenBank: NM_011211, Probe ID: VB1-17688-06) and VGluT2 (1335-2403, GenBank: NM_080853, Probe ID: VB1-3201379-06) were used. Fast red and Fast blue were prepared for the simultaneous detection of multiple mRNAs using FISH. Paraffin sections containing the medulla oblongata from P7, P14, P21, and 2-month-old mice were hybridized using a Probe set and Fast blue and Fast red liquid substrates. Hoechst was used for fluorescent nuclear counterstaining.
Behavioral tests
Behavioral analyses were performed using 2ā4-month-old male and female mice as described previously (Uesaka et al., 2018). In the open field test, mice were placed in an open field box [50 cm Ć 50 cm Ć 40 cm (W Ć D Ć H) size] for 10 min and their behaviors were recorded using the video camera attached to the ceiling of the experimental room to assess the activity of mice. The total distance traveled was automatically analyzed using the TimeOF4 software (O'Hara & Co., Japan). The beam walking test was performed to assess motor coordination. Mice were placed on the origin of a columnar beam (thin beam; 1 cm diameter, thick beam; 2.8 cm diameter, 80 cm long, placed 70 cm above the floor) and habituated to walk on the beam and to enter the black goal box placed at the end of the beam before the trial. During this habituation, mice were placed on the middle of the beam and allowed to walk to the goal box five times. The number of slips until the mice reached the black goal box was counted. The rotarod test was carried out to assess motor coordination and motor learning. Mice were placed on a stationary rotarod (model LE8205, Panlab, Spain) for 3 consecutive days with five trials per day with a 30-min break in-between. The rotarod was accelerated linearly from 4 rpm to 40 rpm over 300 s in each trial. The time from the start of rotation until the mice fell was measured. The coat hanger test was performed to evaluate limb strength and coordination (Jang et al., 2019). Mice were hung on the middle of a coat hanger and allowed to climb toward the top. The score was determined by the position that the mice could reach within 60 s.
Quantification and statistical analysis
Data were represented as the mean ± SEM. Normality was checked for individual datasets by using the ShapiroāWilk test. To compare two independent datasets, the Student's t-test was used when both datasets showed normal distribution, and the MannāWhitney U-test was conducted when either of the two did not show normal distribution. For multiple comparisons, two-way repeated measures ANOVA was used for datasets with normal distributions, and the SteelāDwass test was used for those without normal distributions. The statistics used for comparing datasets shown in individual figure panels are summarized in Table 1. A significant difference between the groups was determined when the p-value was < 0.05. All statistical analyses were performed using EZR (Kanda, 2013).
Table 1
| Figures | Number of mice | Normality (Shapiro-Wilk test) | Statistical methods |
|---|---|---|---|
| Figure 1B | WT: 6 male mice, 5 female mice. KO: 4 male mice, 6 female mice | Yes | Student's t-test |
| Figure 1L | WT and KO 3 mice, each | No | Steel-Dwass test |
| Figure 1N | WT and KO 2 mice, each | No | Steel-Dwass test |
| Figures 2D, E | WT and KO 2 mice, each | Yes | Student's t-test |
| Figures 3E, F, LāN | WT and KO 2 mice, each | Yes | Student's t-test |
| Figures 3P, Q | WT and KO 2 mice, each | Yes | Student's t-test |
| Figures 4AāE | WT: 2 (P3-5), 7 (P8-10), 7 (P11-12), 4 (P13-15), 4 (P19-29) mice KO: 2 (P3-5), 5 (P8-10), 7 (P11-12), 5 (P13-15), 4 (P19-29) mice | N.A. | Mann-Whitney U test |
| Figure 4F | Same as Figures 4AāE | No | Mann-Whitney U test |
| Figures 5AāD | WT: 2 (P3-5), 7 (P8-10), 7 (P11-12), 4 (P13-15), 4 (P19-29) mice KO: 2 (P3-5), 5 (P8-10), 7 (P11-12), 5 (P13-15), 4 (P19-29) mice | N.A. | Mann-Whitney U test |
| Figure 5E | Same as Figures 5AāD | No | Mann-Whitney U test |
| Figures 6B, C | WT and KO 3 mice, each | Yes | Student's t-test |
| Figure 6G | WT and KO 3 mice, each | Yes | Two-way repeated measures ANOVA |
| Figure 6E | WT: 4 mice, KO: 3 mice | Yes | Two-way repeated measures ANOVA |
| Figure 7D | Ctrl: 6 mice, KD: 4 mice, RES: 4 mice | N.A. | Mann-Whitney U test |
| Figure 7E | Same as Figure 7D | Yes | Student's t-test |
| Figures 8B, D, H | Same as Figure 1B | Yes | Student's t-test |
| Figure 8F | Same as Figure 1B | Yes | Two-way repeated measures ANOVA |
Experimental details: number of mice, normality assessment and statistics.
Results
Impaired CF synapse formation and diminished CF synaptic territory during development in PTPĪ“ KO mice
As reported previously (Uetani et al., 2000), PTPĪ“ KO mice were significantly lower in their body weights than WT mice (Male WT: 26.7 ± 0.9 g, Male KO: 17.3 ± 1.7 g, Female WT: 17.4 ± 0.4 g, Female KO: 16.3 ± 1.6 g) due to insufficient food intake (Figures 1A, B). We first examined the gloss morphology of the cerebellum at P30. The organization and structure of cerebellar lobules appeared normal, but the degree of CF innervation was apparently reduced in PTPĪ“ KO mice (Figures 1CāH). Since the cerebellum has a compartmental structure depending on expression patterns of several marker molecules of PCs such as Aldolase C (Aldoc) and PLCβ3/4 (Kano et al., 1998; Sugihara and Quy, 2007), we scrutinized CF innervation in PCs with Aldoc expression [Aldoc (+) PCs] and those without [Aldoc (ā) PCs] in WT and PTPĪ“ KO mice at P12 and P29-31. We found that the Aldoc expression pattern was not altered in PTPĪ“ KO mice at P12 and P22 (Figures 1IāL), indicating that the lack of PTPĪ“ does not affect Aldoc expression in PCs. Then, we examined whether the effects of PTPĪ“ deletion were different between Aldoc (+) and Aldoc (ā) PCs. We found that the territory of CF innervation over PC dendrites was significantly reduced in PTPĪ“ KO mice in both Aldoc (+) and Aldoc (ā) PCs at P12 and P29-31 when compared to WT mice (Figures 1MāP). We also found that the CF innervation territory in Aldoc (ā) PCs was significantly reduced when compared to Aldoc (+) PCs in PTPĪ“ KO mice, while the extent of CF innervation was similar between Aldoc (+) and Aldoc (ā) PCs in WT mice (Figures 1MāP).
Figure 1

PTPĪ“ promotes the extension of CF synaptic territory along PC dendrites predominantly in Aldoc (ā) PCs. (A) Representative photos of a young adult WT and PTPĪ“ KO mouse at P60. (B) Body weight of WT (gray) and PTPĪ“ KO (purple) mice from 2 to 4 months of age. WT (male n = 6, female n = 5) and PTPĪ“ KO (male n = 4 female n = 6) mice from 2 to 4 months of age. (CāH) Gross morphology of the cerebellar vermis with immunofluorescence for the PC marker Calbindin (Calb) (blue), the CF terminal marker VGluT2 (red), and the PF terminal marker VGluT1 (green) in a WT and a PTPĪ“ KO mouse at P30. Scale bars, 200 μm (C, D) and 20 μm (EāH). (IāL) Gross morphology of the coronal (P22) and sagittal (P12) sections of the cerebellum with immunofluorescence for Car8 (blue), a PC marker, and Aldoc (red) from a WT and a PTPĪ“ KO mouse. Scale bars, 1,000 μm (I, J) and 500 μm (K, L). (MāP) Confocal images of the cerebellum showing immunoreactivities of Car8 (blue), Aldoc (red), and VGluT2 (white) in WT and PTPĪ“ KO mice at P12 (M) and at P29-31 (O). Scale bar, 20 μm. The relative height of VGluT2-labeled CF terminals to the molecular layer thickness for WT [N; Aldoc (ā) n = 11 regions, Aldoc (+) n = 12 regions, from 3 mice at P12 P; Aldoc (ā) n = 8 regions, Aldoc (+) n = 8 regions from 2 mice at P29-31] and PTPĪ“ KO [N; Aldoc (ā) n = 12 regions, Aldoc (+) n = 12 regions, from 3 mice at P12. P; Aldoc (ā) n = 8 regions, Aldoc (+) n = 8 regions from 2 mice at P29-31]. *P < 0.05, **p < 0.01, ***P < 0.001 by the SteelāDwass test. Error bars in the graphs represent ± SEM.
