ORIGINAL RESEARCH article

Front. Plant Physiol., 19 September 2025

Sec. Plant Morphogenesis and Evolution

Volume 3 - 2025 | https://doi.org/10.3389/fphgy.2025.1657264

MYB4 and HY5 integrate light and cytokinin signaling pathways during Arabidopsis seedling development

  • Department of Biotechnology, National Institute of Technology, Durgapur, India

Abstract

Arabidopsis seedling growth is regulated by integration of various environmental and hormonal signals. While the interactions between light and cytokinin signaling pathways have been studied, the molecular mechanism by which their interaction regulate hypocotyl elongation remain unclear. In this study, we demonstrate that MYB4, a positive regulator of photomorphogenesis, physically interacts with HY5 and attenuates HY5-mediated regulation of MYB4. The expression of MYB4 is induced by different wavelengths of light and it genetically interacts with HY5 to regulate hypocotyl length during light-mediated seedling development. The MYB4 and HY5 mediated regulation of hypocotyl length is altered upon cytokinin treatment in a light intensity-dependent manner. Furthermore, on contrary to the light signals, cytokinin suppresses MYB4 expression. MYB4 together with HY5 regulates the expression of the key genes such as ABCG14, ARR4, and CHS involved in cytokinin signaling pathway. Taken together, this study highlights how the HY5-MYB4 module integrates light and cytokinin signals to fine-tune Arabidopsis seedling development.

Introduction

Plants, as photoautotrophs, are highly sensitive to their light environment. Light plays a crucial role not only as an energy source for photosynthesis but also in influencing various developmental and physiological processes throughout the plant’s life cycle. These processes include seed germination, seedling photomorphogenesis, photoperiodic responses, shade avoidance, and flowering (; Sullivan and Deng, 2003; ; ; ; ). Plants have evolved with a sophisticated sensory network that monitors key aspects of their illuminated environment, including light intensity, quality, duration, and direction (). These various light signals are detected by at least five classes of wavelength-specific photoreceptors, including phytochromes (PHYA-PHYE), cryptochromes (CRY1 and CRY2), phototropins (PHOT1 and PHOT2), F-box-containing flavin-binding proteins (ZTL, FKF1, and LKP2), and UV-B RESISTANCE LOCUS 8 (UVR8) (). These photoreceptors are biologically activated by different light signals, leading to widespread transcriptional reprogramming at the genome level ().

Extensive genetic and biochemical research has shown that the ELONGATED HYPOCOTYL5 (HY5), a bZIP transcription factor, is a key regulator of light-responsive transcriptional changes. HY5 primarily binds to ACGT-containing cis-elements (such as the G-box and T/G-box) of numerous target genes, thereby modulating various light-regulated physiological and developmental processes in plants (, ; Zhang et al., 2011). Mutant seedlings lacking HY5 function exhibit significantly elongated hypocotyls under different light conditions (), indicating that HY5 operates downstream of multiple photoreceptors to promote photomorphogenesis. In addition to inhibiting hypocotyl elongation, HY5 also regulates various other physiological and developmental processes, including root growth, pigment biosynthesis and accumulation, responses to various hormonal signals, and adaptation to low and high temperatures (; ; Wang et al., 2021). Similar to HY5, CAM7 (Calmodulin7), also known as Z-box binding factors 3 (ZBF3) (; ) acts as transcription factor and directly interacts with promoters of several light-inducible genes (; ). Previous studies have demonstrated that CAM7 physically interacts with HY5 to enhance the activity of the HY5 promoter and promote photomorphogenesis (; ). More recently, a yeast two-hybrid screen using CAM7 as bait identified MYB4 as one of its interacting partners. CAM7 also interacts genetically with MYB4 to control the hypocotyl length during Arabidopsis seedling development. Additionally, it was reported that both HY5 and CAM7 bind to the promoter of MYB4 and positively regulate its expression ().

The MYB protein family encompasses a large group of transcription factors that play roles in various plant-specific processes (). MYB4, a well-studied member of the R2R3-MYB subfamily, is known for regulating the phenylpropanoid metabolic pathway, which contributes to UV-B light resistance (; Zhao et al., 2007; ; Zhou et al., 2015; Wang et al., 2019). MYB4 functions as a transcriptional repressor by directly targeting the expression of C4H (encodes cinnamate 4-hydroxylase, a crucial enzyme in the biosynthesis of sinapate esters), and AtMYB7, another transcriptional repressor of several flavonoid biosynthesis genes. MYB4 is expressed in various organs of adult plants, including roots, stems, leaves, and flowers (). Studies on light-mediated regulation of MYB4 expression in rosette leaves have shown that it is expressed in darkness and is induced under various wavelengths of light, including white, blue, and UV light (). MYB4 has also been found to directly influence flavonoid biosynthesis by repressing the expression of ADT6 (AROGENATE DEHYDRATASE 6) and interfering with the transcriptional activity of MBW (composed of MYB, bHLH, and WD40 proteins) complexes through interaction with bHLH transcription factors (; Xu et al., 2014; Wang et al., 2019). More recently, it has been shown that the N-terminal MYB domains of MYB4 play a role in its stability and folding under thermal stress in Arabidopsis thaliana ().

