Abstract
Background: Intestinal barrier contributes as an important role in maintaining intestinal homeostasis. Oxidative stress can cause critical damages in intestinal integrity of animals.
Objectives: This study was conducted to investigate the alleviated effect of taurine against small intestine (duodenum, jejunum, ileum) injury induced by oxidative stress.
Methods: The piglet model of diquat-induced oxidative stress was employed. In addition, analysis of intestinal morphology, reverse transcription PCR (RT-PCR), and Western blot were used in this study.
Results: Compared with the control group (CON), diquat-induced oxidative stress triggers immune response; the content of immunoglobulin M (IgM) and immunoglobulin G (IgG) was significantly changed, but 0.60% taurine supplementation could restore the level of serum immunoglobulin. Oxidative stress induces serious damage in intestinal morphology structure and tight junction barrier. Compared with the CON, the villus height of intestine was significantly decreased, the crypt depth and villus height/crypt depth (V/C) were also decreased, and 0.60% taurine supplementation could restore impaired morphology and even improve crypt depth and V/C of the jejunum and ileum. Compared with the CON, oxidative stress markedly increased the messenger RNA (mRNA) expression level of claudin-1 and occludin in the duodenum, and the value of occludin was significantly decreased in the jejunum of the diquat group (DIQ). Relative to the DIQ, 0.60% taurine supplementation increased the mRNA expression level of claudin-1, occludin, and ZO-1 in the ileum. Compared with the CON, the expression of claudin-1 protein was significantly upregulated, and occludin and ZO-1 protein were both downregulated in the small intestine of DIQ.
Conclusion: Taurine exerts protective effects by regulating immune response and restores the intestinal tight junction barrier when piglets suffer from oxidative stress.
Introduction
Oxidative stress occurs throughout animal life, with many factors contributing to the induction of oxidative stress, such as birth, weaning, changes in food sources, and transportation (; ; ; ; ). Weaning induces both acute and long-lasting changes in the intestines of piglets, including the shortening of villus height and increasing crypt depth (), as well as reducing digestive enzyme activities (). After weaning for 3 days, the jejunal antioxidant-related genes (Cu–Zn superoxide dismutase, Mn superoxide dismutase, glutathione peroxidase 1, and glutathione peroxidase 4) of piglets are significantly decreased (), and cytokines’ mRNA expression level [tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), and interleukin (IL-6)] are significantly increased; jejunal epithelial permeability are markedly raised (). Diquat is widely used to induce oxidative stress in intestine of piglets (; ; ). Diquat-induced oxidative stress has a negative effect on jejunal and ileal morphology (; ), and it could increase the histopathological grading of the jejunum, ileum, and colon (); the activities of antioxidant enzymes (superoxide dismutase, glutathione peroxidase) and the permeability of jejunal epithelium significantly decrease (). Thus, the weaning period is the time in which piglets experience an increased prevalence of gastrointestinal dysfunctions, which in turn reduces growth performance in pigs and subsequently leads to economic loss ().
Taurine is abundant in muscle tissue but has a low concentration in body fluids, such as serum and urine in pig (; ), and it has varied biological and physiological functions, such as protective and inflammatory roles (; , ). Taurine presents a high level in the small intestine (). Several studies have shown that treatment with taurine has a protective effect on intestinal injuries owing to ischemia–reperfusion and lipopolysaccharides (; ), which is supported by the significant decrease in histological scores and apoptosis indices after ischemia–reperfusion in rats (). In dextran sulfate sodium-induced experimental colitis, taurine supplementation significantly alleviates diarrhea severity in C57BL/6 mice (). In a model of potassium bromate-induced intestinal oxidative injury, taurine exerts an ameliorative effect by improving antioxidant defense and duodenum tissue integrity (). However, some studies have shown that taurine impairs or has no beneficial effect on intestinal growth or on the mucosal structure of broiler chickens (; ). Excessive taurine supplementation (3%) was observed to have adverse effects on diarrhea index, villus height, and crypt depth (). These results suggest that the dose of taurine supplementation used was not suitable in these experiments and that this aspect merits further research.
Normal intestinal function depends on the founding and conservation of a mucosal barrier, which is coated by a monolayer of intestinal epithelial cells. The intestinal mucosal barrier is indispensable for preventing intestinal injury owing to microbiota or undesirable substances (). However, the intestinal barrier is not fully developed at birth (). The formation of tight junctions creates one of the major components of the intestinal barrier (). Occludin was the first identified tight junction protein, whereas claudins are the main proteins that contribute to the physiological and structural paracellular barrier function (). Researchers who have examined the intestinal barrier function mainly focus on the duodenum (), jejunum, and ileum (), as well as on cell lines with H2O2-induced oxidative stress (). In spite of this, there have been a few studies on the use of taurine in piglets. have reported the effect of taurine in the intestinal health of weaned pigs. Moreover, a few studies have collectively examined the duodenum, jejunum, and ileum to examine intestinal barrier function during oxidative stress.