It is reported that the expression of Aldoc is seen between P5 and P8, and a characteristic zonal pattern of expression is observed between P12 and P17 (Fujita et al., 2014). Therefore, we examined the localization of PTPĪ“ in WT mouse cerebellum at P0, at the beginning of (P6), and at a time of clear expression (P18) of Aldolase C. Our immunohistochemical (IHC) analysis revealed that PTPĪ“ immunoreactivity is colocalized with VGluT2, on soma and dendrites of PCs from P0 to P18 in both of Aldoc (ā) and (+) PCs (Figure 2A) and found no PTPĪ“ immunoreactivity in PTPĪ“ KO cerebellum (Figure 2B). These results suggest that the PTPĪ“ protein is localized at CF-PC synapses during early postnatal development from P0. We then investigated whether PTPĪ“ is involved in CF synapse formation during the perinatal period. We found that there was no difference in the area of the cell body of PC, but the area of VGluT2 in PTPĪ“ KO mice was smaller than in WT mice in anterior lobules (1/2-3) (Figures 2CāE), indicating CF synapses in PTPĪ“ KO mice is reduced or/and smaller than in WT mice. Taken together, these results indicate that PTPĪ“ is involved in CF synapse formation during the perinatal period and extension of CF innervation territory along PC dendrites and the effect of PTPĪ“ deletion for CF translocation is more prominent in Aldoc (ā) PCs than in Aldoc (+) PCs during postnatal development.
Figure 2

PTPΓ protein is localized at the CF-PC synapse during perinatal and postnatal periods and is involved in CF synapse formation. (A) Confocal images of the cerebellum at P0, P6, and P18 showing immunoreactivities of Car8 (blue), Aldoc (red), VGluT2 (white), and PTPΓ (green) in Aldoc (-) Purkinje cells (left) and Aldoc (+) Purkinje cells (right). Scale bar (upper), 10 μm for P0, 20 μm for P6 and P18; Scale bar (lower), 5 μm. White arrows indicate the colocalization of PTPΓ and VGluT2. (B) Confocal images of immunofluorescence for PTPΓ (green), Car8 (blue), and VGluT2 (red) in a WT (upper) and a PTPΓ KO (lower) mouse cerebellum at P6. Scale bars, 10 μm. (C) Confocal images of anterior lobules of a WT (left) and a PTPΓ KO (right) mouse cerebellum at P4 showing immunoreactivities of Calbindin (green) (green) and VGluT2 (red). Scale bar, 10 μm. (D, E) Bar graphs for PC area (μm2) (D) and VGluT2 positive area (μm2) (E) in WT (blue columns) and PTPΓ KO (orange columns) mice. Sample numbers of cells/mice are shown in parentheses. Error bars in the graphs represent ± SEM. ***P < 0.001 by Student's t-test.
The size of the CF synapse was smaller in PTPĪ“ KO mice during postnatal development in the anterior cerebellum
LAR-RPTPs have been reported to contribute to the presynaptic formation by accumulating active zone proteins such as calcium/calmodulin-dependent serine kinase (CASK) and RIM1/2 via liprin-α (Serra-PagĆØs et al., 1998; Spangler et al., 2013). We investigated whether PTPĪ“ is involved in presynaptic formation via the accumulation of synapse protein at CF-PC synapses. We performed immunostaining with VGluT2 and RIM1/2, an active zone marker, to determine the density of VGluT2, the area of VGluT2, and the area of overlap between VGluT2 and RIM1/2 on PC dendrites at P11 and P30 (Figures 3AāD, HāK). In anterior lobules, there was no difference in the density of VGluT2 between WT and PTPĪ“ KO mice (Figure 3E), but the size of VGluT2 and the area of overlap between VGluT2 and RIM1/2 in PTPĪ“ KO mice were smaller than WT mice (Figures 3F, G). We also found no difference between WT and PTPĪ“ KO mice at P30 in each parameter (Figures 3HāN). We analyzed quantum EPSCs (qEPSCs) elicited by stimulating the strongest CFs in Sr2+-containing external solution (Hashimoto and Kano, 2003) (Figure 3O). The frequency of qEPSCs was lower in PTPĪ“ KO mice than in WT mice at P9 to P11 (Figures 3O, P). However, there was no difference in the amplitude of qEPSCs (Figure 3Q). These results indicate that CF synapses are immature in PTPĪ“ KO mice at P9 to P11 and the synaptic vesicle release sites may be small because of the low frequency of qEPSCs in the anterior cerebellum.
Figure 3

PTPĪ“ KO is required for normal presynapse development. (AāD) Confocal images of an anterior lobule (Lobule III) of a WT (left) and a PTPĪ“ KO (right) mouse cerebellum at P11 showing immunoreactivities of Calbindin (blue), VGluT2 (green), and RIM1/2 (red), a maker for the active zone. The rectangular areas demarked with white lines in (A, B) are enlarged in (C1āC3, D1āD3), respectively. Scale bar, 20 μm. White arrows indicate overlapping areas of VGluT2 and RIM1/2. (EāG) Bar graphs showing (E) Number of VGluT2 puncta/μm, (F) VGluT2 positive area/μm, and (G) VGluT2 positive area/overlapping area of VGluT2 and RIM1/2 area/μm in WT (blue) and PTP KO (orange) mice. Sample numbers of regions/mice are shown in parentheses. **P < 0.01, ***P < 0.001 by Student's t-test. Error bars in the graphs represent ± SEM. (HāN) Similar to (AāG) but for data at P30. (O) Representative traces of asynchronous quantal EPSCs were elicited by stimulating the strongest CF in an anterior lobule of a WT and a PTPĪ“ KO mouse at P9-11 in the Sr2+-containing extracellular solution. Holding potential was ā70 mV. Scale bars, 100 ms and 500 pA (left) and 20 ms and 50 pA (right). (P, Q) Histograms showing (P) the average frequency and (Q) amplitude of quantal EPSCs in WT (blue) and PTP KO (orange). Sample numbers of PCs/mice are shown in parentheses. *P < 0.05 by Student's t-test. Error bars in the graphs represent ± SEM.
The number of CFs innervating individual PCs in PTPĪ“ KO mice was decreased from the perinatal period to postnatal development
Our IHC analysis has revealed that PTPĪ“ is localized at CF-PC synapses from P0 and is involved in CF synapse formation from P4 before Aldoc expression (Figure 2). We then analyzed CF synaptic inputs and CF innervation of PCs in anterior lobules of neonatal PTPĪ“ KO mice electrophysiologically in acute cerebellar slices during the perinatal stage. We found that PCs in anterior lobules of PTPĪ“ KO mice were innervated by significantly fewer CFs than those of WT mice at P3-5 (Figure 4A), implicating that CF innervation is reduced in PCs in anterior lobules of PTPĪ“ KO mice. To investigate whether PTPĪ“ is involved in CF synapse elimination, we next examined the number of CFs innervating individual PCs in WT and PTPĪ“ KO mice during postnatal development (P8-29) after Aldoc expression. In addition, to examine the effect of PTPĪ“ on CF synapse elimination in Aldoc (+) and (ā) PCs, we analyzed CF innervation in anterior and posterior lobules (8-10) where Aldoc (ā) and (+) PCs were predominant, respectively. PCs in anterior lobules of PTPĪ“ KO mice had fewer CFs than those of WT mice from P8 to P12 (Figures 4B, C). In contrast, PCs in posterior lobules of PTPĪ“ KO mice had fewer CFs than those of WT mice transiently at P13-15 (Figure 5C). There was no difference in the number of CFs innervating each PC in anterior lobules from P13 to P29 and in posterior lobules at P19-27 (Figures 4D, E, 5D). These results suggest that PTPĪ“ is required for CF synapse elimination to proceed normally during limited developmental periods without causing persistent abnormality in the CF innervation pattern after P19.
Figure 4

Transient acceleration of CF synapse elimination during P8 to P12 and persistent reduction of CF-EPSC amplitude in PCs of cerebellar anterior lobules of PTPĪ“ KO mice. (AāE) Representative traces of CF-EPSC and summary histograms showing the number of discrete steps of CF-EPSCs in cerebellar anterior lobules of WT (blue) and PTPĪ“ KO (orange) mice during postnatal development. Sample numbers of PCs/mice are shown in parentheses. The holding potential was ā70 mV for P3-5 and ā10 mV for P8-29. Scale bars, 20 ms and 1 nA. *P < 0.05 by the MannāWhitney U-test. (F) Developmental changes in the total amplitude of CF-EPSCs in individual PCs of WT (blue) and PTPĪ“ KO (orange) mice. The total amplitudes of CF-EPSCs including all CF-EPSC steps were averaged at each postnatal age. ***P < 0.001 by the MannāWhitney U-test. Error bars represent ± SEM.
Figure 5

Transient acceleration of CF synapse elimination during P13 to P15 and reduction of CF-EPSC amplitude until P15 in PCs of cerebellar posterior lobules of PTPĪ“ KO mice. (AāD) Similar to Figures 4BāE but for data from PCs in posterior lobules. Holding potential was ā10 mV. Scale bars, 20 ms and 1 nA. *p < 0.05, ***p < 0.001 by the MannāWhitney U-test. Error bars represent ± SEM. (E) Similar to Figure 4F but for data from PCs in posterior lobules. ***P < 0.001 by the MannāWhitney U-test. Error bars represent ± SEM.