The internal hormonal balance in plants plays a significant role in determining its sensitivity and response to various environmental stimuli. Light signaling components like HY5, PIF3, and PIF4 act as key integrators of light and hormonal pathways by regulating the levels of gibberellin, abscisic acid, auxin, and cytokinin in Arabidopsis (Sibout et al., 2006; ; ; ; ; ; Yu et al., 2013; ; van Gelderen, 2018; Yang et al., 2018; ; ; ; ; ; ). Among the various hormones, exogenous cytokinin treatment resulted in paler plants that exhibited stunted growth, elevated levels of anthocyanin and diminished apical dominance (). Previously, it was also demonstrated that cytokinins enhance the CHLOROPHYLL A/B BINDING PROTEIN (CAB) and RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN (RBCS) levels (Fierabend and deBoer, 1978; ). Additionally, the RESPONSE REGULATOR 4 (ARR4) protein, which mediates cytokinin action, directly interacts with PHYB and stabilizes its active form (Sweere et al., 2001). Despite the significant resistance of hy5 seedlings to systemic cytokinin application in both shoot and root growth inhibition (), cytokinin induces the accumulation of HY5 regardless of light conditions. The MYB transcription factors in Arabidopsis thaliana also play a crucial role in regulating hormone signaling pathways. For instance, AtMYB59 has been shown to influence cytokinin signaling by modulating the expression of ARR16, a key component of the cytokinin signal transduction pathway (). Since CAM7 genetically interacts with HY5 and MYB4, and that HY5 regulates the MYB4 transcript abundance, we examined the genetic and molecular interrelation between HY5 and MYB4 during Arabidopsis seedling development emphasising on light and cytokinin signaling pathways.

Results

MYB4 physically interacts with HY5

A recent study has demonstrated that MYB4 physically interacts with CAM7, and both CAM7 and HY5 bind to the MYB4 promoter to regulate its transcriptional activation (). To investigate whether MYB4 physically interacts with HY5, we conducted in vitro pull-down assays using poly-His and GST fusion proteins. GST, GST-CAM7, and GST-MYB4 were incubated with Ni-NTA beads to which HY5-6His was bound. The α-GST immunoblot of the pulled down proteins revealed that GST-MYB4 was selectively pulled down by HY5-6His similar to GST-CAM7, used a positive control (), however not with GST alone (Figure 1A, Upper Panel). The same membrane was then stripped and re-probed using α-His to examine the equal loading of HY5 (Figure 1A, Lower Panel). These results suggest that MYB4 and HY5 physically interact with each other.

Figure 1

; ) lines. The protein samples were immunoprecipitated with anti-GFP antibody. Both input (5%) and IP fractions were immunoblotted with anti-GFP antibody (upper panel) and the co-immunoprecipitated proteins were detected with anti-HY5 antibody (lower panel). The interaction between CAM7 and HY5 served as the positive control. The experiment was repeated three times and similar results were obtained.

MYB4 has two distinct domains; the N-terminal domain (9-116 aa) comprises of two MYB domains and the C-terminal domain (117-282 aa) comprises of transcriptional activation domain () (Figure 1B). To determine the HY5 interacting domain of MYB4, we conducted yeast two-hybrid assays to examine the domain wise protein-protein interaction. As shown in Figure 1C, the C terminal domain of MYB4 interacted with HY5, however not the N-terminal domain. The negative controls involving empty vectors (AD and BD) and their respective combinations with HY5 and MYB4 (full length and truncated) did not exhibit any physical interaction. These results suggest that MYB4 physically interacts with HY5 through the C terminal domain.

To validate this physical interaction in vivo, we performed co-immunoprecipitation assay. The rosette leaves of 30-d old hy5 mutant () and HY5 OE line () were infiltrated with Agrobacterium harbouring either GFP, GFP-CAM7 (positive control, ), or GFP-MYB4 constructs, resulting in transient expression of these proteins. As shown in Figure 1D, HY5 was co-immunoprecipitated with GFP-CAM7 and GFP-MYB4 but not with GFP alone in HY5 OE background. However, in hy5 mutant background, used as negative control, HY5 wasn’t coimmunoprecipitated with any of the transiently expressed proteins. These results further confirm that MYB4 physically interacts with HY5.

MYB4 genetically interacts with HY5 to regulate photomorphogenic growth

MYB4 and HY5 work as positive regulators of photomorphogenesis at various wavelengths of light (; ; ; ; ; ). To further investigate the role of MYB4 in photomorphogenesis, we first examined whether MYB4 expression is induced during dark-to-light transition. The semi-quantitative and quantitative PCR analyses revealed that MYB4 expression was induced at various wavelengths of light during dark to light transition. As shown in Figures 2A–D and Supplementary Figure 2, the level of induction varied with context to time and wavelength of light tested. We then determined the physiological significance of the physical interaction between MYB4 and HY5 through genetic studies. For that, the myb4 was genetically crossed with hy5 mutant, and the homozygous myb4 hy5 double mutant lines were generated Supplementary Figure 3). To determine the genetic relationship between MYB4 and HY5, 6-day-old wild-type (segregated WT of F2 population), myb4, hy5, and myb4 hy5 seedlings were grown in dark and at various wavelengths of light. Dark-grown seedlings exhibited hypocotyl length similar to the WT background (Figures 3A, B). The myb4 mutant seedlings displayed significantly increased hypocotyl length as compared to WT under white light (WL), blue light (BL), and far-red light (FRL) (Figures 3C–H). No such effect was observed under red light (RL) condition (Figures 3I, J). Consistent with the previous findings, hy5 mutant exhibited a significantly elongated hypocotyl compared to WT under all light conditions tested (). The hypocotyl of myb4 hy5 double mutant was found to be significantly more elongated than each of the single mutants in WL, BL, and FRL, however not in RL (Figures 3C–J). These results suggest that MYB4 and HY5 work in an additive manner to control the hypocotyl length under WL, BL and FRL.