Taking all of this into consideration, it is worthwhile to explore oxidative stress in the livestock industry. A previous study has found that the growth performance was negatively affected (such as reduced food intake, bodyweight, etc.) after diquat challenge (). Taurine supplementation (0.60%) abolished the depression of pig growth performance (unpublished data). Moreover, pigs are comparable to humans in terms of gastrointestinal tract structure and function; thus, these pig nutritional programming studies can provide reference for human nutrition studies (). In our previous study, we found that during oxidative stress, the protein expression of the taurine transporter is significantly increased, whereas it is ameliorated when taurine is added to the small intestines of piglets, and the concentration of taurine in blood is increased in a dose-dependent manner when fed diets contain different taurine content (). However, whether taurine can alleviate the piglets’ intestinal oxidative stress through the restoration of the physiological function of the intestinal mucosa is not clear. Therefore, in this study, we hypothesized that taurine supplementation could alleviate diquat-induced intestinal damages; as such, we investigated the alleviative effects of taurine on piglets with diquat-induced intestinal oxidative stress.
Materials and Methods
Animals and Dieting
This study was conducted according to the Chinese Guidelines for Animal Care Welfare. Protocols were approved by the Committee on Animal Care of the Institute of Subtropical Agriculture, Chinese Academy of Sciences (ethical approval code: ISA-2017-012). Thirty-five weaned piglets were randomly allotted into five groups (n = 7). The control group (CON) was treated with a basic diet and intraperitoneal (ip) injection of isometric sterilized saline. The diquat group (DIQ) was treated with basic diet and ip administration of diquat; the low taurine group (LT) was treated with basic diet + 0.15% taurine and ip administration of diquat; the middle taurine group (MT) was treated with basic diet + 0.30% taurine and ip injection of diquat; and the high taurine group (HT) was treated with basic diet + 0.60% taurine and ip administration of diquat. According to a previous study, supplementing with 0.30% taurine increased the villus height, while 3% taurine supplementation reduced intestinal health of weaned piglets, such as higher diarrhea index, lower villus height, and deeper crypt depths (). The saline or diquat treatments were conducted once at the beginning of the formal experiment. Diquat was purchased from Sigma (CAS Number 6358-62-2) and was dissolved in sterilized saline at a concentration of 9.6 mg/ml. Diquat would evoke vomit; therefore, diquat was administered by intraperitoneal injection. The injection volume was limited to 10 ml as described previously (). The diets were isoenergetic, isonitrogenous, and were ensured to have met the nutritional requirements according to the National Research . The content of taurine in diet was measured according to previous method (). Feed composition is presented in Table 1.
TABLE 1
| Items | Treatment | |||
| CON/DIQ | LT (0.15%) | MT (0.30%) | HT (0.60%) | |
| Ingredient composition (g/100 g) | ||||
| Corn | 64.15 | 64.23 | 64.38 | 64.61 |
| Soybean meal | 19.80 | 19.40 | 19.00 | 18.10 |
| Soybean protein concentrate | 5.00 | 5.00 | 5.00 | 5.00 |
| Dried whey | 4.30 | 4.30 | 4.30 | 4.30 |
| Fish meal | 4.00 | 4.00 | 4.00 | 4.00 |
| Soya bean oil | 0.35 | 0.50 | 0.60 | 0.90 |
| Taurine | 0.00 | 0.15 | 0.30 | 0.60 |
| Lysine | 0.36 | 0.37 | 0.37 | 0.41 |
| Methionine | 0.12 | 0.12 | 0.12 | 0.13 |
| Threonine | 0.09 | 0.10 | 0.10 | 0.11 |
| Tryptophan | 0.01 | 0.01 | 0.01 | 0.02 |
| CaHPO4 | 0.00 | 0.00 | 0.00 | 0.00 |
| Limestone | 0.52 | 0.52 | 0.52 | 0.52 |
| NaCl | 0.30 | 0.30 | 0.30 | 0.30 |
| 1% Premixa | 1.00 | 1.00 | 1.00 | 1.00 |
| Nutrient level (g/100 g) | ||||
| Digestible energy(MJ/kg)b | 14.59 | 14.59 | 14.58 | 14.57 |
| Crude protein | 20.11 | 20.12 | 20.11 | 20.12 |
| SID lysine | 1.24 | 1.23 | 1.23 | 1.24 |
| SID methionine + cysteine | 0.69 | 0.69 | 0.68 | 0.68 |
| SID threonine | 0.73 | 0.74 | 0.73 | 0.73 |
| SID tryptophan | 0.21 | 0.21 | 0.20 | 0.21 |
| Total calcium | 0.49 | 0.48 | 0.48 | 0.48 |
| Total phosphorus | 0.43 | 0.43 | 0.43 | 0.42 |
| Digestible phosphorus | 0.22 | 0.22 | 0.22 | 0.21 |
| Taurinec | 0.02 | 0.13 | 0.27 | 0.56 |
Ingredient and chemical composition of the experimental diet.
aSupplied per kilogram of diet: CuSO4⋅5H2O, 19.8 mg; KI, 0.20 mg; FeSO4⋅7H2O, 400 mg; NaSeO3, 0.56 mg; ZnSO4⋅7H2O, 359 mg; MnSO4⋅H2O, 10.2 mg; vitamin K (menadione), 5 mg; vitamin B1, 2 mg; vitamin B2, 15 mg; vitamin B12, 30 μg; vitamin A, 5,400 IU; vitamin D3, 110 IU; vitamin E, 18 IU; choline chloride, 80 mg; antioxidants, 20 mg; fungicide, 100 mg. bCalculated values, other values are measured. cMeasured values.