The total amplitude of CF-EPSC in PTPĪ“ KO mice was decreased during perinatal to postnatal development
To determine the role of PTPĪ“ in CF to PC synaptic transmission during postnatal development, we evaluated the strengths of CF synaptic inputs in PTPĪ“ KO mice. We found that the total amplitude of CF-EPSCs in anterior lobules was significantly smaller in PTPĪ“ KO mice than in WT mice from P3 to P29 (Figure 4F; Table 2). In contrast, while the total amplitude in posterior lobules was smaller also in PTPĪ“ KO mice than in WT during P8-15, it recovered at P19-27 (Figure 5E; Table 3). We then determined the disparity ratio, which has been utilized to assess the relative difference among the strengths of multiple CF inputs (Hashimoto and Kano, 2003). The disparity ratio was unchanged in PTPĪ“ KO mice when compared to WT during P8-30 in both anterior and posterior lobules (Tables 2, 3), indicating that PTPĪ“ may equally affect synaptic inputs from the strongest and weaker CFs. We next compared paired-pulse plasticity that reflects the probability of neurotransmitter release from presynaptic terminals unless postsynaptic AMPA-type glutamate receptors are not saturated (Wadiche and Jahr, 2001). We found that the paired-pulse ratio (PPR) in PTPĪ“ KO mice was smaller than that in WT mice in anterior lobules at P8-15 and in posterior lobules at P8-10 (Tables 4, 5). This result may suggest that the release probability of CF synaptic terminals in PTPĪ“ KO mice was higher than in WT mice. However, the degree of paired-pulse depression for the strongest CF input is usually underestimated with normal extracellular Ca2+ concentration. This is because the 1st pulse of CF stimulation induces multivesicular release of glutamate, causes saturation of postsynaptic AMPA receptors, and therefore the 1st EPSC is smaller than reality, whereas the 2nd pulse of CF stimulation does not induce postsynaptic AMPA receptor saturation (Hashimoto and Kano, 2003). Therefore, it is possible that the degree of paired-pulse depression of CF synaptic responses in PTPĪ“ KO appears stronger than in WT mice presumably because the postsynaptic AMPA receptors may not be saturated in response to the 1st pulse of CF stimulation. In addition to the paired-pulse ratio, the decay time constant of CF-EPSC was shorter in PTPĪ“ KO mice than in WT mice in both anterior and posterior lobules (Tables 4, 5), which may reflect the shorter electrotonic distance between the site of CF synapses in PC dendrites and the recording site in the soma presumably due to the impairment of CF translocation. Taken together, these results indicate that PTPĪ“ is involved in multiple aspects of events required for normal CF to PC synaptic transmission.
Table 2
| Anterior lobule (1-3) | Total amplitude (nA) | Disparity ratio | Disparity index |
|---|---|---|---|
| WT (P8-10) | 3.37 ± 0.36 (n = 18) | 0.56 ± 0.09 (n = 12) | 0.52 ± 0.12 (n = 12) |
| PTPΓ KO (P8-10) | 1.93 ± 0.25 (n = 20)** | 0.52 ± 0.08 (n = 11) | 0.52 ± 0.11 (n = 11) |
| WT (P11-12) | 3.04 ± 0.37 (n = 20) | 0.5 ± 0.09 (n = 4) | 0.5 ± 0.11 (n = 4) |
| PTPΓ KO (P11-12) | 1.42 ± 0.18 (n = 33)*** | 0.39 ± 0.1 (n = 5) | 0.71 ± 0.17 (n = 5) |
| WT (P13-15) | 2.63 ± 0.22 (n = 19) | 0.44 ± 0 (n = 1) | 0.71 ± 0 (n = 1) |
| PTPΓ KO (P13-15) | 1.72 ± 0.12 (n = 41)*** | 0.41 ± 0.08 (n = 10) | 0.78 ± 0.12 (n = 9) |
| WT (P21-29) | 2.25 ± 0.16 (n = 8) | 0.07 ± 0.02 (n = 2) | 1.22 ± 0.05 (n = 2) |
| PTPΓ KO (P19-29) | 1.26 ± 0.21 (n = 14)** | 0.3 ± 0 (n = 1) | 0.77 ± 0 (n = 1) |
Total amplitudes and disparity parameters for CF-EPSCs in cerebellar anterior lobules (1/2-3) of WT and PTPĪ“ KO mice.
CF-EPSC amplitudes were measured at holding potential of ā10 mV. Disparity parameters were calculated with the formulas described in Methods. P-value was determined by Mann-Whitney U-test. All data are expressed as mean ± SEM.
** P < 0.01; ***P < 0.001.
Table 3
| Posterior lobule (8-10) | Total amplitude (nA) | Disparity ratio | Disparity index |
|---|---|---|---|
| WT (P8-10) | 4.11 ± 0.4 (n = 16) | 0.54 ± 0.09 (n = 11) | 0.49 ± 0.1 (n = 11) |
| PTPΓ KO (P8-10) | 1.81 ± 0.21 (n = 25)*** | 0.49 ± 0.05 (n = 17) | 0.57 ± 0.07 (n = 17) |
| WT (P11-12) | 4.77 ± 0.27 (n = 22) | 0.34 ± 0.09 (n = 4) | 0.73 ± 0.18 (n = 4) |
| PTPΓ KO (P11-12) | 2.45 ± 0.34 (n = 14)*** | 0.46 ± 0.07 (n = 7) | 0.58 ± 0.11 (n = 7) |
| WT (P13-15) | 3.91 ± 0.24 (n = 40) | 0.42 ± 0.08 (n = 15) | 0.67 ± 0.11 (n = 15) |
| PTPΓ KO (P13-15) | 2.68 ± 0.22 (n = 36)*** | 0.36 ± 0.1 (n = 6) | 0.75 ± 0 (n = 6) |
| WT (P21-29) | 2.49 ± 0.3 (n = 14) | 0.03 ± 0 (n = 1) | 1.34 ± 0 (n = 1) |
| PTPΓ KO (P19-27) | 2.04 ± 0.17 (n = 30) | 0.25 ± 0 (n = 1) | 0.84 ± 0 (n = 1) |
Total amplitudes and disparity parameters for CF-EPSCs in cerebellar posterior lobules (1/2-3) of WT and PTPĪ“ KO mice.
Data are measured and described similarly to Table 1.
*** P < 0.001.
Table 4
| Anterior lobule (1-3) | CF group | Amplitude (nA) | Paired pulse ratio (interval, 50 ms) | 10ā90% rise time (ms) | Decay time constant (ms) | n |
|---|---|---|---|---|---|---|
| CF-mono | 3.13 ± 0.65 | 0.5 ± 0.03 | 0.74 ± 0.09 | 4.6 ± 0.81 | 6 | |
| WT (P8-10) | CF-multi-s | 2.13 ± 0.18 | 0.47 ± 0.03 | 0.51 ± 0.04 | 4.76 ± 0.4 | 12 |
| CF-multi-w | 1.03 ± 0.2 | 0.51 ± 0.03 | 0.64 ± 0.07 | 4.33 ± 0.5 | 18 | |
| CF-mono | 1.48 ± 0.28 | 0.34 ± 0.03* | 0.82 ± 0.14 | 4.58 ± 1.18 | 9 | |
| PTPΓ KO (P8-10) | CF-multi-s | 1.52 ± 0.27* | 0.38 ± 0.04 | 0.52 ± 0.04 | 3.89 ± 0.35 | 11 |
| CF-multi-w | 0.57 ± 0.09 | 0.37 ± 0.06 | 0.48 ± 0.05 | 3.14 ± 0.24 | 14 | |
| CF-mono | 3.69 ± 0.72 | 0.58 ± 0.02 | 0.5 ± 0.03 | 5.11 ± 0.44 | 15 | |
| WT (P11-12) | CF-multi-s | 2.55 ± 0.36 | 0.55 ± 0.07 | 0.54 ± 0.04 | 4.01 ± 0.48 | 4 |
| CF-multi-w | 1.37 ± 0.37 | 0.55 ± 0.03 | 0.48 ± 0.03 | 3.28 ± 0.43 | 4 | |
| CF-mono | 1.36 ± 0.21*** | 0.46 ± 0.02*** | 0.44 ± 0.02 | 2.11 ± 0.14*** | 28 | |
| PTPΓ KO (P11-12) | CF-multi-s | 1.31 ± 0.44 | 0.39 ± 0.05 | 0.55 ± 0.02 | 2.35 ± 0.19* | 5 |
| CF-multi-w | 0.35 ± 0.08* | 0.51 ± 0.05 | 0.48 ± 0.02 | 2.18 ± 0.17 | 7 | |
| CF-mono | 2.42 ± 0.08 | 0.69 ± 0.02 | 0.45 ± 0.03 | 6.27 ± 0.3 | 18 | |
| WT (P13-15) | CF-multi-s | 3.41 ± 0 | 0.69 ± 0 | 0.56 ± 0 | 4.66 ± 0 | 1 |
| CF-multi-w | 1.52 ± 0.29 | 0.64 ± 0.04 | 0.48 ± 0.01 | 4.59 ± 0.69 | 2 | |
| CF-mono | 1.68 ± 0.14*** | 0.58 ± 0.02*** | 0.44 ± 0.02 | 3.45 ± 0.3*** | 31 | |
| PTPΓ KO (P13-15) | CF-multi-s | 1.44 ± 0.21 | 0.49 ± 0.04 | 0.47 ± 0.02 | 3.06 ± 0.27 | 10 |
| CF-multi-w | 0.39 ± 0.08* | 0.44 ± 0.07 | 0.67 ± 0.11 | 2.34 ± 0.44 | 13 | |
| CF-mono | 2.12 ± 0.17 | 0.75 ± 0.02 | 0.46 ± 0.04 | 6.82 ± 0.6 | 6 | |
| WT (P21-29) | CF-multi-s | 2.47 ± 0.26 | 0.76 ± 0.04 | 0.46 ± 0.02 | 6.9 ± 0.25 | 2 |
| CF-multi-w | 0.17 ± 0.03 | 0.5 ± 0.08 | 0.51 ± 0.1 | 3.81 ± 1.08 | 2 | |
| CF-mono | 1.19 ± 0.22*** | 0.72 ± 0.01 | 0.5 ± 0.05 | 5.94 ± 0.89 | 13 | |
| PTPΓ KO (P19-29) | CF-multi-s | 1.69 ± 0 | 0.61 ± 0 | 0.47 ± 0 | 5 ± 0 | 1 |
| CF-multi-w | 0.4 ± 0 | 0.7 ± 0 | 0.45 ± 0 | 2.21 ± 0 | 1 |
Electrophysiological parameters of CF-EPSCs in cerebellar anterior lobules (1/2-3) of WT and PTPĪ“ KO mice.
