BRIEF RESEARCH REPORT article

Front. Protistol., 30 June 2025

Sec. Marine and Freshwater Harmful Algae and Protists

Volume 3 - 2025 | https://doi.org/10.3389/frpro.2025.1612811

Vertical distribution of harmful algae in the sediment of Uranouchi Inlet by metabarcoding

  • 1. Laboratory of Aquatic Environmental Science, Faculty of Agriculture and Marine Science, Kochi University, Nankoku, Japan

  • 2. Usa Marine Biological Institute, Kochi University, Tosa, Japan

  • 3. Kochi Prefectural Fisheries Experiment Station, Susaki, Japan

  • 4. Faculty of Agriculture and Marine Science, Kochi University, Nankoku, Japan

Abstract

Uranouchi Inlet, situated on the Pacific coast of southwestern Japan, has been a highly enclosed inlet known for yellowtail farming since 1959. Since the 1980s, harmful algal blooms (HABs) have repeatedly occurred, resulting in mass mortality of fish and shellfish. In the sediment at the inlet, the resulting cysts of the HAB species may be preserved, which reflects the history of HAB events. However, the vertical distributions of HAB species in sediment have not been elucidated. In this study, core sediment samples were analyzed by metabarcoding. The dating of each sample was cited from previous study dating the same samples. The findings revealed the presence of eleven HAB species, with notable shifts from approximately 1977–1988. The timing of the shifts corresponded to that of the development of aquaculture and the resulting eutrophication. Vertical core metabarcoding provides footprints of how HAB species composition may be influenced by anthropogenic environmental changes.

1 Introduction

Uranouchi Inlet, located on the Pacific coast of southwestern Japan, is a highly enclosed inlet with a narrow bay mouth (). These characteristics enabled the start of yellowtail farming in 1959. Since then, fish farming has continued in the inlet, with nearly 3,500 tons of farmed fish (mainly yellowtail or red sea bream) produced in 2018 (; ). Harmful algal blooms (HABs) have repeatedly occurred in the inlet since the 1980s, resulting in mass mortality of fish and shellfish ().

Some HAB-causative species are known to form cysts, resulting in the accumulation of these cysts in sediments. These cysts germinate when the surrounding environment is suitable for growth (; ; ; ). It has been reported that some cysts in bottom sediments collected by a core sampler and found to be almost a century old could still germinate (, ; ; ; ), which enables us to speculate on the history of HABs caused by cyst-forming species by identifying the species of cysts in bottom sediments. However, species identification of HAB cysts is difficult because of the lack of understanding of their morphological characteristics in some cases (; ; ). Recently, DNA-based species identification by metabarcoding via high-throughput sequencers has been performed to detect HAB-causative species in surface sediment samples because of the fast, work-saving, and comprehensive identification of multiple species (; ; , ). Studies that attempt to identify HAB species by collecting surface sediment samples at shallow depths (from 0 to 15 cm of collected surface sediments) have been performed to determine the HAB species that have been present recently in the nearby collection area. However, several studies have focused on the detection of HAB-causative species collected from sediment core samples that are more than 15 cm depths (; ; ; ). Among them, few studies have focused on how marine eukaryotic HAB communities have been influenced by anthropogenic activities, such as heavy metal pollution and agricultural pollution (), climate change () and nutrient runoff from rivers (). Under these circumstances, there are no studies on the long-term history of the transition of HAB-causative species due to eutrophication in coastal areas caused by aquaculture. In this study, we aimed to clarify the vertical distribution of cyst-forming HAB species in sediment core samples from Uranouchi Inlet by metabarcoding, where fish farming has been continuously performed since the 1960s and HAB events have repeatedly occurred, and discuss the possibility that environmental changes caused by fish farming have contributed to changes in the community compositions of HAB species.

2 Method

The sediment core sample (0–57 cm depth) was collected as described by at Menokuso Station in Uranouchi Inlet, Kochi, Japan (33.25.346N, 133.23.522E), on August 22, 2016 (Supplementary Figure 1). The sediment core was sliced into 3-cm layers each with a thread saw, and the nineteen layered samples were named URA01 (0–3 cm) to URA19 (54–57 cm), which were obtained as described previously by . To avoid contamination between each sample, only the center of each sediment sample was collected and peripheral sediment was removed by washing with sterile seawater. Prior to DNA extraction, the samples were stored in the dark at -80°C to prevent degradation of the genomic DNA of cysts of HAB species in the sediment. Radiometric dating of the nineteen samples (Figure 1) was conducted with Pb-210 and Cs-137 by . The result of estimated year of each sample by was shown in Figure 1.