Sample Collection
After the feeding period (28 days), blood samples were collected from the overnight fasting piglets by vein puncture. To do this, pigs were electrically stunned (250 V, 0.5 A, 5–6 s) and bled by the exsanguination of the precaval vein. Blood samples were then centrifuged at 3,000 × g for 10 min, after which the supernatants were collected and stored at -80°C until the downstream analyses were performed. Intestinal mucosa samples were cleaned using phosphate-buffered saline (PBS) and were collected using a glass slide. All samples were placed into liquid N2 and stored at -80°C until further analysis.
Serum Immunoglobulin
Serum immunoglobulin A (IgA) (CSB-E13234p), immunoglobulin G (IgG) (CSB-E06804p), and immunoglobulin M (IgM) (CSB-E06805p) levels were determined using an ELISA kit (Cusabio, Wuhan, China). All experiments were performed according to the manufacturer’s instructions. Briefly, we used a serum separator tube, and samples were allowed to clot for 2 h at room temperature before centrifugation for 15 min at 1,000 × g. It was recommended to dilute the serum with 2,000-fold dilution for test IgA and IgM and with 1,000-fold dilution for test IgG. This assay employs the competitive inhibition enzyme immunoassay technique. Then, we used the professional soft “Curve Expert” to make a standard curve. The concentration read from the standard curve were multiplied by the dilution factor.
Analysis of Intestinal Morphology
Small intestine samples (duodenum, jejunum, ileum; 3 cm) were prepared for histological analysis; these were collected and immediately fixed in 4% neutral buffered formalin. Afterward, the samples were seated into paraffin blocks, and three cross-sections for each sample were cut into 6-μm-thick sections and stained with H&E. Villus height and crypt depth were measured from at least 12 well-oriented crypt–villus units by upright fluorescence microscopy using a model BX51 microscope (Olympus, Tokyo, Japan), as previously described ().
RNA Extraction and Real-Time RT-PCR
Reverse transcription and real-time quantitative PCR (RT-qPCR) were performed as previously described (; ). TRIzol reagent (Invitrogen-Life Technologies, CA, United States) was used for total RNA extraction. Premixed TaqTM DNA Polymerase (TaKaRa, Otsu, Japan) was used for PCR analysis. RT-PCR was performed by Roche LightCycler 480 II (Roche, Basel, Switzerland). The messenger RNA (mRNA) expression levels of the target genes were determined by the 2–ΔΔCt method, using the following formula: [ΔΔCt = (Ctgene of interest – Ctβ–actin)treated – (Ctgene of interest - Ctβ–actin)untreated] (). β-Actin housekeeping gene was used as an internal control to normalize target gene transcript levels. Primers for the selected genes (Table 2) were designed using the Primer 5.0 software.
TABLE 2
| Genes | Primer (from 5′ to 3′) | Product size (bp) | Accession no. |
| Claudin-1 | F:CTCAATACAGGAGGGAAGCCA | 91 | NM-001244539.1 |
| R: ATATTTAAGGACCGCCCTCTCC | |||
| Occludin | F: TCAGGTGCACCCTCCAGATT | 167 | NM-001163647.2 |
| R: TGTCGTTGCTGGGTGCATAA | |||
| ZO-1 | F:ACCATGTCTTGAAGCAGCCA | 103 | XM-021098896.1 |
| R: GCCTGTCTCTCCATGTACGG | |||
| β-actin | F:CTGCGGCATCCACGAAACT | 147 | XM-021086047.1 |
| R: AGGGCCGTGATCTCCTTCTG |
Characteristics of the primers used for real-time PCR analysis.
ZO-1, zonula occludens-1.
Western Blotting Analysis
Relative protein levels for the tight junction proteins ZO-1, claudin-1, and occludin in the small intestine were determined using Western blot (; ). Protein content of intestine samples was detected by BCA Protein Assay Kit according to the manufacturer’s instructions (Beyotime, Shanghai, China). The resultant signals were obtained using the AlphaImager 2200 software (Alpha Innotech Corporation., San Leandro, CA, United States). The primary antibodies used in this experiment are ZO-1 (#21773-1-AP) at a dilution of 1:700, claudin-1 (#13050-1-AP) at a dilution of 1:500, and occludin (#66378-1-Ig) at a dilution of 1:1,000, and β-actin (#60008-1-Ig) at a dilution of 1:5,000, which were all purchased from Proteintech Group (Chicago, IL, United States).
Statistical Analysis
The data were analyzed using one-way analysis of variance (ANOVA) and Duncan’s multiple range test (SAS 8.2). Data were expressed as mean ± SEM. Values in the same row marked with different letters are significantly different (P < 0.05).