Amplitudes were measured at holding potential of ā10 mV. Rise time was defined as the time required for the membrane current to change from 10 to 90% of the maximal CF-EPSC amplitude. PPR (Paired-pulse ratio) was defines as the relative portion of the second EPSC amplitude to the first one with the inter-stimulus interval of 50 ms. The decay time constant was obtained by fitting the EPSC decay with a single exponential. P-value was determined by Mann-Whitney U-test. All data are expressed as mean ± SEM.
* P < 0.05; ***P < 0.001.
Table 5
| Posterior lobule (8-10) | CF group | Amplitude (nA) | Paired pulse ratio (interval, 50 ms) | 10ā90% rise time (ms) | Decay time constant (ms) | n |
|---|---|---|---|---|---|---|
| CF-mono | 2.91 ± 0.57 | 0.44 ± 0.06 | 0.47 ± 0.06 | 4.76 ± 0.47 | 4 | |
| WT (P8-10) | CF-multi-s | 2.63 ± 0.22 | 0.56 ± 0.02 | 0.43 ± 0.01 | 5.83 ± 0.4 | 12 |
| CF-multi-w | 1.42 ± 0.22 | 0.56 ± 0.04 | 0.44 ± 0.04 | 4.96 ± 0.58 | 16 | |
| CF-mono | 1.59 ± 0.47 | 0.51 ± 0.06 | 0.62 ± 0.06 | 3.12 ± 0.29*** | 8 | |
| PTPΓ KO (P8-10) | CF-multi-s | 1.19 ± 0.15*** | 0.49 ± 0.02* | 0.61 ± 0.03*** | 3.87 ± 0.26*** | 19 |
| CF-multi-w | 0.47 ± 0.08*** | 0.57 ± 0.03 | 0.53 ± 0.03* | 3.31 ± 0.19* | 30 | |
| CF-mono | 4.44 ± 0.28 | 0.63 ± 0.02 | 0.45 ± 0.03 | 5.08 ± 0.29 | 18 | |
| WT (P11-12) | CF-multi-s | 4.78 ± 0.51 | 0.63 ± 0.04 | 0.46 ± 0.04 | 5.88 ± 0.03 | 4 |
| CF-multi-w | 1.46 ± 0.24 | 0.65 ± 0.03 | 0.44 ± 0.03 | 7.92 ± 1.99 | 4 | |
| CF-mono | 2.6 ± 0.56* | 0.55 ± 0.04 | 0.53 ± 0.03 | 5.32 ± 0.94 | 7 | |
| PTPΓ KO (P11-12) | CF-multi-s | 1.56 ± 0.27* | 0.44 ± 0.06 | 0.55 ± 0.03 | 5.63 ± 1.01 | 7 |
| CF-multi-w | 0.65 ± 0.19* | 0.49 ± 0.06 | 0.52 ± 0.04 | 4.12 ± 0.47 | 8 | |
| CF-mono | 3.97 ± 0.34 | 0.68 ± 0.01 | 0.44 ± 0.02 | 5.83 ± 0.34 | 25 | |
| WT (P13-15) | CF-multi-s | 3.14 ± 0.26 | 0.6 ± 0.03 | 0.46 ± 0.03 | 6.82 ± 0.46 | 15 |
| CF-multi-w | 1.17 ± 0.2 | 0.62 ± 0.03 | 0.41 ± 0.03 | 4.99 ± 1.11 | 15 | |
| CF-mono | 2.39 ± 0.22*** | 0.64 ± 0.02 | 0.48 ± 0.02 | 5.22 ± 0.29 | 30 | |
| PTPΓ KO (P13-15) | CF-multi-s | 3.03 ± 0.35 | 0.67 ± 0.04 | 0.42 ± 0.04 | 4.97 ± 0.6 | 6 |
| CF-multi-w | 0.93 ± 0.23 | 0.54 ± 0.05 | 0.41 ± 0.03 | 3 ± 0.51 | 7 | |
| CF-mono | 2.33 ± 0.28 | 0.67 ± 0.03 | 0.51 ± 0.03 | 4.84 ± 0.32 | 13 | |
| WT (P21-29) | CF-multi-s | 4.52 ± 0 | 0.7 ± 0 | 0.38 ± 0 | 4.22 ± 0 | 1 |
| CF-multi-w | 0.12 ± 0 | 0.31 ± 0 | 0.35 ± 0 | 11.4 ± 0 | 1 | |
| CF-mono | 2.05 ± 0.17 | 0.66 ± 0.01 | 0.47 ± 0.02 | 4.53 ± 0.29 | 29 | |
| PTPΓ KO (P19-27) | CF-multi-s | 1.4 ± 0 | 0.65 ± 0 | 0.45 ± 0 | 4.06 ± 0 | 1 |
| CF-multi-w | 0.35 ± 0 | 0.51 ± 0 | 0.44 ± 0 | 1.95 ± 0 | 1 |
Electrophysiological parameters of CF-EPSCs in cerebellar posterior lobules (8-10) of WT and PTPĪ“ KO mice.
Data are presented similarly to Table 3.
* P < 0.05; ***P < 0.001.
Transient increase of PF-PC excitatory synaptic transmission at P12-13 in PTPĪ“ KO mice
Previous studies have shown that inhibitory synaptic inputs to PCs (Nakayama et al., 2012) and abnormal PF-PC synapse formation have a significant influence on CF elimination (Hashimoto et al., 2001, 2009b, 2011; Ichikawa et al., 2002). We recorded the amplitude and frequency of miniature inhibitory postsynaptic currents (mIPSCs) in anterior lobules and found that the amplitude and frequency of mIPSCs were not different between WT and PTP KO mice during P9-12 (Figures 6AāC). We next recorded PF mediated-EPSCs (PF-EPSCs) in anterior lobules to investigate whether PTPĪ“ is involved in normal PF synapse development. PF-EPSCs in PTPĪ“ KO mice were increased in amplitude during P12-13 (Figures 6D, E), but they became normal during P28-30 (Figures 6F, G) when compared to WT mice. These results suggest that the lack of PTPĪ“ transiently increases PF-PC excitatory transmission during the second postnatal week during which CF innervation was reduced.
Figure 6

Transient increase of PF-PC excitatory synaptic transmission at P12-13 but normalization at P28-30 in PTPĪ“ KO mice. (A) Representative traces of mIPSC recorded from a WT (top, P11) and a PTPĪ“ KO (bottom, P12) mouse. Vh was ā70 mV. Scale bars, 500 ms and 50 pA. (B, C) Bar graphs showing (B) the average mIPSC frequency and (C) the average mIPSC amplitude in WT (blue) and PTP KO (orange) mice at P9-12. Sample numbers of cells/mice are shown in parentheses. Error bars in the graphs represent ± SEM. (D) Representative traces of PF-EPSCs recorded from a WT (top, P12) and a PTPĪ“ KO mouse (bottom, P12). Vh was ā70 mV. Scale bars, 10 ms and 500 pA. (E) Inputāoutput curve of PF-EPSCs in WT (n = 12) and PTPĪ“ KO mice (n = 12) at P12-13 with stimulus intensities from 1 to 10 μA. Vh was ā70 mV. A significant difference was observed between WT and PTPĪ“ KO mice (Repeated-measures ANOVA: factor genotype, P = 0.0003555; factor stimulus intensity, P < 2.2e-16; interaction, genotype Ć stimulus intensity, P = 2.2e-16). Sample numbers of cells/mice are shown in parentheses. ***P < 0.001. (F) Representative traces of PF-EPSCs recorded from a WT mouse (top, P28) and a PTPĪ“ KO mouse (bottom, P28). Vh was ā70 mV. Scale bars; 10 ms and 500 pA. (G) Inputāoutput curve of PF-EPSCs in WT (n = 12) and PTPĪ“ KO mice (n = 11) at P28-30 with stimulus intensities from 1 to 10 μA. Vh was ā70 mV. No significant difference was observed between WT and PTPĪ“ KO mice (Repeated-measures ANOVA: factor genotype, P = 0.8857; factor stimulus intensity, P < 2.2e-16; interaction, genotype Ć stimulus intensity, P = 0.9885). Sample numbers of cells/mice are shown in parentheses.