Figure 2

Figure 3

MYB4 modulates HY5-mediated physiological responses

We then examined whether the genetic interaction between MYB4 and HY5 could influence the expression of light-inducible genes. To determine this, we assessed the transcript levels of RBCS-1A and CAB1 in 6-day-old WT, myb4, hy5, and myb4 hy5 seedlings grown under constant WL (30 μmol m-2 s-1). As previously reported, the expression of these genes was significantly decreased in hy5 background as compared to the WT (; ). However, as shown in Figure 3K, the additional mutation of MYB4 in hy5 mutant, did not alter the expression of RBCS-1A and CAB1, resulting in the expression pattern similar to that of hy5 in myb4 hy5 double mutant. These results collectively suggest that additional mutation in MYB4 in hy5 background does not affect the expression of light inducible genes.The accumulation of chlorophyll and anthocyanin is an important physiological response controlled by light signaling pathways (; ; ). It has been reported earlier that hy5 mutant seedlings show a reduced level of chlorophyll and anthocyanin contents (; Shin et al., 2007). To examine the significance of the genetic interplay between MYB4 and HY5 in the accumulation of chlorophyll and anthocyanin, we assessed the chlorophyll and anthocyanin levels in 6-day-old WT, myb4, hy5, and myb4 hy5 double mutant seedlings grown in WL (30 µmolm-2s-1). As shown in Figures 3L, M, while chlorophyll content between myb4 and WT seedlings was similar (Figure 3L), an increase in anthocyanin accumulation was observed in myb4 mutants when compared to the WT seedlings (Figure 3M). The additional mutation of MYB4 in hy5 mutant seedlings did not alter the level of chlorophyll accumulation (Figure 3L), suggesting that HY5 regulates the chlorophyll accumulation independently of MYB4. However, as shown in Figure 3M, the anthocyanin content of myb4 hy5 double mutant was similar to WT background, suggesting that MYB4 and HY5 work antagonistically to regulate the anthocyanin accumulation.

MYB4 regulates HY5 mediated activation of its own promoter

Since HY5 binds to the MYB4 promoter and positively regulates its expression, and given that HY5 and MYB4 physically interact, we aimed to investigate the physiological relevance of this physical interaction in mediating the transcriptional regulation of MYB4. To investigate this, we analysed the DNA-protein interaction between the MYB4 promoter and HY5 in the absence or presence of MYB4. Previously it has been reported that the MYB4 promoter contains three E-Boxes, and HY5 specifically binds to the third E-Box (). We conducted electrophoretic mobility shift assays (EMSA) using purified GST-HY5 and GST-MYB4 fusion proteins, along with both wild-type and mutated versions of the MYB4 promoter fragments (Figure 4A). As shown in Figure 4B, HY5 exhibited strong binding to the wild-type MYB4 promoter fragment, however not to the mutated one. The binding affinity of HY5 to wild-type MYB4 promoter fragment is decreased in the presence of MYB4 (Figure 4B, lane nos. 6 and 7). The reduction in HY5 binding affinity became more pronounced with increasing concentrations of MYB4. However, the DNA-protein complex of HY5 with the wild-type promoter fragment remained unchanged in the presence of GST alone (Figure 4B, lane no. 4). Additionally, no DNA-protein complex was formed between MYB4 and the wild-type promoter fragment (Figure 4B, lane no. 3).

Figure 4

To further gain insight into this regulation, we conducted transient expression assays in Arabidopsis protoplasts using a construct in which the wild-type MYB4 promoter (DNA fragment containing HY5 but not MYB4 binding sites) was fused to the β-glucuronidase reporter gene (Pro AtMYB4-GUS) (Figure 4C). As shown in Figure 4D, while HY5 increased the MYB4 promoter activity by ~2.2-fold, MYB4 alone did not alter the promoter activity. However, when both MYB4 and HY5 were introduced into the protoplast, MYB4 could drastically reduce the HY5 mediated increase in MYB4 promoter activity (Figure 4D). Since we omitted the MYB4 binding site in the transactivation assay, the negative regulation is probably not due to direct binding to the promoter which supports our EMSA results. These results collectively suggest that the physical interaction between MYB4 and HY5 modulates HY5-mediated transcriptional activation of MYB4.

MYB4 and HY5 mediate the integration of light and cytokinin signaling

Previous studies have shown that HY5 protein is stabilized by light (; Wang et al., 2021; ) and cytokinin (Vandenbussche et al., 2007). As this study revealed the genetic interplay between HY5 and MYB4 during photomorphogenic growth, we wanted to explore the genetic interaction between MYB4 and HY5 upon cytokinin treatment. To examine this, we first analyzed whether cytokinin alters MYB4 expression. For this, we monitored MYB4 transcript levels in WT seedlings grown on MS plates, with or without 2 µM and 4 µM trans-zeatin. It was observed that at lower light intensity (15 µmol m-2s-1) MYB4 expression was significantly reduced at 4 µM trans-zeatin, however not at 2 µM, suggesting that higher concentrations of cytokinin represses MYB4 expression (Supplementary Figure 4). Next, we examined the hypocotyl length of 6-day-old WT, myb4, hy5, myb4 hy5 mutants in both cytokinin-treated and untreated seedlings grown in the darkness. It was observed that the dark-grown seedlings of each genotype studied exhibited similar hypocotyl length in absence or presence of different concentrations of cytokinin. (Supplementary Figure 5). These results suggest that mutation in MYB4 doesn’t alter the cytokinin mediated inhibition of hypocotyl elongation in dark.

To determine the effect of light and cytokinin on hypocotyl growth, we examined hypocotyl length of 6-day-old WT, myb4, hy5, and myb4 hy5 double mutant seedlings grown under lower and higher WL fluences on MS plates, with or without 1 µM, 2 µM, and 4 µM trans-zeatin. As shown in Figures 5A, C, under lower intensity of WL (15 μmol m−2 s−1), among the various cytokinin concentrations tested, only the highest concentration (4 µM) was able to rescue the etiolated growth of the myb4 mutant. However, at higher WL intensity (60 μmol m−2 s−1), both 2 µM and 4 µM cytokinin were able to suppress hypocotyl elongation, resulting in hypocotyl length in the myb4 mutant similar to that of the WT (Figures 5B, D). Consistent with earlier reports (Vandenbussche et al., 2007), we observed that similar to the control condition, hy5 mutants exhibited elongated hypocotyl as compared to the WT upon cytokinin treatment. Notably, the hypocotyl length of the myb4 hy5 double mutant was significantly higher than that of hy5 mutant under all the conditions tested (Figures 5A–D). These results suggest that the additional loss of MYB4 function alters the hy5 phenotype upon cytokinin treatment. At lower intensity of WL and lower cytokinin concentration, MYB4 and HY5 function additively to regulate hypocotyl length which is similar to the effect of WL alone. However, at the same light intensity but higher cytokinin concentration this genetic interaction is altered and MYB4 and HY5 exhibit synergistic mode of interaction. At higher light intensity even lower cytokinin concentration is sufficient for the cytokinin mediated synergistic interaction between MYB4 and HY5. Thus, the genetic interaction between MYB4 and HY5 is modulated by both light intensity and cytokinin levels.