Results
Serum Immunoglobin
The results of serum immunoglobin analysis are presented in Figure 1. Compared with CON, diquat-induced oxidative stress significantly decreased the IgM level and significantly increased IgG (P < 0.05). Compared with DIQ, taurine supplementation was able to restore the IgA levels with no dose effect. Compared with DIQ, IgM levels were significantly increased in MT and HT (P < 0.05), whereas IgG levels were significantly decreased in MT and HT (P < 0.05).
FIGURE 1
Morphology
Figure 2 shows intestinal HE staining results (duodenum, jejunum, and ileum) of piglets with diquat-induced oxidative stress and taurine supplementation. Our results showed that supplementation with taurine could alleviate the intestinal injury to some extent.
FIGURE 2
Figure 3 shows the measured values of intestinal villus height, crypt depth, and V/C ratio. Compared with CON, the villus height of the small intestine (duodenum, jejunum, and ileum) were significantly decreased in DIQ (P < 0.05); furthermore, we found that 0.60% taurine supplementation (HT) could restore the villus height of the small intestine. Compared with CON, the crypt depth of duodenum was significantly increased in DIQ (P < 0.05). Compared with DIQ, 0.60% taurine supplementation could effectively decrease crypt depth in the small intestine (P < 0.05). Compared with CON, V/C ratio was significantly decreased in DIQ, and compared with DIQ, 0.60% taurine supplementation was found to improve V/C ratio (P < 0.05).
FIGURE 3
Tight Junction mRNA Expression
The mRNA expression levels of claudin-1, occludin, and ZO-1 in the intestinal mucosa (duodenum, jejunum, and ileum) are presented in Figure 4. Compared with CON, the expression of claudin-1 and occludin were significantly increased in DIQ in the duodenum; however, they had no difference in the taurine supplementation group (P < 0.05). Compared with CON, the expression of occludin was significantly decreased in DIQ in the jejunum (P < 0.05). Compared with DIQ, the expression of claudin-1, occludin, and ZO-1 were significantly increased in the HT in the ileum (P < 0.05).
FIGURE 4
Tight Junction Protein Expression
The protein expression levels of claudin-1, occludin, and ZO-1 in the intestinal mucosa (duodenum, jejunum, and ileum) are presented in Figure 5. Compared with CON, the expression of claudin-1 was significantly upregulated in DIQ in the intestine (duodenum, jejunum, and ileum) (P < 0.05). Furthermore, compared with DIQ, taurine supplementation significantly downregulated the expression of claudin-1 in the duodenum, and jejunum (P < 0.05). Compared with CON, the expression of occludin and ZO-1 were significantly downregulated in DIQ in the intestine (duodenum, jejunum, and ileum) (P < 0.05). Compared with DIQ, taurine supplementation could significantly upregulate the expression of occludin in the intestine (duodenum, jejunum, and ileum), with the exception of LT in the jejunum (P < 0.05). Lastly, taurine supplementation was observed to elevate the ZO-1 expression in the intestine; however, the data were not significantly different (P > 0.05).
FIGURE 5
Discussion
Weaning piglets frequently suffer from oxidative stress, which impairs growth and intestinal development (; ; ). Taurine is known to exert a protective effect after damage (). Our results indicated that oxidative stress triggers an aberrant immune response and has negative effects on intestinal morphology and tight junction barriers. Supplementation with taurine is an effective therapy for recovering, maintaining, or enhancing barrier function in diquat-induced intestinal injury.
Diquat is a toxin that affects cell survival and immune response (; ), whereas immunoglobulins play vital roles in mediating immune responses. Serum immunoglobulins include IgA, IgM, and IgG. The B and T cells were exposed to antigen and eventually swallowed and thus delivered to lymphoid cells; the B cells mature into plasma cells and secrete immunoglobulins (). The immunoglobulin (IgA, IgG, and IgM) levels of the piglets were measured from the serum. IgG is the major serum immunoglobulin involved in mediating a protective inflammatory response (); oxidative stress might play a role in the elevation of serum IgG (). IgA mediates a variety of protective functions and has both anti- and proinflammatory effects (). Natural IgM has a primary function of protecting against a range of bacterial and fungal infections (). Adult male workers exposed to insecticides have lower levels of IgG and IgM and higher levels of cytokines (), which is consistent with our results. Immunoglobulin production is regulated by the nuclear factor kappa B (NF-κB) signaling pathway; it is concluded that oxidative-stress-induced activation of NF-κB signal pathway plays a possible role in the increase in serum immunoglobulin content (). It is suggested that oxidative stress alters the immune response, whereas taurine reverses these immunological abnormalities.