Knockdown of PTPĪ“ in CFs from P0-2 caused reduced CF innervation of PCs at P10-13
Since PTPĪ“ is known to be a presynaptic organizer (Takahashi and Craig, 2013), we assume that PTPĪ“ functions at CF synaptic terminals but not at postsynaptic PCs. Therefore, we investigated whether mRNA of PTPĪ“ is expressed in the inferior olive, the origin of CFs, using FISH during postnatal to adult stages. We revealed that VGluT2-positive neurons in the inferior olive expressed PTPĪ“ mRNA during early postnatal stages to adulthood (Figure 7A). Then, to examine whether PTPĪ“ in CFs is involved in CF synaptic function and CF synapse development, we performed RNAi-mediated knockdown (KD) of PTPĪ“ in CFs during postnatal development (Figure 7B). We found that PCs of PTPĪ“ KD mice were innervated by fewer CFs than those of control (Ctrl) mice (Figures 7C, D), and the total amplitude of CF-EPSC in PTPĪ“ KD mice tended to be decreased when compared to that in Ctrl mice (Figure 7E; Table 6) in anterior lobules at P10-13. These results are consistent with those of PTPĪ“ KO mice (Figures 4B, C, F; Table 2). The effects of PTPĪ“ KD in CFs on most parameters were rescued by co-expression of a miRNA-resistant PTPĪ“ (PTPĪ“ RES) (Figures 7CāE; Table 6), except the rise time and decay time constant of CF-EPSCs (Table 7). These results suggest that PTPĪ“ in CFs is required for CF synapse formation, augmentation of CF synaptic strength, and possibly maintenance and strengthening of CF innervation during postnatal cerebellar development.
Figure 7

PTPĪ“ KD in CFs reduced the CF-EPSC amplitude and the number of CFs innervating PCs from P10 to P13. (A) Expression of mRNAs for PTPĪ“ in the inferior olive of P7, P14, P21, and 2-month-old mice. Images from double fluorescence in situ hybridization analyses to detect PTPĪ“ (red) and VGluT2 (white) mRNAs expressed in inferior olivary neurons projecting CFs to the cerebellar cortex. Scale bars, 500 μm. (B) Vector constructs for Control (Ctrl; Scr-PTPĪ“), PTPĪ“ knockdown (KD), and PTPĪ“ rescue (RES). (C) Sample traces of CF-EPSCs from a Ctrl mouse, a mouse with PTPĪ“ KD, and that with PTPĪ“ RES recorded from PCs in anterior lobules during P10 to P13. Holding potential was ā10 mV. Scale bars, 20 ms and 1 nA. (right). (D) Summary histogram showing the number of CFs innervating individual PCs in anterior lobules of Ctrl (green column), PTPĪ“ KD (purple column), and PTPĪ“ RES (blue column) mice during P10ā13. The numbers of PCs/mice are shown in parentheses. *P < 0.05 by the MannāWhitney U-test. (E) Average total amplitudes of CF-EPSCs in anterior lobules of Ctrl (green column), PTPĪ“ KD (purple column), and PTPĪ“ RES (blue column) mice. Error bars in the graphs represent ± SEM. The numbers of PCs/mice are shown in parentheses. *P < 0.05 by Student's t-test.
Table 6
| Total amplitude (nA) | Disparity ratio | Disparity index | |
|---|---|---|---|
| Control (P10-13) | 3.72 ± 0.26 (n = 27) | 0.39 ± 0.1 (n = 11) | 0.72 ± 0.14 (n = 11) |
| PTPΓ KD (P10-13) | 2.89 ± 0.34 (n = 21)* | 0.17 ± 0.02 (n = 4) | 1.04 ± 0.07 (n = 4) |
| PTPΓ RES (P10-13) | 4.07 ± 0.49 (n = 14) | 0.27 ± 0.08 (n = 6) | 0.89 ± 0.13 (n = 6) |
Total amplitudes and disparity parameters in cerebellar anterior lobules (1/2-3) of control, PTPĪ“ KD and PTPĪ“ RES mice.
Table 7
| Anterior lobule (1-3) | CF group | Amplitude (nA) | Paired pulse ratio (interval, 50 ms) | 10ā90% rise time (ms) | Decay time constant (ms) | n |
|---|---|---|---|---|---|---|
| CF-mono | 3.44 ± 0.37 | 0.53 ± 0.03 | 0.59 ± 0.02 | 4.62 ± 0.31 | 16 | |
| Control (P10-13) | CF-multi-s | 3.4 ± 0.31 | 0.5 ± 0.02 | 0.55 ± 0.02 | 3.72 ± 0.45 | 11 |
| CF-multi-w | 1.17 ± 0.27 | 0.51 ± 0.03 | 0.44 ± 0.03 | 2.86 ± 0.31 | 10 | |
| CF-mono | 2.87 ± 0.41 | 0.6 ± 0.03 | 0.54 ± 0.03 | 4.35 ± 0.33 | 17 | |
| PTPΓ KD (P10-13) | CF-multi-s | 2.5 ± 0.28 | 0.63 ± 0.03* | 0.49 ± 0.01 | 4.78 ± 0.66 | 4 |
| CF-multi-w | 0.42 ± 0.06 | 0.52 ± 0.05 | 0.42 ± 0.02 | 2.44 ± 0.36 | 1 | |
| CF-mono | 4.55 ± 0.68 | 0.53 ± 0.02 | 0.48 ± 0.02 | 4.0 ± 0.36 | 8 | |
| PTPΓ RES (P10-13) | CF-multi-s | 2.71 ± 0.51 | 0.49 ± 0.04 | 0.47 ± 0.03 | 3.7 ± 0.61 | 6 |
| CF-multi-w | 0.72 ± 0.21 | 0.52 ± 0.04 | 0.37 ± 0.03 | 2.64 ± 0.39 | 7 |
Electrophysiological parameters of CF-EPSCs in anterior lobules of control, PTPĪ“ KD and PTPĪ“ RES mice.
Young adult PTPĪ“ KO mice showed motor dysfunction in several behavioral tests
Finally, we examined whether the lack of PTPĪ“ resulted in any abnormality in cerebellum-related behaviors. In the open field test, there was no difference in total distance traveled between WT and PTPĪ“ KO mice (Figures 8A, B). In the beam walking test, the average number of slips on the thick beam was larger in PTPĪ“ KO mice than in WT mice, whereas those on the thin beam were not significantly different between the genotypes (Figures 8C, D), indicating impaired motor coordination and balance in PTPĪ“ KO mice. In the rotarod test, PTPĪ“ KO mice exhibited reduced latency to fall compared with WT, suggesting impaired motor coordination and/or motor learning (Figures 8E, F). We performed the coat hanger test to evaluate motor coordination. For the coat hanger test, mice were hung in the middle of the coat hanger (score 0) and allowed to climb to the top (score 6) within 60 s. The score was determined by the position where mice could reach (Figure 8G). The average score of the hanger test for PTPĪ“ KO mice was lower than that for WT mice (Figure 8H), suggesting impaired motor coordination and/or limb strength in PTPĪ“ KO mice. Taken together, these results show that the lack of PTPĪ“ causes deficits in motor coordination and motor learning.
Figure 8

Motor dysfunction in young-adult PTPĪ“ KO mice. (A, B) Open field test. Representative tracks for WT (left) and PTPĪ“ KO (right) (A) and total distance traveled (B) in an open field arena over 10 min trial for WT (male n = 6, female n = 5) and PTPĪ“ KO (male n = 4, female n = 6) mice from 2 to 4 months of age. *P < 0.05 (Student's t-test). (C, D) Beam walking test. Cartoon of balance walking test (C) and average number of slips on a thick beam and a thin beam (D) for WT (male n = 6, female n = 5) and PTPĪ“ KO (male n = 4, female n = 6) mice from 2 to 4 months of age. *P < 0.05 (Student's t-test). (E, F) Rotarod test. Cartoon of rotarod test (E) and a summary graph showing durations for which mice stayed on the rod (F). The rod was rotated at the speed of 40 rpm. The duration on the rod was measured (F) in five sessions of each of 3 consecutive days for WT (male n = 6, female n = 5) and PTPĪ“ KO (male n = 4, female n = 6) mice from 2 to 4 months of age. A significant difference was observed between WT and PTPĪ“ KO mice (repeated-measures ANOVA: factor genotype, P = 0.02487; factor stimulus intensity, P < 2.2e-16; interaction, genotype Ć stimulus intensity, P = 0.09550). *P < 0.05. (F, G) Hanger test. The score set at different positions of a coat-hanger (G) and average scores (H) for WT (male n = 6, female n = 5) and PTPĪ“ KO (male n = 4, female n = 6) mice from 2 to 4 months of age. *P < 0.05 (Student's t-test).
Discussion
Presynaptic PTPĪ“ functions as a synapse organizer for CF-PC synapse formation
We demonstrated that PTPĪ“ mRNA was expressed in the inferior olive and PTPĪ“ protein was localized at CF-PC synapses at least from P0 in WT mice. PCs of PTPĪ“ KO mice were innervated by fewer CFs than those of WT mice during the perinatal period of P3-5, and CF-specific KD of PTPĪ“ from P0-2 yielded the reduced CF innervation at P10-12. These results suggest that presynaptic PTPĪ“ may act as a synapse organizer for CF-PC synapse formation during the perinatal period before CF synapse elimination.
A previous study reported that global deletion of all neurexins (NRXN1, 2, and 3), which are known as presynaptic organizers, from CFs caused a decrease in the CF-EPSC amplitude and reduction in the height of CF terminal along PC dendrites at P24 (Chen et al., 2017). While these phenotypes are similar to those induced by PTPĪ“ deletion, contributions of neurexins in CF synapse formation and possible lobule differences in their effects were not investigated (Chen et al., 2017). It remains to be clarified whether neurexins and PTPĪ“ influence the formation, development, elimination, and maintenance of CF to PC synapses independently from each other or by sharing common molecules and mechanisms.
