CORRECTION article
Front. Physiol.
Sec. Invertebrate Physiology
Volume 16 - 2025 | doi: 10.3389/fphys.2025.1654902
Correction: Functional Characterization of Olfactory Proteins Involved in Chemoreception of Galeruca daurica
Provisionally accepted
- 1Inner Mongolia Agricultural University, Hohhot, China
- 2Inner Mongolia Forestry and Grassland Pest Control and Quarantine Station, Hohhot, China
Select one of your emails
You have multiple emails registered with Frontiers:
Notify me on publication
Please enter your email address:
If you already have an account, please login
You don't have a Frontiers account ? You can register here
Correction on: Li L, Zhang W-B, Shan Y-M, Zhang Z-R and Pang B-P ( 2021) Functional Characterization of Olfactory Proteins Involved in Chemoreception of Galeruca daurica. Front. Physiol. 12:678698. doi: 10.3389/fphys.2021.678698 File Table S4 was erroneously published with the original version of this paper. The primers of GFP were listed as "Forward primer: TAATACGACTCACTATAGGGCATGGCCAACACTTGTCACTACTTT, Reverse primer: TAATACGACTCACTATAGGGGTGGACAGGTAATGGTTGTCTGGTA". The file has now been replaced. The correct primers of GFP are "Forward primer:TAATACGACTCACTATAGGGCACAAGTTCAGCGTGTCCG, Reverse primer: TAATACGACTCACTATAGGGTTCACCTTGATGCCGTTC". The original version of this article has been updated.
Keywords: Galeruca daurica, Odorant-binding protein, Chemosensory protein, Fluorescence binding assay, RNA Interference, Electroantennogram
Received: 27 Jun 2025; Accepted: 04 Jul 2025.
Copyright: © 2025 Li, Zhang, Shan, Zhang and Pang. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
* Correspondence: Bao-Ping Pang, Inner Mongolia Agricultural University, Hohhot, China
Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.