Physical barriers serve as the first line of defense against pathogenic agents in the external environment of the intestine (). Following infection with Escherichia coli, cytokine expression of IL-1β, IL-6, TNF-α, and IL-10 in the intestinal mucosa significantly increases (), resulting in piglets having greater villous atrophy and intestinal morphology disruption (). Weaning is related to villus atrophy and crypt hyperplasia (), and it is known that the small intestine crypt depth is increased starting from 3 to 7 days postweaning (). On the other hand, dietary taurine has various effects on intestinal health. A study in chickens has shown that, when supplemented with 0.5 g/kg of taurine, the jejunum and ileum villi have impaired development and the relative height of the intestinal mucosa decreases (). Dietary supplementation of 0.3% taurine increases villus height, whereas 3% taurine increases diarrhea index and crypt depth and reduces villus height over that of the control (). Thus, this study suggests that an appropriate dosage of taurine supplementation can benefit intestinal health. Supplementation with 60 mg/kg BW taurine significantly increased taurine concentration in the intestinal fluids of chickens (). Diquat significantly increases the content of reactive oxygen species, which could activate the mitophagy and proapoptotic-related signal pathway during intestinal injury (; ). In our study, we observed that oxidative stress impaired the development of the small intestinal morphology, shortened the villus height, decreased the ratio of V/C, and caused a negative effect on the crypt depth in the duodenum. Interestingly, we found that supplementation with 0.60% taurine increases villus height in the jejunum and ileum. Our results are consistent with those of a previous study that compared taurine-treated rats with ischemia–reperfusion animals, in which taurine caused a significant increase in villus height in the jejunum and ileum (). Our data suggested that taurine potentially has a positive effect on intestinal damages induced by diquat.
Tight junctions form a cytoplasmic surface barrier between epithelial cells, play a central role in separating tissue compartments, and function in maintaining cellular polarity (). In the animal model of diquat-induced oxidative stress, the concentration of TNF-α and IL-6 are significantly increased (; ), which was consistent with our previous results (unpublished data). Oxidative stress is a chronic inflammation, and it makes the intestine more susceptible to pathogens (). Intestinal epithelial cells promote the appropriate immune response against enteric pathogens and modulate immune response at the intestinal barrier and promote the maintenance of intestinal orchestration (). Cytokines modulate tight junction protein expression in a protein-specific manner. Researchers have shown that TNF-α causes an increase in intestinal epithelial tight junction permeability (; ). TNF-α induces a downregulation of claudin-1, occludin, and ZO-1 protein expression in Caco-2 cells (). Proinflammatory cytokine IL-1β does not change ZO-1 protein expression but instead induces a progressive downregulation of occludin protein expression and an upregulation in claudin-1 protein expression in Caco-2 monolayers (). In this study, we found that the protein expression of claudin-1 was significantly increased in DIQ in the small intestine, while the mRNA expression level of claudin-1 was increased in the duodenum. Whether this phenomenon was induced by inflammatory cytokines still requires further investigation. Interestingly, our results showed that taurine supplementation downregulated claudin-1 protein expression in the duodenum and jejunum, low-dose taurine (0.15%) down-regulated claudin-1 protein expression, while middle- (0.30%) and high-dose (0.60%) taurine had no effect on claudin-1 protein expression in the ileum. Heat stress was found to increase occludin protein expression but had no effect on claudin-1 protein expression in the ileum of growing pigs (). Our results showed that oxidative stress had negative effects on occludin and ZO-1 protein expression in the small intestine, which is consistent with the results of a previous study (). Furthermore, we found that the mRNA expression level of occludin increased, which may be related to a compensatory effect. Taurine supplementation could restore occludin and ZO-1 protein expression in the duodenum and ileum, and this did not exhibit dose dependence. However, a low dose (0.15%) of taurine had no effect on occludin and ZO-1 protein expression in the jejunum, which is consistent with jejunal occludin mRNA expression results. Lastly, the negative effect exerted on the intestinal tight barrier by oxidative stress was ameliorated by taurine.
Under oxidative stress condition, the content of taurine decreases in urine (), suggesting that the reabsorption of taurine is improved. Lipopolysaccharide-induced inflammation has no effect on the concentration of taurine in serum and intestinal fluids (; ). However, the transportation of taurine is enhanced in the intestine. Cysteine dioxygenase (CDO) and cysteinesulfinate decarboxylase (CSD) are the two limited enzymes in taurine biosynthesis pathway of the liver, and its protein expression level is changed in a contrary way (, ). Taking together, these results indicated that oxidative stress could lead to taurine redistribution in tissues and fluids. The synthesis of taurine was also changed in the liver.
Conclusion
In conclusion, taurine could alleviate intestinal injury through the restoration of the intestinal morphology and tight junction barrier, with 0.60% taurine supplementation being a suitable dose. Our study provided a nutritional strategy for intestinal health. Further study is warranted to elucidate the intestinal permeability, inflammation, and immune responses that contribute to the intestinal pathologies that resulted from oxidative stress.
Statements
Data availability statement
All relevant data is contained within the manuscript.
Ethics statement
The animal study was reviewed and approved by the Committee on Animal Care of the Institute of Subtropical Agriculture, Chinese Academy of Sciences (ethical approval code: ISA-2017-012).
Author contributions
CW contributed to the conceptualization, the methodology, the formal analysis, the investigation, the data curation, and the writing of the original draft. QG contributed to the methodology, the data curation, and the investigation. WW contributed to the methodology. YD contributed to the methodology and the investigation. LZ contributed to the investigation. JL and SH contributed to the supervision. WC contributed to the methodology. FL contributed to the resource, the review and editing aspect of the writing, the visualization, the supervision, and the project administration. All authors have read and approved the manuscript.