Figure 1

. 2: URA01—03, URA04—13 and URA14—19 were surface mixed layers, layers determined by radiometric dating, and layers out of the dating range, respectively. 3: The core sample was collected from Uranouchi inlet in 2016.

The processes required for MiSeq sequencing, such as DNA extraction and MiSeq library preparation, were essentially performed following the methods described by . DNA was extracted from 250 mg of raw sediment taken from each layer of the core sample in duplicate via a DNeasy® PowerSoil® Kit according to the manufacturer’s protocol (QIAGEN, Hilden, Germany). The eukaryotic universal V8–V9 primer set was used to amplify the V8–V9 region of the 18S rDNA (approximately 350 bp). The primers used were forward primer V8F+adapter 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG+ATAACAGGTCTGTGATGCCCT-3’ and reverse primer 1510R+adapter 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG+CCTTCYGCAGGTTCACCTAC-3’ (). PCR was conducted using the primers and the extracted DNA from core samples as templates, and the amplified products (approximately 400 bp) were purified via the method described in . Equimolar quantities of the purified amplicons were pooled and subjected to 2 × 250-bp sequencing (MiSeq Reagent Nano Kit v2, Illumina) on an inhouse MiSeq platform (Illumina). The raw data (fastq file) of both the forward and reverse sequences obtained from MiSeq were deposited in the DDBJ Sequence Read Archive under BioProject number PRJDB17880 (DRR Run number: DRR543997–DRR544015).

After MiSeq paired-end sequencing (2 × 250 bp), raw sequences were trimmed in Mothur ver. 1.40.3 () on Galaxy () and Mothur ver. 1.36.1 () in the laboratory based on the bioinformatics method described by . After trimming the sequences, only the sequences expected for the 18S rDNA V8–V9 region were retrieved, and singleton sequences were also removed based on the method of .

For HAB species identification of unique sequences, a BLAST (basic local alignment search tool) 2.7.1+ search () was conducted via the Protist Ribosomal Reference database ver. 5.0.1 (PR2, ). After a BLAST search against the reference database described above, only sequences showing more than 97% similarity to those of HAB species and more than 281-bp query coverage were selected for further analysis. To understand the full picture of eukaryotes obtained by MiSeq, the total number of reads in all samples of each taxon group from Supergroup to Division was calculated, as well as the relative number of reads in each of the 19 samples for each taxon group. Since this study focused on HAB species in sediment samples, unique sequences associated with HAB genera and species listed in the IOCUNESCO Taxonomic Reference List of Harmful Micro Algae () were retained. In addition, the genus Skeletonema, which is known to cause nori bleaching in Japan (; ; , ; ) and caused fish kill events by Skeletonema costatum in British Columbia, Canada () was also treated as a HAB genus.

To prevent misidentification of HAB species with unique sequences at the genus or species level, maximum likelihood (ML) molecular phylogenetic trees were constructed using unique sequences and reference sequences belonging to each genus obtained from GenBank and PR2. Multiple alignments, best model selection and ML molecular phylogenetic trees were constructed via the methods described by . If the unique sequence appeared in the same clade as the reference HAB species, it was assigned to the same HAB species. However, if the reference sequences of multiple HAB species were mixed in the same clade, misidentification was avoided by listing multiple species together.

To investigate the vertical distribution of HAB species detected in the sediment samples, a heatmap with hierarchical clustering was generated on the basis of the read numbers of each HAB species in each sediment sample. The detailed heatmap analysis method followed the same approach as that in and was performed in R 4.3.1 () and RStudio 2023.06.0 + 421 ().

To discuss the occurrence of HAB species detected by metabarcoding, the occurrence species of major HAB species and their cells measured by light microscopy when fishery damage occurred in Uranouchi Inlet from 1984 to 2017 was provided by the Kochi Prefectural Fisheries Experiment Station. Simultaneously, water quality survey results (NH4-N, NO2-N, NO3-N, PO4-P, DIN-N, DON-N, DOP-P, T-N and T-P) from 1980 to 2020 surveyed every 2 to 5 years in Mitsumatsu station near Menokuso Station in Uranouchi Inlet, where the core sample used in this study was collected, was provided by Kochi Prefectural Fisheries Experiment Station and Fisheries Research Institute, Japan Fisheries Research and Education Agency.