Figure 5

We also measured the primary root length in WT, myb4, hy5, and myb4 hy5 double mutant seedlings grown under cytokinin treatment in darkness and under various intensities of white light. While cytokinin suppresses primary root length in WT in both dark and WL (), our results showed no significant differences in inhibition ratios between WT and myb4 mutant seedlings across all conditions (Supplementary Figures 6A–C). Consistent with previous findings by , the hy5 mutant exhibited resistance to cytokinin treatment under both the intensities of the white light. The myb4 hy5 double mutant displayed primary root inhibition patterns similar to the hy5 mutant in white light, indicating that HY5 works independent of MYB4 in regulating primary root length upon cytokinin treatment (Supplementary Figures 6B, C).

MYB4 and HY5 differentially regulate the expression of cytokinin responsive genes

Our study shows that while cytokinin rescues the etiolated growth of myb4 seedlings, the primary root length of myb4 remains similar to WT in both presence and absence of cytokinin. The ATP-binding cassette (ABC) transporter subfamily G14 (ABCG14) in Arabidopsis is primarily active in roots and is crucial for transporting cytokinin to the shoots. When ABCG14 expression is disrupted, it leads to significant stunted growth in the shoots, which can be reversed by applying trans-zeatin externally (; Zhang et al., 2014). To explore whether altered ABCG14 levels is responsible for the suppression of the hypocotyl length of myb4, we assessed the transcript levels of ABCG14 in 6-day-old WT, myb4, hy5, and myb4 hy5 seedlings grown under low (15 μmol m-2 s-1) and high (60 μmol m-2 s-1) white light in MS or in MS with 2 μM and 4 μM trans-zeatin (Figures 6A, B). Under control conditions (without cytokinin), at both low (15 μmol m-2 s-1) and high intensities (60 μmol m-2 s-1) of WL, the expression of ABCG14 in the myb4 mutant is similar to that in the WT, whereas the hy5 mutants exhibit a significant upregulation (~2.2-fold increase) of ABCG14 expression compared to WT (Figures 6A, B). An additional mutation in MYB4 could suppress the elevated expression of ABCG14 in the hy5 mutant, resulting in expression levels similar to WT in the myb4 hy5 double mutant. Earlier it was reported that the expression of ABCG14 was induced by cytokinin treatment (). When we assessed the transcript levels of ABCG14 in 6-day-old WT, myb4, hy5, and myb4 hy5 seedlings grown under constant low white light (15 μmol m-2 s-1) and under constant high white light (60 μmol m-2 s-1) in MS with 2 μM and 4 μM trans-zeatin, we observed that in low light intensity and low cytokinin concentrations, the expression of ABCG14 is significantly reduced in myb4 mutant than that of WT (Figures 6A, B). The expression level pattern of ABCG14 remains same like the untreated for both myb4 and hy5 mutant in all other conditions. Interestingly, unlike the untreated conditions, in myb4 hy5 double mutant, the expression of ABCG14 is similar to that of hy5 mutants. This suggests that upon 2 μM cytokinin treatment at low intensity of WL, HY5 works downstream to MYB4 to regulate the expression of ABCG14 (Figure 6A).

Figure 6

Sweere et al. (2001) suggested a potential mechanism through which cytokinin and light signaling pathways interact to control hypocotyl elongation through RESPONSE REGULATOR 4 (ARR4). To determine if ARR4 plays a role in the altered response of myb4 mutant seedlings, we measured ARR4 transcript levels in 6-day-old WT, myb4, hy5, and myb4 hy5 seedlings grown under continuous low white light (15 μmol m−2 s−1) and high white light (60 μmol m−2 s−1) conditions, both in untreated MS and in MS supplemented with 2 μM and 4 μM trans-zeatin (Figures 6C, D). The results show that ARR4 expression was significantly increased in the myb4 mutant but decreased in the hy5 mutant. In the myb4 hy5 double mutant, ARR4 expression was similar to that in the hy5 mutant, indicating that HY5 functions downstream of MYB4 in regulating ARR4 expression. As it was previously reported that the ARR4 gene expression is also induced by cytokinin (Sweere et al., 2001), we checked the transcript levels of ARR4 in 6-day-old WT, myb4, hy5, and myb4 hy5 seedlings grown under constant low white light (15 μmol m-2 s-1) and under constant high white light (60 μmol m-2 s-1) in MS with 2 μM and 4 μM trans-zeatin. In low light, the pattern of expression of ARR4 is similar to that of the untreated for both myb4 and hy5 mutants. Interestingly, the expression of ARR4 in myb4 hy5 double mutant is similar to that of myb4 mutants, suggesting that under cytokinin treatment in low light, MYB4 works downstream to HY5 to regulate the expression of ARR4. However, in high light, there were no significant differences in the ARR4 transcript in any cytokinin concentrations tested (Figure 6D). This suggests that the role of MYB4 and HY5 in the regulation of cytokinin induced ARR4 expression is specific to low intensity of WL.