Although several trans-synaptic adhesion molecules have been identified to contribute to CF-PC synapse maintenance or elimination including Sema3A-PlxnA4, Sema7A-PlxnC1/ItgB1, Sort1-progranulin, BDNF-TrkB, and C1q1-Bai3 (Uesaka et al., 2014, 2018; Kakegawa et al., 2015; Choo et al., 2017), specific synaptic molecules involved in the formation and/or maintenance of CF synapses during perinatal stages or synaptic molecules with differential functions in cerebellar lobules related to the Aldoc expression are yet to be identified. Even in mice with PC-selective deletion of P/Q type voltage-gated Ca2+ channels (PQ-VDCCs), which are known to cause the most severe impairments in CF synapse elimination processes including CF-PC synapse strengthening, CF translocation, and CF synapse elimination, the initial CF-PC synapse formation at P4-6 appears normal (Hashimoto et al., 2011). Therefore, PTPĪ“ is thought to be the first identified presynaptic molecule involved in CF-PC synapse function and/or maintenance during the perinatal period before the sequential events of CF synapse elimination possibly in a manner independent of PQ-VDCCs in PCs and in predominantly Aldoc (ā) PCs of anterior lobules.
PTPĪ“ is required for proper CF-PC synaptic transmission and CF translocation
Synapse organizers induce synapse formation by promoting the accumulation of synaptic vesicles and the construction of active zones at presynaptic terminals and the formation of postsynaptic density at the postsynaptic membrane (Südhof, 2018). LAR-RPTPs have two tandem phosphatase domains in their intracellular domains to which several active zone proteins such as Liprin-α, Caskin, and Trio are known to bind directly (Debant et al., 1996; Serra-Pagès et al., 1998; Weng et al., 2011). Liprin-α plays a role in synaptic vesicle release and normal presynaptic output by regulating the dynamics of active zone proteins such as RIM and CASK (Spangler et al., 2013). We found that the synapse size was small and the RIM1/2 structure was obscured in PTPΓ KO mice, suggesting that accumulation of active zone proteins by PTPΓ is required for CF synaptic development during postnatal development.
Proper CF translocation and extension along PC dendrites are known to require PQ-VDCC-mediated Ca2+ flux into PCs (Hashimoto et al., 2011). Reduced CF translocation along PC dendrites is also seen in mice with PC-specific KO of TARPγ2 (Kawata et al., 2014), a major AMPA receptor auxiliary subunit in PCs. In this PC-specific TARPγ2 KO mouse, CF-EPSCs are small in amplitude due to the reduction of AMPAR-mediated currents leading to a decrease in PQ-VDCC-mediated Ca2+ flux into PCs during CF activity (Kawata et al., 2014). Hence, these results suggest that the reduction of CF synaptic inputs in PTPĪ“ KO mice also causes diminished CF translocation and extension along PC dendrites due to the reduction of Ca2+ influx into PCs. In line with this notion, the impairment of CF translocation in Aldoc (+) PCs of PTPĪ“ KO mice at P29-31 was relatively milder than in Aldoc (ā) PCs, which may ascribe at least partially to the recovery of reduced CF-EPSC amplitude in Aldoc (+) PCs after P15 to P19-27. However, another possibility remains that PTPĪ“ may directly regulate CF translocation and extension along PCs irrespective of the activity of PCs.
PTPĪ“ is required for CF-PC synapse maintenance and is involved indirectly in PF synapse development
Our electrophysiological data showed reduced multiple CF innervation of PCs in PTPĪ“ KO mice at P8-12 in anterior lobules and at P13-15 in posterior lobules, which corresponded to the early (P7-11) and late phases (P12-17) of CF elimination (Hashimoto et al., 2009b). In addition, the CF-specific PTPĪ“ KD, which was caused by the injection of the lentivirus for PTPĪ“ KD into the inferior olive after perinatal CF synapse formation, caused reductions in multiple CF innervations of PCs during P10-13. These results suggest that PTPĪ“ contributes to the maintenance of CF-PC synapses and to antagonizing CF elimination, although the reduced multiple CF innervation in Aldoc (ā) PCs during P8-12 might be attributable at least partially to the impaired CF synapse formation during the perinatal period.
The acceleration of CF synapse elimination has been observed from P8 to P18 in mice with Sema3A KD in PCs (Uesaka et al., 2014) and from P11 to P16 in PC-specific Progranulin KO mice (Uesaka et al., 2018). The developmental stage of the CF synapse affected by PTPĪ“ KO was partially overlapped with that dependent on Sema3A or Progranulin. One previous study reported that PTPĪ“ mediated the Sema3A signaling in cerebral cortical neurons (Nakamura et al., 2017). Further study is needed to elucidate whether PTPĪ“ interacts with Sema3A-PlxnA4 or Progranulin-Sort1 pathway for CF synapse development.
In both PTPĪ“ KO mice and Sema3A-PlxnA4 KD mice, PF-PC synaptic transmission was enhanced at P12-13. The enhanced PF-PC synaptic transmission has been found also in PC-specific PQ-VDCC KO mice (Miyazaki et al., 2012), suggesting that the diminished CF territories in PQ-VDCC KO mice or Sema3A KD mice caused enlargement of PF synaptic territories. Considering the expression of PTPĪ“ on CFs but not on PFs, it is likely that the enhanced PF synaptic inputs in PTPĪ“ KO mice resulted indirectly from the reduced CF synaptic territory on PC dendrites.
Previous studies have shown that PTPĪ“ is involved in excitatory synapse formation and maintenance in vivo. For example, in PTPĪ“ KO mice, decreased excitatory synapse density and strength in distal dendrites of hippocampal CA1 neurons (Park et al., 2020) and impaired synaptic plasticity (Uetani et al., 2000) were found. Therefore, PTPĪ“ is considered to have similar functions on excitatory synapses in the hippocampus and the cerebellum.
PTPĪ“ KO mice show motor dysfunction in young adulthood
PTPĪ“ has been reported to be associated with behavioral abnormalities due to impairment in the hippocampal and cerebral cortical neural circuits. For example, the first report showed that PTPĪ“ KO mice have defects in learning and memory ability with the enhancement of hippocampus long-term potentiation (Uetani et al., 2000). One recent report by Yoshida et al. (2021) identified the NLGN3-PTPĪ“ interaction that competes with the well-known NLGN3-NRXN1 interaction. Interruption of the NLGN3-PTPĪ“ interaction in mice caused impairment of sociability and enhancement of motor learning with an imbalance in excitatory/inhibitory synaptic protein expression in the forebrain (Yoshida et al., 2021). Moreover, PTPĪ“ KO mice and meA (binding site for IL1RAPL1)-specific PTPĪ“ mutant mice showed abnormal sleep behavior and non-REM rhythms with decreased excitatory synaptic transmission in the hippocampal CA1 neurons (Park et al., 2020).
In addition to these reported results, we found in the present study that young adult PTPĪ“ KO mice showed impaired motor coordination in the beam test and reduced motor learning in the rotarod test, suggesting that PTPĪ“ KO mice are impaired in cerebellum-related motor functions. Accumulating evidence from connectomics and functional imaging studies suggest that motor and non-motor functions of the cerebellum are likely attributable to Aldoc (ā) and (+) PCs, respectively (Jan and Mitchell, 1998; Voogd, 2014; Lin et al., 2020). Because our data indicate that PTPĪ“ predominantly functions in Aldoc (ā) PCs of anterior lobules, impairment of CF synaptic function or CF innervation of Aldoc (ā) PCs in anterior lobules of PTPĪ“ KO mice is thought to contribute to the cerebellum-related motor dysfunction.
Possible postsynaptic ligands for PTPĪ“ and phenotype of PTPĪ“ KO mice
As mentioned above, NLGN3 is one of the postsynaptic ligands for PTPĪ“ (Yoshida et al., 2021). However, in NLGN3 R451C mice, NLGN3 expression in the cerebellum was greatly reduced and CF synapse elimination was impaired transiently from P10 to P15 with increased amplitude of EPSCs by weaker CF stimulation (Lai et al., 2021). Since these phenotypes are clearly different from those of PTPĪ“ KO mice, NLGN3 is not likely to be the postsynaptic ligand of PTPĪ“ responsible for the cerebellar phenotypes of PTPĪ“ KO mice.
PTPĪ“ interacts with a variety of postsynaptic ligands, including NGL-3, IL-1RAP, IL1RAPL1, and SALM3,5 (Takahashi and Craig, 2013). In addition, LAR-RPTPs were identified as cellular receptors of proteoglycans (Aricescu et al., 2002; Shen et al., 2009). A previous study suggests that astrocyte-secreted glypican 4, a type of heparan sulfate proteoglycans, interacts with PTPĪ“ and recruits AMPA receptors in postsynaptic sites via the release of neuronal pentraxin 1 from presynaptic terminals (Farhy-Tselnicker et al., 2017). Further study is needed to identify postsynaptic ligands for PTPĪ“ on CF-PC synapses from these candidates. Multiple molecules have been reported to be complementarily expressed in PCs in accordance with the aldolase C expression patterns. For example, PLCβ3 and PLCβ4 are expressed in Aldoc (+) and Aldoc (ā) PCs, respectively (Hawkes, 2014; Cerminara et al., 2015). Thus, it is likely that some postsynaptic ligands for PTPĪ“ are differentially expressed in Aldoc (+) and Aldoc (ā) PCs, which may underlie the differential phenotypes of PTPĪ“ KO mice in these two populations of PCs.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The animal study was reviewed and approved by the animal welfare committees of The University of Tokyo.