3 Results

3.1 Overview of metabarcoding results

A total of 561,941 raw sequences were obtained from MiSeq paired-end sequencing, and all the raw sequences were generated as contig sequences (Supplementary Table 1). The sequences filtered and trimmed via Mothur were 179,827 unique sequences, and 465,118 reads were obtained. Among the sequences, 164,789 unique sequences and a total of 433,983 reads of the 18S rDNA V8–V9 region were obtained. After removal of chimeras and ‘pre.cluster’, 35,897 unique sequences and a total of 332,895 reads were passed through filtering. After singleton sequences were removed, 10,224 unique sequences and a total of 307,222 reads were obtained (Supplementary Table 1).

Eight supergroups of Eukaryota were identified from metabarcoding sequences using BLAST search with PR2 database (Supplementary Table 2 and Supplementary Figure 2). The total read number identified by the BLAST search in the 19 sediment samples was 234,173 reads, with the highest number of 139,129 reads for Alveolata in the TSAR (Supplementary Table 2). Total reads of the supergroups and divisions derived from the 19 sediment samples were varied among 5,124 reads at URA18 to 17,703 reads at URA02 (Supplementary Table 3). Supergroup and division showing the most abundant reads was TSAR and Alveolata, respectively, in URA01–URA14 and URA19 samples (ranged from 33.79% at URA19 to 79.83% at URA09, Supplementary Table 4 and Supplementary Figure 2). In contrast, Obazoa and Opisthokonta were the most dominant supergroup and division in URA15–URA18 (ranged from 33.86% at URA15 to 42.59% at URA17), respectively.

3.2 Molecular phylogenetic position of each identified HAB species

Ten HAB species belonging to the genera Alexandrium, Azadinium, Chattonella, Fibrocapsa, Heterocapsa, and Heterosigma were identified in this study (Table 1). In the case of the genus Skeletonema, the total numbers of unique sequences and reads of the genus were also shown in Table 1 because not only Skeletonema costatum but also many species of the genus are considered to cause nori bleaching in Japan. The HAB species Aureococcus anophagefferens, Azadinium dexteroporum and A. spinosum, Dictyocha fibula, Karenia mikimotoi, Pseudo-nitzschia delicatissima, P. multiseries, P. pseudodelicatissima, and P. pungens were also detected. However, the total read numbers of those HAB species were less than fifty which was difficult to examine for vertical distribution in the sediment samples, so those species were excluded from the subsequent analysis.

Table 1

GenusSpeciesHarmful effects and toxins of each HAB speciesUnique sequence numbersNumbers of reads
Alexandriumaffineichthyotoxicity ()3132
hiranoi/pseudogonyaulaxgoniodomin A from A. hiranoi (; ) goniodomin A from A. pseudogonyaulax ()4552
leeiichthyotoxicity ( and )10183
pacificum (Group IV)paralytic shellfish toxins (neosaxitoxin and gonyautoxins 1–6)
(; ; )
9591
tamiyavanichiiparalytic shellfish toxins (neosaxitoxin and gonyautoxins 1–5)
(; ; )
2177
Azadiniumpoporum1azaspiracids (; , ; ; )385
Chattonellamarinaichthyotoxicity ()2827
Fibrocapsajaponicaichthyotoxicity (; 2012)245,560
Heterocapsacircularisquama2bivalve mortality ()3228
Heterosigmaakashiwo3ichthyotoxicity ( and ; ; )2364
Skeletonemaspp.nori bleaching and fish kill (; ; , ; ; )233,742

List of HAB species and nori bleaching/fish kill species detected by metabarcoding in this study, their harmful effects, and their numbers of unique sequences and reads obtained in this study.

1The sequences of Azadinium dalianense/poporum (Supplementary Figure 4) were determined to be those of A.poporum’ in this study, because A. poporum has been found at various locations in Japan ().

2The sequences of Heterocapsa circularisquama (Supplementary Figure 6) were determined to be those of H.circularisquama’ in this study, because H. circularisquama has been found at Uranouchi Inlet ().

3The sequences of Heterosigma akashiwo/minor (Supplementary Figure 5) were determined to be those of H.akashiwo’ in this study, because H. akashiwo has been found at various locations in Japan (; ; ).