Seedlings treated with exogenous cytokinins accumulate anthocyanin pigments, with increased transcript levels of CHALCONE SYNTHASE (CHS) gene, a key player in the anthocyanin biosynthesis pathway (Deikman et al., 1995). HY5 enhances anthocyanin biosynthesis by directly binding to CHS promoter resulting in its transcriptional activation (; ). Conversely, MYB4, a known negative regulator of anthocyanin biosynthesis, indirectly repress CHS expression (Wang et al., 2020). Given these observations, we asked how loss of MYB4 and HY5 functions influence CHS regulation under cytokinin treatment. To answer this, we grew 6-day-old WT, myb4, hy5, and myb4 hy5 seedlings under constant low white light (15 μmol m−2 s−1) and high white light (60 μmol m−2 s−1) on MS media without trans-zeatin and with 2 µM and 4 µM trans-zeatin (Figures 6E, F). Consistent with previous findings, we observed that in untreated conditions, CHS transcript level was significantly elevated in the myb4 mutant whereas it was significantly reduced in the hy5 mutant. In the myb4 hy5 double mutant, CHS expression was similar to the hy5 mutant, indicating that HY5 acts downstream of MYB4 in regulating CHS expression under control condition (Figures 6E, F). However, under both low and high cytokinin treatment across both light intensities, CHS expression was significantly reduced (~2-3 fold) in the myb4 mutant. In contrast, CHS expression patterns were similar in hy5 and myb4 hy5 double mutants across both treated and untreated conditions. These findings suggest that MYB4 plays opposing roles in the regulation of CHS expression depending on the presence or absence of cytokinin and HY5 works downstream to MYB4 in this regulation.

Discussion

A signal transduction pathway relies on its interconnected transcriptional regulatory network for proper functional execution. In this study, we show that MYB4 is functionally connected with HY5 to integrate light and cytokinin responses. Furthermore, our results suggest that MYB4, through its physical interaction, attenuates HY5 from binding to the MYB4 promoter. Multiple lines of experimental evidences, including in vitro and in vivo assays, demonstrate a physical interaction between MYB4 and HY5 proteins. Domain-specific interaction studies further reveal that HY5 interacts with the C-terminal domain (transcriptional activation domain, ) of MYB4. Depending on the growth conditions, two or more substrates can compete for binding to the same domain of a protein. For example, upon blue light exposure, photoactivated CRY2 competes with PAP2 for binding to the WD40 domain of COP1, thereby stabilizing PAP2 and resulting in anthocyanin biosynthesis (). Previous studies have shown that CAM7 interacts with HY5 (), and recent findings indicate that CAM7 interacts with the C-terminal domain of MYB4 as well (). This raises intriguing questions about whether CAM7, HY5 and MYB4 compete for binding with each other or form a transient or obligatory multiprotein complex to regulate photomorphogenesis. One plausible functional significance of MYB4-HY5 physical interaction could be that MYB4 modulates HY5-mediated regulation of MYB4 expression in order to maintain the balance between light and cytokinin mediated hypocotyl elongation. The EMSA results show that the presence of MYB4 significantly reduces HY5-binding to the MYB4 promoter which is further supported by trans-activation experiments in Arabidopsis protoplasts.

Genetic analysis of the myb4 hy5 double mutant shows that long hypocotyl phenotype of hy5 is further enhanced in myb4 hy5 double mutant, resulting in an exaggerated tall phenotype under WL, BL, and FRL, but not in RL. Thus, MYB4 and HY5 function additively under those wavelengths of light. While light-inducible genes like RBCS-1A and CAB1 display expression levels similar to WT in myb4 mutants, their expression in myb4 hy5 mutant is similar to hy5 mutant. Additionally, while HY5 regulate chlorophyll accumulation independent of MYB4, they work antagonistically to regulate anthocyanin levels. Therefore, MYB4 and HY5 coordinate both independently and dependently to regulate photomorphogenic growth.

Integration of light and hormone signaling pathway in Arabidopsis is well studied (; Tian and Reed, 1999; ; Xiong et al., 2023). Among the various phytohormones, cytokinin mimics the effect of light signals, resulting in the de-etiolation of dark-grown seedlings and the inhibition of hypocotyl elongation at lower intensities of light (; ; Vandenbussche et al., 2007). Our study demonstrates that upon cytokinin treatment, the elongated hypocotyl phenotype of myb4 in WL, is suppressed. At higher light intensities, where the effect of cytokinin is otherwise diminished, exogenous cytokinin could still suppress the hypocotyl elongation of myb4 mutants. One possible explanation for this observation is that, due to impaired light responses in the myb4 mutant, the inhibitory effect of light on cytokinin-mediated suppression of hypocotyl elongation is rescued. Additionally, cytokinin application downregulates MYB4 expression. The genetic interaction between HY5 and MYB4, typically additive, becomes synergistic under cytokinin treatment in WL. These altered morphologies are probably due to changes in the dynamics of physical interactions and transcriptional regulation under different growth conditions. The shift in genetic interaction following treatment with exogenous signals or environmental stimuli, which alters the regulatory dynamics between genes, is not unprecedented. explores the intricate interactions between photoreceptors and brassinosteroid-inactivating P450 enzymes, demonstrating how light treatments influence flowering and gene expression through various genetic pathways. Additionally, the genetic interaction between HY5 and GBF1 also varies in a light intensity- and wavelength-dependent manner (Singh et al., 2012). Apart from regulating light-responsive genes, MYB4 and HY5 regulate the expression of genes involved in cytokinin signaling pathway. While the expression of ABCG14, which is involved in the transport of cytokinin from root to shoot, is significantly downregulated in the myb4 mutant, the expression of ARR4, an A-type response regulator, is significantly upregulated as compared to the corresponding cytokinin-treated WT seedlings. Furthermore, HY5 and MYB4 work in the same pathway to regulate the expression of ABCG14 and ARR4. The reduced expression of ABCG14 in myb4 might be responsible for altered cytokinin export to shoot resulting in the observed stunted growth. Whereas in light signaling MYB4 negatively regulates CHS expression, it positively regulates CHS expression upon cytokinin treatment. Since plants are continuously exposed to changing environmental cues, understanding how they integrate and respond to fluctuating light signals and internal hormone levels provides insights into their intricate mechanisms of adaptability and survival.

In summary, HY5 binds to the MYB4 promoter, and positively regulates its expression (). Conversely, MYB4 physically interacts with HY5, inhibiting HY5 to bind to its promoter, thus autoregulating its own expression (Figure 7). Furthermore, under higher light intensity, myb4 mutants show hypersensitivity to lower cytokinin concentrations, whereas under lower light intensity, higher cytokinin levels are required to observe this effect. This stoichiometric balances between HY5 and MYB4 provide maintain homeostasis and accordingly control hypocotyl elongation in response to light and cytokinin.