Author contributions
YO, TW, and MK designed the experiment and wrote the manuscript. YO performed knockdown and rescue of PTPĪ“ in CFs, morphological experiments and analyses, and electrophysiological experiments and analyses. KM and KH performed electrophysiological experiments and analyses. MY and MW performed immunohistochemical experiments and analyses. All authors contributed to the article and approved the submitted version.
Funding
This study was supported by Grants-in-Aid for Scientific Research (18H04012 and 21H04785 to MK) from the Japan Society for the Promotion of Science (JSPS) and by Grants-in-Aid for Transformative Research Areas (A) (20H05915 to MK) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan.
Acknowledgments
We thank N. Uesaka, Y. Sugaya, S. Fujino, and T. Noro for helpful advice and discussion. We also thank Y. Kato, M. Watanabe-Suzuki, T. Tanaka, K. Akasaka, and K. Aoyama for technical assistance and animal care. Cartoons were created using the software from BioRender.com.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisherās note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
Aiba A. Kano M. Chen C. Stanton M. E. Fox G. D. Herrup K. et al . (1994). Deficient cerebellar long-term depression and impaired motor learning in mGluR1 mutant mice. Cell79, 377ā388. 10.1016/0092-8674(94)90205-4
2
Anderson G. R. Aoto J. Tabuchi K. Fƶldy C. Covy J. Yee A. X. et al . (2015). β-neurexins control neural circuits by regulating synaptic endocannabinoid signaling. Cell162, 593ā606. 10.1016/j.cell.2015.06.056
3
Aricescu A. R. McKinnell I. W. Halfter W. Stoker A. W. (2002). Heparan sulfate proteoglycans are ligands for receptor protein tyrosine phosphatase Ļ. Mol. Cell. Biol.22, 1881ā1892. 10.1128/MCB.22.6.1881-1892.2002
4
Cerminara N. L. Lang E. J. Sillitoe R. V. Apps R. (2015). Redefining the cerebellar cortex as an assembly of non-uniform Purkinje cell microcircuits. Nat. Rev. Neurosci.16, 79ā93. 10.1038/nrn3886
5
Chen L. Y. Jiang M. Zhang B. Gokce O. Südhof T. C. (2017). Conditional deletion of all neurexins defines diversity of essential synaptic organizer functions for neurexins. Neuron94, 611ā625.e4. 10.1016/j.neuron.2017.04.011
6
Choo M. Miyazaki T. Yamazaki M. Kawamura M. Nakazawa T. Zhang J. et al . (2017). Retrograde BDNF to TrkB signaling promotes synapse elimination in the developing cerebellum. Nat. Commun.8, 195. 10.1038/s41467-017-00260-w
7
de Wit J. Ghosh A. (2016). Specification of synaptic connectivity by cell surface interactions. Nat. Rev. Neurosci.17, 22ā35. 10.1038/nrn.2015.3
8
Debant A. Serra-Pages C. Seipel K. O'brien S. Tang M. Parks S. H. et al . (1996). The multidomain protein Trio binds the LAR transmembrane tyrosine phosphatase, contains a protein kinase domain, and has separate rac-specific and rho-specific guanine nucleotide exchange factor domains. Proc. Natl. Acad. Sci. U. S. A.93, 5466ā5471. 10.1073/pnas.93.11.5466
9
Farhy-Tselnicker I. van Casteren A. C. M. Lee A. Chang V. T. Aricescu A. R. Allen N. J. (2017). Astrocyte-secreted glypican 4 regulates release of neuronal pentraxin 1 from axons to induce functional synapse formation. Neuron96, 428ā445.e13. 10.1016/j.neuron.2017.09.053
10
Fujita H. Aoki H. Ajioka I. Yamazaki M. Abe M. Oh-Nishi A. et al . (2014). Detailed expression pattern of aldolase C (Aldoc) in the cerebellum, retina and other areas of the CNS studied in Aldoc-Venus knock-in mice. PLoS ONE9, e86679. 10.1371/journal.pone.0086679
11
Fukai S. Yoshida T. (2021). Roles of type IIa receptor protein tyrosine phosphatases as synaptic organizers. FEBS J.288, 6913ā6926. 10.1111/febs.15666
12
Gokce O. Südhof T. C. (2013). Membrane-tethered monomeric neurexin LNS-domain triggers synapse formation. J. Neurosci.33, 14617ā14628. 10.1523/JNEUROSCI.1232-13.2013
13
Hanawa H. Kelly P. F. Nathwani A. C. Persons D. A. Vandergriff J. A. Hargrove P. et al . (2002). Comparison of various envelope proteins for their ability to pseudotype lentiviral vectors and transduce primitive hematopoietic cells from human blood. Mole. Ther.5, 242ā251. 10.1006/mthe.2002.0549
14
Hashimoto K. Ichikawa R. Kitamura K. Watanabe M. Kano M. (2009a). Translocation of a āwinnerā climbing fiber to the Purkinje cell dendrite and subsequent elimination of ālosersā from the soma in developing cerebellum. Neuron63, 106ā118. 10.1016/j.neuron.2009.06.008
15
Hashimoto K. Kano M. (2003). Functional differentiation of multiple climbing fiber inputs during synapse elimination in the developing cerebellum. Neuron38, 785ā796. 10.1016/S0896-6273(03)00298-8
16
Hashimoto K. Kano M. (2013). Synapse elimination in the developing cerebellum. Cell. Mol. Life Sci.70, 4667ā4680. 10.1007/s00018-013-1405-2
17
Hashimoto K. Miyata M. Watanabe M. Kano M. (2001). Roles of phospholipase Cβ4 in synapse elimination and plasticity in developing and mature cerebellum. Mol. Neurobiol.23, 69ā82. 10.1385/MN:23:1:69
18
Hashimoto K. Tsujita M. Miyazaki T. Kitamura K. Yamazaki M. Shin H. S. et al . (2011). Postsynaptic P/Q-type Ca2+ channel in Purkinje cell mediates synaptic competition and elimination in developing cerebellum. Proc. Natl. Acad. Sci. U. S. A.108, 9987ā9992. 10.1073/pnas.1101488108
19
Hashimoto K. Yoshida T. Sakimura K. Mishina M. Watanabe M. Kano M. (2009b). Influence of parallel fiber-Purkinje cell synapse formation on postnatal development of climbing fiber-Purkinje cell synapses in the cerebellum. Neuroscience162, 601ā611. 10.1016/j.neuroscience.2008.12.037
20
Hawkes R. (2014). Purkinje cell stripes and long-term depression at the parallel fiber-Purkinje cell synapse. Front. Syst. Neurosci.8, 41. 10.3389/fnsys.2014.00041
21
Horn K. E. Xu B. Gobert D. Hamam B. N. Thompson K. M. Wu C. L. et al . (2012). Receptor protein tyrosine phosphatase sigma regulates synapse structure, function and plasticity. J. Neurochem.122, 147ā161. 10.1111/j.1471-4159.2012.07762.x
22
Ichikawa R. Miyazaki T. Kano M. Hashikawa T. Tatsumi H. Sakimura K. et al . (2002). Distal extension of climbing fiber territory and multiple innervation caused by aberrant wiring to adjacent spiny branchlets in cerebellar Purkinje cells lacking glutamate receptor 2. J. Neurosci.22, 8487ā8503. 10.1523/JNEUROSCI.22-19-08487.2002
23
Jan V. Mitchell G. (1998). The anatomy of the cerebellum. Trends Neurosci.12, 370ā375. 10.1016/S0166-2236(98)01318-6
24
Jang H. C. Ryu J. H. Shin K. M. Seo N. young Kim G. H. Huh Y. H. et al . (2019). Gait ignition failure in JNPL3 human tau-mutant mice. Exp. Neurobiol.28, 404ā413. 10.5607/en.2019.28.3.404
25
Kakegawa W. Mitakidis N. Miura E. Abe M. Matsuda K. Takeo Y. H. et al . (2015). Anterograde C1ql1 signaling is required in order to determine and maintain a single-winner climbing fiber in the mouse cerebellum. Neuron85, 316ā329. 10.1016/j.neuron.2014.12.020
26
Kanda Y. (2013). Investigation of the freely available easy-to-use software āEZRā for medical statistics. Bone Marrow Transplant.48, 452ā458. 10.1038/bmt.2012.244
27
Kano M. Hashimoto K. (2009). Synapse elimination in the central nervous system. Curr. Opin. Neurobiol.19, 154ā161. 10.1016/j.conb.2009.05.002
28
Kano M. Hashimoto K. Watanabe M. Kurihara H. Offermanns S. Jiang H. et al . (1998). Phospholipase Cβ4 is specifically involved in climbing fiber synapse elimination in the developing cerebellum. Proc. Nat. Acad. Sci.95, 15724ā15729. 10.1073/pnas.95.26.15724
29
Kawata S. Miyazaki T. Yamazaki M. Mikuni T. Yamasaki M. Hashimoto K. et al . (2014). Global scaling down of excitatory postsynaptic responses in cerebellar purkinje cells impairs developmental synapse elimination. Cell Rep.8, 1119ā1129. 10.1016/j.celrep.2014.07.014