In the molecular phylogenetic tree of the genus Alexandrium, unique sequences of the genus Alexandrium obtained this study were separated into five major clades (Supplementary Figure 3). Four clades contained sequences of A. affine, A. leei, A. pacificum (group IV) and A. tamiyavanichii, whereas the remaining clade contained two species (A. hiranoi and A. pseudogonyaulax) in the molecular phylogenetic tree. A. pacificum (Group IV) and A. tamiyavanichii have been reported as paralytic shellfish toxin (PST) producers (A. pacificum: ; ; , A. tamiyavanichii: ; ; , Table 1). A. affine and A. leei have been reported to be associated with fish mortality (A. affine: , A. leei: ; , Table 1). A. hiranoi and A. pseudogonyaulax produce goniodomin A, which is an antifungal polyether macrolide that inhibits actin reorganization and angiogenesis (, ; , Table 1).

Regarding the toxic species of the genus Azadinium, three unique sequences belonging to the clade A. poporum/A. dalianense were obtained (Supplementary Figure 4). Since A. dalianense has not been found and A. poporum has recently been found in Japanese coastal waters via many water samples collected from various locations in Japan (), these unique sequences may be those of A. ‘poporum’, known as an azaspiracid producer (; , ; , , Table 1). The azaspiracid is known to cause symptoms similar to diarrheal shellfish poisoning, including nausea, vomiting, abdominal pain, and severe diarrhea symptoms in humans who ingest mussels or scallops contaminated with azaspiracids ().

The unique sequences belonging to the Chattonella marina complex (C. marina var. antiqua, C. marina var. marina, C. marina var. ovata and C. minima) were detected (Supplementary Figure 5). Several strains of the C. marina complex produce reactive oxygen species (ROS), which may affect the gills of fish during red tide outbreaks and cause fish mortality (, Table 1). Regarding phylogeny, the C. marina complex detected in the sediment sample may also have the potential for ROS production because sequences of the productive ROS strains and those of the C. marina complex detected in this study appeared in the same clade on the tree (Supplementary Figure 5). The unique sequences assigned to Fibrocapsa japonica were detected (Supplementary Figure 5). Fish mortality caused by F. japonica has been reported (; , Table 1), and some studies have reported that this species produces ROS and hemolysins, which may cause cell clogging in the gills (, 2012). The unique sequence of Heterosigmaakashiwo’, which has been reported as a HAB that causes fish mortality, was detected (Table 1 and Supplementary Figure 5). The genus Heterosigma contains a new species, H. minor, described in 2016 (). These two species of Heterosigma are indistinguishable in the 18S rDNA V8–V9 region analyzed in this study. However, H. minor has only been described from a strain isolated from Virginia, USA (strain ARC HA0504-1), and no Japanese strain has been isolated to date (; ; ). Therefore, we determined the unique sequences in the phylogenetic tree as H. ‘akashiwo’ (Supplementary Figure 5).

Three unique sequences were found in the genus Heterocapsa, but the position of those sequences in the phylogenetic tree of the genus Heterocapsa was difficult to identify at the species level, since those sequences belonged to one clade along with several other species of the genus Heterocapsa (Supplementary Figure 6). This is because the 18S rDNA V8–V9 region, which is the target region for metabarcoding in this study, cannot identify each species of the genus Heterocapsa. However, considering that there are reports of bivalve mortality caused by H. circularisquama in Uranouchi Inlet (; ; ; ; ), these three sequences were considered as H. circularisquama and named as H.circularisquama’ (Table 1).

The blooms of Skeletonema have been reported to be responsible for the color bleaching of nori (Pyropia spp.) in Japan (, Table 1) and gill lesions and mortality of Atlantic salmon Salmo salar in British Columbia (), unique sequences assigned to this genus were treated as HAB species in this study (Supplementary Figure 7).

3.3 Monitoring data of HAB species and water quality survey

The HAB monitoring data provided by the Kochi Prefectural Fisheries Experiment Station for fishery damage in Uranouchi Inlet between 1984 and 2017 showed that the largest fishery damage on record occurred in 2001 in this inlet, with the damage amounting to 60 million yen (Table 2).