Figure 7

) to enhance MYB4 expression. As a feedback response, MYB4 interacts with HY5, preventing its binding to MYB4 promoter, thus finely regulating its expression to balance light and cytokinin signals in controlling hypocotyl growth during Arabidopsis seedling development.

Methods

Plant materials and growth conditions

Arabidopsis thaliana plants used in this study were homozygous myb4 mutant (CS26404), a Ds transposon tagged mutant in Ler background () and homozygous hy5-ks50 mutant, a T-DNA insertion mutant in Ws background (). The myb4 hy5 double mutants were created through genetic crosses using standard methods outlined by Yadav et al. (2005) by crossing homozygous myb4 mutant with hy5 homozygous mutant lines. The homozygosity of both the mutation in T2 generation were confirmed by the inability of gene-specific primer sets, which spanned the full length of MYB4 (MYB4FP and MYB4RP primers) and HY5 (HY5FP and HY5RP) to amplify the MYB4 and HY5 gene respectively from genomic DNA isolated from the plants. One homozygous myb4 hy5 double mutant plant, used for different experiments was additionally confirmed by assessing the transcript levels of both MYB4 and HY5 using RT-PCR analyses. To analyse double mutants from different ecotype backgrounds, a segregated WT line of Ws-Ler from the T2 generation was marked as WT and used as a control to compare phenotypic and molecular differences.

Arabidopsis seeds were surface-sterilized and sown on Murashige and Skoog (MS) plates, stratified in the dark at 4°C to break dormancy before being transferred to growth chambers. They were then grown under specific wavelengths of light at designated light intensities at 22 °C. For different phenotypic studies, seedlings were photographed, and their hypocotyl lengths were measured using ImageJ software. For cytokinin responsive experiments, seeds were sown on MS plates with different concentration of trans-Zeatin.

In vitro pull-down assay

The full-length coding sequences (CDS) of CAM7 and MYB4 were cloned into the pGEX‐4T2 vector to produce fusion proteins with Glutathione S‐transferase (GST). The GST (negative control), GST-CAM7 (positive control) and GST-MYB4 were overexpressed and purified from E. coli BL21 (DE3) using Glutathione Sepharose 4B beads (Amersham Biosciences). The full-length CDS of HY5 was cloned into the pET‐20b (+) vector, adding a 6× Histidine tag to the C-terminus. The HY5-His protein was overexpressed in E. coli BL21 (DE3) and purified with Ni‐NTA Agarose beads (Qiagen). The in vitro binding assay was performed following the protocol from . For the assay, 2μg of HY5-His was added to microcentrifuge tubes containing Ni-NTA Agarose beads and incubated with in vitro binding buffer (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 0.2% glycerol, 0.1% Triton-X100, 1 mM EDTA, 1 mM PMSF, 0.1% NP-40, and protease inhibitor cocktail; Sigma, Calcutta, India) for 2 hours at 4 °C. After washing off the unbounded proteins, GST, GST-CAM7 or GST-MYB4 was added in equimolar amounts and incubated overnight at 4 °C. Following incubation, the supernatant was collected by centrifugation, and the beads were washed three times with binding buffer. The beads were then resuspended in 5X sodium dodecyl sulfate (SDS) loading buffer and boiled for 10 minutes. Both the supernatant (5%) and pellet fractions were analyzed using 12% SDS–polyacrylamide gel electrophoresis (PAGE) and immunoblotted with anti-GST antibodies to detect protein interactions. The same membrane was then stripped and probed using α-His to examine the equal loading of HY5-His.

Yeast two-hybrid assay

For the domain-wise interaction study of MYB4 with HY5, full-length CDS and truncated version of MYB4 was combined with the GAL4 DNA-binding domain (BD-MYB4- bait) and the full-length CDS of HY5 was combined with the GAL4 activation domain (AD-HY5- prey). The fusion constructs were then introduced into yeast AH109 strain using polyethylene glycol/lithium acetate transformation (Clontech), and the growth were assessed of the co-transformed yeast cells on 2D plates (lacking leucine and tryptophan) and 4D plates (lacking leucine, tryptophan, adenine, and histidine). As previously demonstrated by , COP1 and HY5 were used as a positive control for this study.

Co‐immunoprecipitation assays

Co-IP assay was performed as described previously () with slight modifications. Full length CDS of MYB4 was cloned into pCAMBIA 1303 to yield a GFP fusion protein. Total protein was extracted from the leaves of 30-d old hy5 and HY5OE plants transiently expressing GFP, CAM7-GFP () or MYB4-GFP using Co‐IP buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 10% glycerol and protease inhibitor cocktail). 500 μg of total protein for each sample was incubated with 15 μl of anti-GFP monoclonal antibody (Sigma) for 6h at 4 °C. To this 30 μl of pre blocked protein A‐agarose beads (Sigma) was added and incubated for 2 hr at 4 °C. Then the beads were washed three times with Co‐IP buffer, and after the last wash the beads were boiled in 5X protein loading dye for 10 min to elute the protein and along with that 5% input was run in SDS‐PAGE. Immunoblots were developed using anti-GFP antibody (Sigma, dilution- 1:2500) and co-immunoprecipitated protein was detected by stripping and re-probing with anti-HY5 antibody (Srivastava et al., 2015; Sigma, dilution- 1:5000).