Funding
This study was supported by the National Key R&D Program (2018YFD0500405), the Science and Technology Projects of Changsha City (kq1801059), the Youth Innovation Team Project of ISA, CAS (2017QNCXTD_ZCS), and the Earmarked Fund for China Agriculture Research System (CARS-35).
Acknowledgments
We would like to thank Editage (www.editage.cn) for the English language editing.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Abbreviations
- IgA
immunoglobulin A
- IgG
immunoglobulin G
- IgM
immunoglobulin M
- V/C
villus height/crypt depth.
References
1
AhmadM. K.KhanA. A.AliS. N.MahmoodR. (2015). Chemoprotective effect of taurine on potassium bromate-induced DNA damage, DNA-protein cross-linking and oxidative stress in rat intestine.PLoS One10:e0119137. 10.1371/journal.pone.0119137
2
BoudryG.PeronV.Le Huerou-LuronI.LallesJ. P.SeveB. (2004). Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine.J. Nutr.1342256–2262. 10.1093/jn/134.9.2256
3
CampbellJ. M.CrenshawJ. D.PoloJ. (2013). The biological stress of early weaned piglets.J. Anim. Sci. Biotechnol.4:19. 10.1186/2049-1891-4-19
4
CaoS.WuH.WangC.ZhangQ.JiaoL.LinF.et al (2018). Diquat-induced oxidative stress increases intestinal permeability, impairs mitochondrial function, and triggers mitophagy in piglets.J. Anim. Sci.961795–1805. 10.1093/jas/sky104
5
ConleyM. E.DelacroixD. L. (1987). Intravascular and mucosal immunoglobulin A: two separate but related systems of immune defense?Ann. Intern. Med.106892–899. 10.7326/0003-4819-106-6-892
6
CouncilN. R. (2012). Nutrients Requirements of Swine.Washington, DC: National Academy Press.
7
DengQ.XuJ.YuB.HeJ.ZhangK.DingX.et al (2010). Effect of dietary tea polyphenols on growth performance and cell-mediated immune response of post-weaning piglets under oxidative stress.Arch. Anim. Nutr.6412–21. 10.1080/17450390903169138
8
DuanY.ZengL.LiF.WangW.LiY.GuoQ.et al (2017). Effect of branched-chain amino acid ratio on the proliferation, differentiation, and expression levels of key regulators involved in protein metabolism of myocytes.Nutrition368–16. 10.1016/j.nut.2016.10.016
9
EhrensteinM. R.NotleyC. A. (2010). The importance of natural IgM: scavenger, protector and regulator.Nat. Rev. Immunol.10778–786. 10.1038/nri2849
10
Elkouby-NaorL.Ben-YosefT. (2010). Functions of Claudin tight junction proteins and their complex interactions in various physiological systems.Int. Rev. Cel. Mol. Biol.2791–32. 10.1016/S1937-6448(10)79001-79008
11
EwaschukJ. B.MurdochG. K.JohnsonI. R.MadsenK. L.FieldC. J. (2011). Glutamine supplementation improves intestinal barrier function in a weaned piglet model of Escherichia coli infection.Br. J. Nutr.106870–877. 10.1017/S0007114511001152
12
GuC.QuH.HanL.SongX.ZhaoL.LuW. (2011). The effect of raw soybean on oxidative status of digestive organs in mice.Int. J. Mol. Sci.128836–8845. 10.3390/ijms12128836
13
GuilloteauP.ZabielskiR.HammonH. M.MetgesC. C. (2010). Nutritional programming of gastrointestinal tract development. Is the pig a good model for man?Nutr. Res. Rev.234–22. 10.1017/S0954422410000077
14
GuoQ.LiF.DuanY.WenC.WangW.ZhangL.et al (2019). Oxidative stress, nutritional antioxidants and beyond.Sci. China Life Sci.[Online ahead of print]
15
HedemannM. S.HojsgaardS.JensenB. B. (2003). Small intestinal morphology and activity of intestinal peptidases in piglets around weaning.J. Anim. Physiol. Anim. Nutr.8732–41. 10.1046/j.1439-0396.2003.00405.x
16
HuC.XiaoK.LuanZ.SongJ. (2013). Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs.J. Anim. Sci.911094–1101. 10.2527/jas.2012-5796
17
HuangC.GuoY.YuanJ. (2014). Dietary taurine impairs intestinal growth and mucosal structure of broiler chickens by increasing toxic bile acid concentrations in the intestine.Poult. Sci.931475–1483. 10.3382/ps.2013-03533
18
HuxtableR. J. (1992). Physiological actions of taurine.Physiol. Rev.72101–163. 10.1152/physrev.1992.72.1.101
19
HuxtableR. J.LippincottS. E. (1982). Relative contribution of diet and biosynthesis to the taurine content of the adult rat.Drug Nutr. Interact.1153–168.