Table 2

YearSpecies observed during red tide outbreak (concentration : cells/L)Damaged fish speciesDamage quantityDamage amount (multiplied by thousands of JPY)
1984Heterosigma sp. (ND)Japanese amberjack2,500 fishes1,950
1991Chattonella marina (640)Japanese amberjack21,500 fishes8,920
1992Heterosigma akashiwo
(4,880)
greater amberjack600 fishes540
1993Chattonella marina (10,533)Heterosigma akashiwo (ND)Karenia mikimotoi (ND)Japanese amberjack,
striped jack
Japanese amberjack 50,000 fishes, striped jack 20,000 fishes35,000
1994Chattonella marina (ND)Karenia mikimotoi (35,000)red sea bream800 fishes800
1994Chattonella
marina (3,300)
striped jack1,000 fishes1,500
1997Chattonella antiqua (8,300)Japanese amberjack15,000 fishes20,000
2001Heterosigma akashiwo (113,800)red sea bream, yellowtailred sea bream 2,000,000 fishes, yellowtail 600,000 fishes60,000
2001Fibrocapsa japonica (1,600)Chattonella spp. (ND)greater amberjack10,000 fishesND
2002Chattonella antiqua (4,100)C. marina
(ND)
Japanese amberjack1,100 fishes270
2003Chattonella antiqua/marina (25,700)Japanese amberjack54,000 fishes26,000
2003Chattonella antiqua/ marina (4,134)Japanese amberjack, greater amberjackJapanese amberjack 6,180 fishes, greater amberjack 400 fishes1,600
2004Chattonella marina (ND)Karenia mikimotoi (16,664)greater amberjack, red
sea bream, abalone
greater amberjack
343 fishes, red sea bream 269 fishes, 250,000 abalones
ND
2006Heterosigma akashiwo (27,800)red sea bream, striped jackNDND
2006Chattonella marina (ND)Karenia mikimotoi
(52,580)
greater amberjack, red sea breamgreater amberjack 2,000 fishes, red sea bream 300 fishesND
2007Chattonella marina (15,400)Japanese amberjack, greater amberjackJapanese amberjack 40 fishes, greater amberjack 40 fishes20
2008Chattonella spp. (18,700)Japanese amberjack, greater amberjack, red sea bream, striped jackND5,856
2009Chattonella spp. (13,320)Japanese amberjackNDND
2009Heterosigma akashiwo (12,400)striped jack220 fishesND
2010Chattonella marina (6,250)Karenia mikimotoi (1,640)yellowtail1,500 fishesND
2011Chattonella spp. (16,500)Japanese amberjack,
greater amberjack, bluefin tuna
Japanese amberjack 2,200 kg, greater amberjack 6,960 kg, bluefin tuna 4.2 kg8,371
2011Chattonella spp. (3,080)Karenia mikimotoi (1,170)Japanese amberjack20,200 kg14,650
2012Chattonella spp. (5,230)Fibrocapsa japonica (1,080)Karenia mikimotoi (8,875)Dictyocha fibula (4,690)yellowtail, greater amberjack, red sea breamyellowtail 50 fishes, greater amberjack 504 fishes, red sea bream 773 fishesND
2012Chattonella spp. (5,230)Fibrocapsa japonica
(1,080)
Karenia mikimotoi
(27,300)
Dictyocha fibula (4,690)
2013Heterosigma akashiwo (515,000)greater amberjack5 fishesND
2014Chattonella marina (6,800)greater amberjack, red sea breamgreater amberjack 10,000 fishes, red sea bream 172 fishesND
2014Chattonella marina (6,800)
2015Chattonella
spp. (61)
Japanese amberjack, greater amberjack, red sea breamJapanese amberjack 2,900 fishes, greater amberjack 6,990 fishes, red sea bream 18,400 fishes23,890
2015Chattonella spp. (170,000)Karenia mikimotoi (ND)
2015Chattonella spp. (11,300)Karenia mikimotoi (ND)
2015Chattonella spp. (4,900)Karenia mikimotoi (ND)
2016Pseudochatton
ella verruculosa
(450)
greater amberjack110 fishesND
2017Heterosigma akashiwo (20,500)red sea bream2,900 fishes2,540
2017Chattonella spp. (6,650)yellowtail, greater amberjack, bluefin tunayellowtail 3,500 fishes, greater, amberjack 500 fishes, bluefin tuna 60 fishes6,330

Summary of the dominant HAB species of the red tides and the economic damage to fish aquaculture in Uranouchi Inlet, compiled by the Kochi Prefectural Fisheries Experiment Station.

ND, No data.

HAB species highlighted by bold: HAB species detected in the metabarcoding that were included in this study.

HAB species shown by fine: HAB species detected by metabarcoding but excluded from analysis in this study.