Gene expression analysis

Total plant RNA was isolated from the 6-day-old Arabidopsis thaliana seedlings grown under required light conditions using RNeasy plant mini kit (Qiagen). cDNA was synthesized from 1µg of total RNA using RevertAid H Minus First Strand cDNA synthesis Kit (Thermo Scientific). qPCR was then performed using Power SYBR® Green PCR Master Mix (Applied 509 Biosystems) in StepOnePlusTM Real-Time PCR Systems using respective qPCR gene specific primers. ACTIN2, a housekeeping gene was used as reference gene to normalize the transcript level of the qPCR values. To analyze the relative changes in gene expression, the common 2-ΔΔCT algorithm was used. First, ΔCt value is calculated by normalizing samples Ct to ACTIN2 Ct values. This value for different samples was then normalized to the Ct values of the experimental control and the ΔΔCt values were obtained. Fold expression was calculated by the formula, 2-ΔΔCT, which was then plotted on the graph. The primers used for qPCR analysis has been mentioned in Table 1.

Table 1

Sl. No.Primer nameSequence (5’-3’)
1Actin2 FPAAAGGCTTAAAAAGCTGGGG
2Actin2 RPGGGACTAAAACGCAAAACGA
3CAB1-FP1GAGGAAGACTGTTGCCAAGC
4CAB1-RP1CCCACCTGCTGTGGATAACTTC
5RBCS-1A-FP1ACCTTATCCGCAACAAGTGG
6RBCS-1A-RP1TGGGGTACTCCTTCTTGCAC
7MYB4(GST)FPCGGGATCCATGGGAAGGTCACCGTGC
8MYB4(GST)RPATAAGAATGCGGCCGCTTATTTCATCTCCAAGCTTCG
9HY5(His)FPCGGAATTCGATGCAGGAACAAGCGACTACTC
10HY5(His)RPCCGCTCGAGAAGGCTTGCATCAGCATTAGAACC
11FP-MYB4ΔC-Y2HGGAATTCCATATGGGAAGGTCACCGTGC
12RP-MYB4ΔC-Y2HCGGAATTCGGTATTACTCGTAACTGGTTC
13FP-MYB4ΔN-Y2HGGAATTCCATATGATTAATATCTCATTCACTTCTGC
14RP-MYB4ΔN-Y2HCGGAATTCTTATTTCATCTCCAAGCTTCG
15FP-HY5-Y2HGGAATTCATGCAGGAACAAGCGACTAG
16RP-HY5-Y2HCCATCGATTCAAAGGCTTGCATCAGCATTAG
17MYB4 proto-WT FPCGGGATCCGTGCTTGTCATTTGGTGAGAG
18MYB4 proto-WT RPCCGCTCGAGGTTTTTTGGACAAGTGCAGGTC
19MYB4 pRTL2- FPCATGCCATGGGGATGGGAAGGTCACCG
20MYB4 pRTL2- RPCATGCCATGGTTATTTCATCTCCAAGCTTCG
21HY5 pRTL2- FPCATGCCATGGGCATGCAGGAACAAGCGACTAGC
22HY5 pRTL2- RPCATGCCATGGTCAAAGGCTTGCATCAGCATTAG
23MYB4_qPCR_FPAGATGAGTGCCCAGTTCAAGA
24MYB4_qPCR_RPAGCTGCACTTGAAACAACGT
25HY5_qPCR_FPAGACATATTCTGAAGAACACAACAGG
26HY5_qPCR_RPAGAAGAAGAAGGAGATCAAGGC
27MYB4_R2c_FPCGGAATTCTTACAAGTTATCCTGCCCACAC
28MYB4_R2c_RPCGGGATCCCTCTAATATATAGACTGCACTGG
29MYB4_R2Am3_FPCGGAATTCTTAGCAAGTGATTGTATTAGGG
30MYB4_R2Am3_RPCGGGATCCCCCTAATACAATCACTTGCTAA
31MYB4-GFP_FPCATGCCATGGGAAGGTCACCGTGC
32MYB4-GFP_RPGGACTAGTGCGGCCGCTTATTTCATCTCCAA
33ABCG14 RT FPTCGCCAACGGAATCCCAC
34ABCG14 RT RPGGTTTTTGGCAGCAGCTTTG
35ARR4 RT FPGAAGATTAAGGAATCGTCC
36ARR4 RT RPTCAAGGCATCTGTCGATTC
37CHS FPCTGTCCTCGTATCGCTAAGGAT
38CHS RPACGTGTCGCCTCATCTTCTCTT

Primers used in various experiments.

Analysis of pigment accumulation

The levels of chlorophyll and anthocyanin were determined following the protocol described by . Specifically, for chlorophyll content estimation, 6-day-old seedlings grown under continuous white light (WL) were weighed and quickly frozen in liquid nitrogen. The frozen tissues were grounded in a 1.5 ml microcentrifuge tube, and chlorophyll was extracted in the dark using 80% acetone until the pellet became colourless. Chlorophyll a and b levels were calculated using MacKinney’s specific absorption coefficients: chlorophyll a = 12.7(A663) - 2.69(A645), and chlorophyll b = 22.9(A645) - 4.48(A663). The total chlorophyll content was expressed as micrograms of chlorophyll a and b per gram of fresh tissue weight.

For anthocyanin content estimation, 6-day-old seedlings grown under continuous WL were weighed, rapidly frozen in liquid nitrogen, and ground. Total plant pigments were extracted overnight in 0.3 mL of 1% HCl in methanol. After adding 0.2 mL of water, chlorophyll was separated from anthocyanin by adding an equal volume of chloroform. The anthocyanin level was assessed by spectrophotometric measurements of the aqueous phase (A530 - A657) and normalized to the total fresh weight of the tissue. Flowering times were determined as described by Yadav et al. (2005).

Electrophoretic mobility shift assay

GST, GST-MYB4, and GST-HY5 proteins were overexpressed in E. coli BL21 (DE3) and affinity purified using Glutathione Sepharose 4B beads (Amersham Biosciences). For the DNA binding assays, wild type MYB4 promoter spanning the 3rd E box and mutated 3rd E box generated through primer-based site-directed mutagenesis, were used as probes. All of these fragments were cloned into the pBluescript SK+ vector, followed by PCR amplification and purification to produce the probes. Approximately 100 ng of the DNA fragment was incubated with the purified protein in a reaction mixture containing 1X binding buffer (15 mM HEPES, pH 7.5, 35 mM KCl, 1 mM MgCl2, 1 mM EDTA, pH 8.0, 2% glycerol, and 1 mM DTT) in a total volume of 20 µl. The incubation was carried out at room temperature for 20 minutes. Following incubation, the reactions were resolved on a 7% native polyacrylamide gel, stained with SYBR® Green EMSA nucleic acid gel stain (Molecular Probe, Invitrogen), and visualized using the iBright 750 imaging system (Invitrogen) for image documentation.