20
KanekoY.NimmerjahnF.RavetchJ. V. (2006). Anti-inflammatory activity of immunoglobulin G resulting from Fc sialylation.Science313670–673. 10.1126/science.1129594
21
LiF.DuanY.LiY.TangY.GengM.OladeleO. A.et al (2015). Effects of dietary n-6:n-3 PUFA ratio on fatty acid composition, free amino acid profile and gene expression of transporters in finishing pigs.Br. J. Nutr.113739–748. 10.1017/S0007114514004346
22
LiuY.MaoX.YuB.HeJ.ZhengP.YuJ.et al (2014). Excessive dietary taurine supplementation reduces growth performance, liver and intestinal health of weaned pigs.Livest. Sci.168109–119. 10.1016/j.livsci.2014.08.014
23
LuT.PiaoX.ZhangQ.WangD.PiaoX.KimS. W. (2010). Protective effects of Forsythia suspensa extract against oxidative stress induced by diquat in rats.Food Chem. Toxicol.48764–770. 10.1016/j.fct.2009.12.018
24
LuoZ.ZhuW.GuoQ.LuoW.ZhangJ.XuW.et al (2016). Weaning induced hepatic oxidative stress, apoptosis, and aminotransferases through MAPK signaling pathways in piglets.Oxid. Med. Cell Longev.2016:4768541. 10.1155/2016/4768541
25
MaR. M. A.MaT. Y. (2007). IL-1 causes an increase in intestinal epithelial tight junction permeability.J. Immunol.1784641–4649. 10.4049/jimmunol.178.7.4641
26
MaT. Y.BoivinM. A.YeD.PedramA.SaidH. M. (2005). Mechanism of TNF-α modulation of Caco-2 intestinal epithelial tight junction barrier: role of myosin light-chain kinase protein expression.Am. J. Physiol. Gastr. L288G422–G430. 10.1152/ajpgi.00412.2004
27
MaT. Y.IwamotoG. K.HoaN. T.AkotiaV.PedramA.BoivinM. A.et al (2004). TNF-alpha-induced increase in intestinal epithelial tight junction permeability requires NF-kappa B activation.Am. J. Physiol. Gastr. L286G367–G376. 10.1152/ajpgi.00173.2003
28
MaoX.LvM.YuB.HeJ.ZhengP.YuJ.et al (2014). The effect of dietary tryptophan levels on oxidative stress of liver induced by diquat in weaned piglets.J. Anim. Sci. Biotechnol.5:49. 10.1186/2049-1891-5-49
29
MarcinkiewiczJ.KontnyE. (2014). Taurine and inflammatory diseases.Amino Acids467–20. 10.1007/s00726-012-1361-1364
30
MecdadA. A.AhmedM. H.ElHalwagyM. E. A.AfifyM. M. M. (2011). A study on oxidative stress biomarkers and immunomodulatory effects of pesticides in pesticide-sprayers.Egyp. J. Forensic Sci.193–98. 10.1016/j.ejfs.2011.04.012
31
MiticL. L.Van ItallieC. M.AndersonJ. M. (2000). Molecular physiology and pathophysiology of tight junctions I. Tight junction structure and function: lessons from mutant animals and proteins.Am. J. Physiol. Gastr. L279G250–G254. 10.1152/ajpgi.2000.279.2.G250
32
MontagneL.BoudryG.FavierC.Le Huerou-LuronI.LallesJ. P.SeveB. (2007). Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning.Br. J. Nutr.9745–57. 10.1017/S000711450720580X
33
NandakumarD. N.KonerB. C.VinayagamoorthiR.NandaN.NegiV. S.GoswamiK.et al (2008). Activation of NF-kappaB in lymphocytes and increase in serum immunoglobulin in hyperthyroidism: possible role of oxidative stress.Immunobiology213409–415. 10.1016/j.imbio.2007.10.005
34
NisarR.HansonP. S.HeL.TaylorR. W.BlainP. G.MorrisC. M. (2015). Diquat causes caspase-independent cell death in SH-SY5Y cells by production of ROS independently of mitochondria.Arch. Toxicol.891811–1825. 10.1007/s00204-015-1453-1455
35
OlasK.ButterweckH.TeschnerW.SchwarzH. P.ReipertB. (2005). Immunomodulatory properties of human serum immunoglobulin A: anti-inflammatory and pro-inflammatory activities in human monocytes and peripheral blood mononuclear cells.Clin. Exp. Immunol.140478–490. 10.1111/j.1365-2249.2005.02779.x
36
PearceS. C.ManiV.BoddickerR. L.JohnsonJ. S.WeberT. E.RossJ. W.et al (2013). Heat stress reduces intestinal barrier integrity and favors intestinal glucose transport in growing pigs.PLoS One8:e70215. 10.1371/journal.pone.0070215
37
PetersonL. W.ArtisD. (2014). Intestinal epithelial cells: regulators of barrier function and immune homeostasis.Nat. Rev. Immunol.14141–153. 10.1038/nri3608
38
PitmanR. S.BlumbergR. S. (2000). First line of defense: the role of the intestinal epithelium as an active component of the mucosal immune system.J. Gastroenterol.35805–814. 10.1007/s005350070017
39
PluskeJ. R.HampsonD. J.WilliamsI. H. (1997). Factors influencing the structure and function of the small intestine in the weaned pig: a review.Livestock Product. Sci.51215–236. 10.1016/s0301-6226(97)00057-52