Water quality survey results from 1980 to 2020 showed that DIN-N, DON-N, DOP-P, T-N and T-P stayed high in 2005, while inorganic nitrogen (NH4-N, NO2-N, NO3-N and DIN-N) and inorganic phosphorus (PO4-P) were intermittently high from 1980 to 2020 (Table 3).

Table 3

YearNH4-N(mg/L)NO2-N(mg/L)NO3-N(mg/L)PO4-P(mg/L)DIN- N(mg/L)DON- N(mg/L)DOP- P(mg/L)T-N(mg/L)T-P(mg/L)
19800.0800.0090.0340.0280.123NDaNDaNDaNDa
19850.1190.0040.0080.0570.1310.1280.0140.2600.070
19870.0860.1420.0430.0770.2710.0680.0460.3390.123
19900.1840.0180.0090.0820.2110.0920.0040.3030.086
19950.1960.0030.0050.0740.2040.1220.0120.3260.086
20000.0130.1210.0410.0670.1750.1020.0110.2770.078
2005NDaNDaNDa0.1400.3650.8400.1191.2050.259
20100.0730.0050.0050.0180.0840.1890.0110.2720.029
20150.1580.0100.0070.0300.1750.0630.0090.2380.038
20200.0030.1910.0530.0620.2470.0670.0080.3140.070

Summary of water quality survey results in Mitsumatsu station near Menokuso Station in Uranouchi Inlet, where the core sample used in this study was collected, conducted by Kochi Prefectural Fisheries Experiment Station and Fisheries Research Institute, Japan Fisheries Research and Education Agency.

a

Data not available.

Data from 2007 onward are available to the public online page in Kochi Prefectural Fisheries Experiment Station website written in Japanese (https://www.pref.kochi.lg.jp/soshiki/040409/akashiojoho.html).

3.4 Vertical distribution of HAB species

The vertical distribution of HAB species analyzed via a heatmap revealed that the eleven HAB species could be divided into three groups (Figure 1). The first group was composed of six species found in samples from almost all the sediment layers: A. hiranoi/pseudogonyaulax, C. marina complex, F. japonica, H.circularisquama’, H.akashiwo’ and Skeletonema spp.

The second group of A. affine, A. pacificum (Group IV), and A. tamiyavanichii was not detected or was detected at low abundance in the upper layers of the core sample (Figure 1, URA01–08), whereas these species were detected in the deeper layers (under URA09 and URA10, whose years of occurrence were estimated to be 1980s).

The third group was composed of two HAB species, A. leei and A.poporum’, which were not detected in the deep layers, unlike the URA10 and URA11 samples, respectively, but were detected in the upper layers (Figure 1, URA01–URA11).

4 Discussion

4.1 DNA of HABs found by metabarcoding

Among the detected HAB species, Alexandrium hiranoi is known to form resting cysts in the winter and can remain dormant until the environmental conditions become suitable for germination (). A. leei (; ), A. pseudogonyaulax (; ; ; ), A. affine, A. pacificum (Group IV) and A. tamiyavanichii are also known to form cysts (; ). The following other HAB species are also known to form resting cysts in the sediment: A. poporum (; ), C. marina complex (; ; ), F. japonica (; ), H. circularisquama (), H. akashiwo (; ) and Skeletonema spp (; ; ). Therefore, those DNAs detected in the sediment samples have the possibility of originating from cysts or from DNA adsorbed on humic acids (; ; ) in the sediment samples.

4.2 Insights into the occurrence trends of HAB species group

From the vertical distribution of eighteen HAB species analyzed by heatmap, the first six HAB species group (A. hiranoi/pseudogonyaulax, C. marina complex, F. japonica, H.circularisquama’, H.akashiwo’ and Skeletonema spp.) which appeared in almost every sediment sample suggest that these six cyst-forming species occurred continuously throughout the ages, and DNA derived from the cysts or cells were deposited in the bottom sediment resulting in their detection in all sediment samples. Since 1984, when records began to be kept by the Kochi Prefectural Fisheries Experimental Station, four genera, Chattonella, Fibrocapsa, Heterocapsa, and Heterosigma, have repeatedly formed red tides and caused economic damage to aquaculture (~60 million JPY, Table 2). Although there are no records prior to 1984, these records after 1984 seem to correspond to the existence of those four genera in the sediments during that period (Figure 1, URA01–URA09).