Transient expression assay in Arabidopsis protoplast

Arabidopsis protoplasts were isolated and transformed following the protocol outlined by Yoo et al. (2007). Wild-type MYB4 promoter fragments containing the three E-boxes were PCR amplified and cloned into the pGAL-UAS-GUS vector. The full-length coding sequences (CDS) of HY5 and MYB4 were individually cloned into the pRTL2 vector to create the effector constructs. Both the reporter and effector constructs were introduced into Col-0 protoplasts. Following transfection, the protoplasts were incubated under 20 µmol/m²/s white light for 10 hours before harvesting. The GUS activity measurement was carried out as mentioned by Yoo et al. (2007) and .

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Author contributions

AP: Investigation, Conceptualization, Writing – review & editing, Data curation, Writing – original draft, Validation, Methodology. RB: Writing – original draft, Investigation, Writing – review & editing. SC: Writing – review & editing, Funding acquisition, Writing – original draft, Supervision.

Funding

The author(s) declare financial support was received for the research and/or publication of this article. This work is supported by a research grant of Science and Engineering Research Board (SERB), Government of India (CRG/2021/000063) to SC. SC also acknowledges Sir J.C. Bose National Fellowship Award Grant from SERB (2011-21), Government of India. A.P. and RB are recipients of CSIR-SRF from Council of Scientific and Industrial Research (CSIR), Government of India. SC acknowledges the (DST-FIST) instrumentation facility of the department (provided by Department of Science and Technology, Govt. of India).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphgy.2025.1657264/full#supplementary-material

Supplementary Figure 1

Full Blot of co-immunoprecipitation assay showing interaction between MYB4 and HY5.

Supplementary Figure 2

The expression of MYB4 is stimulated during dark to light transitions. (A–D) Semiquantitative PCR to show the transcript abundance of MYB4 in 5-day-old dark grown WT (ecotype Landsberg erecta) seedlings transferred either to white light (WL: 20 µmolm-2s-1) (A), blue light (BL: 20 µmolm-2s-1) (B), red light (RL:30 µmolm-2s-1) (C), or far-red light (FR: 1.5 µmolm-2s-1) (D), at various time points. Each PCR reaction was sampled at 25 cycles to monitor the amplification process before saturation occurred. The semiquantitative PCR amplification of ACTIN2 for the same reaction setup was used as endogenous control.

Supplementary Figure 3

Confirmation of myb4 hy5 double mutant. Semiquantitative PCR to confirm myb4 hy5 double mutant plant by using gene specific primers. ACTIN2 was used as endogenous control.

Supplementary Figure 4

Expression of MYB4 is downregulated upon cytokinin treatment. Real-time PCR analyses of MYB4 in 6-day-old wild type seedlings grown under constant white light (15 µmolm-2s-1) in normal MS media (Control) or in MS media supplemented with 2 µM and 4 µM trans-zeatin (Treated). Error bars represent ± SE of the mean of three biological replicates. Different alphabets denote statistically significant differences (p < 0.05) by One-way ANOVA followed by a Tukey-Kramer post-hoc test. ACTIN2 was used as endogenous control.

Supplementary Figure 5

Response of myb4 hy5 double mutants to external cytokinin treatment grown under dark condition. (A, B). Visible phenotype of 6-day-old WT (Segregated wild type Ws-Ler), myb4, hy5 and myb4 hy5 double mutant seedlings grown under constant dark (A); Quantification of hypocotyl length (B) of 6-day-old WT (Segregated wild type Ws-Ler), myb4, hy5 and myb4 hy5 double mutant seedlings grown under constant dark. Error bars represent ± SD (n=10). Different alphabets denote statistically significant differences (p < 0.05) by One-way ANOVA followed by a Tukey-Kramer post-hoc test. 1, 2, 3, 4 under the bar represents WT, myb4, hy5 and myb4 hy5 double mutant respectively.

Supplementary Figure 6

HY5 works independently of MYB4 to regulate the root growth inhibition under cytokinin treatment. (A–C) Quantification of primary root length of 6-day-old WT (Segregated wild type Ws-Ler), myb4, hy5 and myb4 hy5 double mutant seedlings grown under dark (A), constant WL (15 µmolm-2s-1) (B) and WL (60 µmolm-2s-1) (C) in absence or in presence of different concentrations of trans-zeatin. Error bars represent ± SD (n=8). Different alphabets denote statistically significant differences (p < 0.05) by One-way ANOVA followed by a Tukey-Kramer post-hoc test. 1, 2, 3, 4 under the bar represents WT, myb4, hy5 and myb4 hy5 double mutant respectively.

References

Summary

Keywords

MYB4, HY5, photomorphogenesis, cytokinin, seedling development

Citation

Pal A, Basu R and Chattopadhyay S (2025) MYB4 and HY5 integrate light and cytokinin signaling pathways during Arabidopsis seedling development. Front. Plant Physiol. 3:1657264. doi: 10.3389/fphgy.2025.1657264

Received

01 July 2025

Accepted

01 September 2025

Published

19 September 2025

Volume

3 - 2025

Edited by

Alexander Heyl, Adelphi University, United States

Reviewed by

Vikas Garhwal, Indian Institute of Science Education and Research Kolkata, India

Han Dong, Henan Agricultural University, China

Updates

Copyright

© 2025 Pal, Basu and Chattopadhyay.

This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Sudip Chattopadhyay, ;

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Share on WeChat

Scan with WeChat to share this article

Article metrics