40
RouwetE. V.HeinemanE.BuurmanW. A.ter RietG.RamsayG.BlancoC. E. (2002). Intestinal permeability and carrier-mediated monosaccharide absorption in preterm neonates during the early postnatal period.Pediatr. Res.5164–70. 10.1203/00006450-200201000-200201012
41
ShimizuM.ZhaoZ.IshimotoY.SatsuH. (2009). Dietary taurine attenuates dextran sulfate sodium (DSS)-induced experimental colitis in mice.Adv. Exp. Med. Biol.643265–271. 10.1007/978-0-387-75681-3_27
42
SukhotnikI.AranovichI.Ben ShaharY.BittermanN.PollakY.BerkowitzD.et al (2016). Effect of taurine on intestinal recovery following intestinal ischemia-reperfusion injury in a rat.Pediatr. Surg. Int.32161–168. 10.1007/s00383-015-3828-3823
43
TianT.WangZ.ZhangJ. (2017). Pathomechanisms of oxidative stress in inflammatory bowel disease and potential antioxidant therapies.Oxid. Med. Cell Longev.2017:4535194. 10.1155/2017/4535194
44
WangN.WangG.HaoJ.MaJ.WangY.JiangX.et al (2012). Curcumin Ameliorates hydrogen peroxide-induced epithelial barrier disruption by upregulating Heme Oxygenase-1 expression in human intestinal epithelial cells.Digest. Dis. Sci.571792–1801. 10.1007/s10620-012-2094-2097
45
WenC.LiF.DuanY.GuoQ.WangW.ZhangL.et al (2019). Dietary taurine regulates free amino acid profiles and taurine metabolism in piglets with diquat-induced oxidative stress.J. Funct. Foods62:103569. 10.1016/j.jff.2019.103569
46
WenC.LiF.ZhangL.DuanY.GuoQ.WangW.et al (2018). Taurine is involved in energy metabolism in muscle, adipose tissue, and Liver.Mol. Nutr. Food Res.63:e1800536. 10.1002/mnfr.201800536
47
WillottE.BaldaM. S.FanningA. S.JamesonB.Van ItallieC.AndersonJ. M. (1993). The tight junction protein ZO-1 is homologous to the Drosophila discs-large tumor suppressor protein of septate junctions.Proc. Natl. Acad. Sci. U.S.A.907834–7838. 10.1073/pnas.90.16.7834
48
XiaoM.MiY.LiuL.LvC.ZengW.ZhangC.et al (2018). Taurine regulates mucosal barrier function to alleviate lipopolysaccharide-induced duodenal inflammation in chicken.Amino Acids501637–1646. 10.1007/s00726-018-2631-2636
49
YiG. F.CarrollJ. A.AlleeG. L.GainesA. M.KendallD. C.UsryJ. L.et al (2005). Effect of glutamine and spray-dried plasma on growth performance, small intestinal morphology, and immune responses of Escherichia coli K88+-challenged weaned pigs.J. Anim. Sci.83634–643. 10.2527/2005.833634x
50
YinJ.WuM.XiaoH.RenW.DuanJ.YangG.et al (2014). development of an antioxidant system after early weaning in piglets.J. Anim. Sci.92612–619. 10.2527/jas2013-6986
51
YuanD.HussainT.TanB.LiuY.JiP.YinY. (2017). The Evaluation of antioxidant and anti-inflammatory effects of Eucommia ulmoides flavones using diquat-challenged piglet models.Oxid. Med. Cell Longev.2017:8140962. 10.1155/2017/8140962
52
YuanJ.WangZ. (2010). Effect of taurine on intestinal morphology and utilisation of soy oil in chickens.Br. Poult. Sci.51540–545. 10.1080/00071668.2010.506984
53
ZhangF.TongL.QiaoH.DongX.QiaoG.JiangH.et al (2008). Taurine attenuates multiple organ injury induced by intestinal ischemia reperfusion in rats.J. Surg. Res.149101–109. 10.1016/j.jss.2007.12.781
54
ZhouY.WangQ.Mark EversB.ChungD. H. (2006). Oxidative stress-induced intestinal epithelial cell apoptosis is mediated by p38 MAPK.Biochem. Biophys. Res. Commun.350860–865. 10.1016/j.bbrc.2006.09.103
Summary
Keywords
immune response, oxidative stress, taurine, tight junction barrier, weaned piglets
Citation
Wen C, Guo Q, Wang W, Duan Y, Zhang L, Li J, He S, Chen W and Li F (2020) Taurine Alleviates Intestinal Injury by Mediating Tight Junction Barriers in Diquat-Challenged Piglet Models. Front. Physiol. 11:449. doi: 10.3389/fphys.2020.00449
Received
31 January 2020
Accepted
09 April 2020
Published
28 May 2020
Volume
11 - 2020
Edited by
Kusum K. Kharbanda, University of Nebraska Medical Center, United States
Reviewed by
Caihong Hu, Zhejiang University, China; Zhaolai Dai, China Agricultural University, China
Updates
Copyright
© 2020 Wen, Guo, Wang, Duan, Zhang, Li, He, Chen and Li.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Fengna Li, lifengna@isa.ac.cn
This article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.