30
Konnerth A. Llanot I. Armstrongt C. M. (1990). Synaptic currents in cerebellar Purkinje cells. Proc. Nat. Acad. Sci.87, 2662ā2665. 10.1073/pnas.87.7.2662
31
Lai E. S. K. Nakayama H. Miyazaki T. Nakazawa T. Tabuchi K. Hashimoto K. et al . (2021). An autism-associated neuroligin-3 mutation affects developmental synapse elimination in the cerebellum. Front. Neural Circuits15, 676891. 10.3389/fncir.2021.676891
32
Lin Y. C. Hsu C. C. H. Wang P. N. Lin C. P. Chang L. H. (2020). The relationship between zebrin expression and cerebellar functions: insights from neuroimaging studies. Front. Neurol.11, 315. 10.3389/fneur.2020.00315
33
Matsuda K. Miura E. Miyazaki T. Kakegawa W. Emi K. Narumi S. et al . (2010). Cbln1 is a ligand for an orphan glutamate receptor Ī“2, a bidirectional synapse organizer. Science328, 363ā368. 10.1126/science.1185152
34
Miyazaki T. Yamasaki M. Hashimoto K. Yamazaki M. Abe M. Usui H. et al . (2012). Cav2.1 in cerebellar Purkinje cells regulates competitive excitatory synaptic wiring, cell survival, and cerebellar biochemical compartmentalization. J. Neurosci.32, 1311ā1328. 10.1523/JNEUROSCI.2755-11.2012
35
Nakamura F. Okada T. Shishikura M. Uetani N. Taniguchi M. Yagi T. et al . (2017). Protein tyrosine phosphatase Ī“ mediates the sema3a-induced cortical basal dendritic arborization through the activation of fyn tyrosine kinase. J. Neurosci.37, 7125ā7139. 10.1523/JNEUROSCI.2519-16.2017
36
Nakayama H. Miyazaki T. Kitamura K. Hashimoto K. Yanagawa Y. Obata K. et al . (2012). GABAergic inhibition regulates developmental synapse elimination in the cerebellum. Neuron74, 384ā396. 10.1016/j.neuron.2012.02.032
37
Park H. Choi Y. Jung H. Kim S. Lee S. Han H. et al . (2020). Splice-dependent trans-synaptic PTP Ī“- IL 1 RAPL 1 interaction regulates synapse formation and non- REM sleep. EMBO J.39, e104150. 10.15252/embj.2019104150
38
Richter K. N. Revelo N. H. Seitz K. J. Helm M. S. Sarkar D. Saleeb R. S. et al . (2018). Glyoxal as an alternative fixative to formaldehyde in immunostaining and super-resolution microscopy. EMBO J.37, 139ā159. 10.15252/embj.201695709
39
Serra-PagĆØs C. Medley Q. G. Tang M. Hart A. Streuli M. (1998). Liptins, a family of LAR transmembrane protein-tyrosine phosphatase- interacting proteins. J. Biol. Chem.273, 15611ā15620. 10.1074/jbc.273.25.15611
40
Shen K. Scheiffele P. (2010). Genetics and cell biology of building specific synaptic connectivity. Annu. Rev. Neurosci.33, 473ā507. 10.1146/annurev.neuro.051508.135302
41
Shen Y. Tenney A. P. Busch S. A. Horn K. P. Cuascut F. X. Liu K. et al . (2009). PTPĻ Is a receptor for chondroitin sulfate proteoglycan, an inhibitor of neural regeneration. Science326, 592ā596. 10.1126/science.1178310
42
Shishikura M. Nakamura F. Yamashita N. Uetani N. Iwakura Y. Goshima Y. (2016). Expression of receptor protein tyrosine phosphatase Ī“, PTPĪ“, in mouse central nervous system. Brain Res.1642, 244ā254. 10.1016/j.brainres.2016.03.030
43
Siddiqui T. J. Craig A. M. (2011). Synaptic organizing complexes. Curr. Opin. Neurobiol.21, 132ā143. 10.1016/j.conb.2010.08.016
44
Spangler S. A. Schmitz S. K. Kevenaar J. T. de Graaff E. de Wit H. Demmers J. et al . (2013). Liprin-α2 promotes the presynaptic recruitment and turnover of RIM1/CASK to facilitate synaptic transmission. J. Cell Biol.201, 915ā928. 10.1083/jcb.201301011
45
Südhof T. C. (2017). Synaptic neurexin complexes: a molecular code for the logic of neural circuits. Cell171, 745ā769. 10.1016/j.cell.2017.10.024
46
Südhof T. C. (2018). Towards an understanding of synapse formation. Neuron.100, 276ā293. 10.1016/j.neuron.2018.09.040
47
Sugihara I. Quy P. N. (2007). Identification of aldolase C compartments in the mouse cerebellar cortex by olivocerebellar labeling. J. Compar. Neurol.500, 1076ā1092. 10.1002/cne.21219
48
Takahashi H. Craig A. M. (2013). Protein tyrosine phosphatases PTPĪ“, PTPĻ, and LAR: presynaptic hubs for synapse organization. Trends Neurosci.36, 522ā534. 10.1016/j.tins.2013.06.002
49
Uemura T. Lee S. J. Yasumura M. Takeuchi T. Yoshida T. Ra M. et al . (2010). Trans-synaptic interaction of GluRĪ“2 and neurexin through Cbln1 mediates synapse formation in the cerebellum. Cell141, 1068ā1079. 10.1016/j.cell.2010.04.035
50
Uesaka N. Abe M. Konno K. Yamazaki M. Sakoori K. Watanabe T. et al . (2018). Retrograde signaling from progranulin to sort1 counteracts synapse elimination in the developing cerebellum. Neuron97, 796ā805.e5. 10.1016/j.neuron.2018.01.018
51
Uesaka N. Mikuni T. Hashimoto K. Hirai H. Sakimura K. Kano M. (2012). Organotypic coculture preparation for the study of developmental synapse elimination in mammalian brain. J. Neurosci.32, 11657ā11670. 10.1523/JNEUROSCI.1097-12.2012
52
Uesaka N. Uchigashima M. Mikuni T. Nakazawa T. Nakao H. Hirai H. et al . (2014). Retrograde semaphorin signaling regulates synapse elimination in the developing mouse brain. Science344, 1020ā1023. 10.1126/science.1252514
53
Uetani N. Kato K. Ogura H. Mizuno K. Kawano K. Mikoshiba K. et al . (2000). Impaired learning with enhanced hippocampal long-term potentiation in PTPĪ“ deficient mice. EMBO J.19, 2775ā2785. 10.1093/emboj/19.12.2775
54
Um J. W. Ko J. (2013). LAR-RPTPs: synaptic adhesion molecules that shape synapse development. Trends Cell Biol.23, 465ā475. 10.1016/j.tcb.2013.07.004
55
Voogd J. (2014). What we do not know about cerebellar systems neuroscience. Front. Syst. Neurosci.8, 227. 10.3389/fnsys.2014.00227
56
Wadiche J. I. Jahr C. E. (2001). Multivesicular release at climbing fiber-Purkinje cell synapses. Neuron32, 301ā313. 10.1016/S0896-6273(01)00488-3
57
Wakita M. Yamagata A. Shiroshima T. Izumi H. Maeda A. Sendo M. et al . (2020). Structural insights into selective interaction between type IIa receptor protein tyrosine phosphatases and Liprin-α. Nat. Commun.11, 649. 10.1038/s41467-020-14516-5
58
Weng Y. L. Liu N. DiAntonio A. Broihier H. T. (2011). The cytoplasmic adaptor protein caskin mediates Lar signal transduction during Drosophila motor axon guidance. J. Neurosci.31, 4421ā4433. 10.1523/JNEUROSCI.5230-10.2011
59
Yoshida T. Yamagata A. Imai A. Kim J. Izumi H. Nakashima S. et al . (2021). Canonical versus non-canonical transsynaptic signaling of neuroligin 3 tunes development of sociality in mice. Nat. Commun.12, 1848. 10.1038/s41467-021-22059-6
60
Yuzaki M. (2018). Two classes of secreted synaptic organizers in the central nervous system. Annu. Rev. Physiol.80, 243ā262. 10.1146/annurev-physiol-021317-121322
Summary
Keywords
synapse elimination, synapse formation, synapse organizer, cerebellum, PTPĪ“, climbing fiber, Purkinje cell
Citation
Okuno Y, Sakoori K, Matsuyama K, Yamasaki M, Watanabe M, Hashimoto K, Watanabe T and Kano M (2023) PTPĪ“ is a presynaptic organizer for the formation and maintenance of climbing fiber to Purkinje cell synapses in the developing cerebellum. Front. Mol. Neurosci. 16:1206245. doi: 10.3389/fnmol.2023.1206245
Received
15 April 2023
Accepted
25 May 2023
Published
22 June 2023
Volume
16 - 2023
Edited by
Catarina Osorio, Erasmus Medical Center, Netherlands
Reviewed by
Aleksandra Badura, Erasmus Medical Center, Netherlands; Martijn Schonewille, Erasmus University Rotterdam, Netherlands
Updates
Copyright
Ā© 2023 Okuno, Sakoori, Matsuyama, Yamasaki, Watanabe, Hashimoto, Watanabe and Kano.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Masanobu Kano mkano-tky@m.u-tokyo.ac.jpTakaki Watanabe wtakaki@m.u-tokyo.ac.jp
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.