According to Kochi Prefectural Fisheries Experimental Station, four Alexandrium species (A. affine, A. pacificum (Group IV), A. tamiyavanichii and A. leei) detected by metabarcoding have not been reported by direct cell counting, but three Raphidophyta (genera Chattonella, Fibrocapsa, and Heterosigma) have been reported (Table 2). The reason for this difference is the number of copies of 18S rDNA per cell in Alexandrium spp. and Raphidophyta. It is known that the copy number of 18S rDNA per cell in the genus Alexandrium is higher than that in Raphidophyta (). Therefore, it is likely that metabarcoding would have detected Raphidophyta but Alexandrium was not. This is a weakness of the occurrence analysis by metabarcoding and should be analyzed by quantitative metabarcoding in the future (; ; ).

The reason why A.poporum’ was detected by metabarcoding but its occurrence has not been recorded may be because the size of this species is small and difficult to identify under microscopic observation (; ). Considering these issues, analysis of HAB species in bottom sediments by metabarcoding is useful for clarifying the occurrence history of HAB species.

In relation with the second HAB species group (A. affine, A. pacificum (Group IV), and A. tamiyavanichii) in the heatmap, Alexandrium spp. blooms occur on a large scale in Osaka Bay and Hiroshima Bay in the Seto Inland Sea, Japan, when nutrient concentrations such as DIN and PO4 are less than 12.8 μM and 0.4 μM, respectively (; ). Considering these issues, it has been reported that conditions suitable for Alexandrium spp. proliferation may involve oligotrophic or mesotrophic waters rather than eutrophic waters (; , ; ). Therefore, the bloom formation of the Alexandrium species in Uranouchi Inlet may have been suppressed by eutrophication caused by aquaculture after 1977–1988 (Table 3), as discussed later.

There are two possibilities for why the third HAB species group (A. leei and A.poporum’) in the heatmap were not detected in deeper samples than the URA11 and URA12 samples, whose years estimated by radiometric dating () were 1977 and 1954. First, these two species did not occur in Uranouchi Inlet prior to 1977 or 1954 and appeared after those years; second, the cysts that formed prior to 1977 or 1954 might have decomposed since the cysts of these two HAB species are not highly durable. Regarding the first possibility, yellowtail aquaculture started in Uranouchi Inlet in 1959, and the aquaculture industry may have caused environmental changes such as eutrophication, as discussed later in the enclosed inlet, which may have enhanced bloom formation in these two species. The cyst durability of these two species should be investigated to clarify which possibility is conceivable.

4.3 Replacement of HAB species groups in the sediment of Uranouchi Inlet

Possible causes of the change in HAB species composition after 1977–1988 (URA09–11) include the following two possibilities: first, eutrophication of Uranouchi Inlet due to the start of aquaculture, and second, climate change, such as global warming. Regarding the first possibility, the total N (T-N) and total P (T-P) concentrations in Uranouchi Inlet in 1985 were 0.260 mg/L and 0.070 mg/L, respectively (Table 3). These values suggest that the seawaters in Uranouchi Inlet were eutrophicated or polluted at that time, based on the criterion of eutrophication (T-N: 0.220– 0.650 mg/L, T-P: 0.03–0.09 mg/L, ) and pollution in coastal waters (‘low-level’ T-N pollution: 0.252–0.308 mg/L; and ‘very high level’ T-P pollution: > 0.031 mg/L, ). It is possible that the eutrophication in Uranouchi Inlet may have occurred as a result of the proliferation of aquaculture in Uranouchi Inlet from the 1960s to the 1970s, which resulted in changes in HAB species composition from 1977–1988. However, information on nutrient concentrations in the years prior to the 1980s is not available. This hypothesis is supported by the finding that Skeletonema spp., a known indicator of eutrophication in the Seto Inland Sea of Japan (; ; , , ), have been detected in greater numbers in Uranouchi Inlet since 1977–1988 (Figure 1). On the other hand, there is a gap of more than a decade between the start of aquaculture in Uranouchi Inlet (1959) and the transition timing of the HAB species groups occurred (1977– 1988). This gap may be due to eutrophication caused by nutrients increasing beyond the environmental capacity while the aquaculture was gradually expanded since the start of aquaculture was not sudden on a large scale.

Second, the sea surface temperature (SST) around Japan has increased due to global warming, and the annual average SST in the northwestern Pacific around Japan has shown an increasing trend (1.24 °C/100 years, ). The annual average SST in Uranouchi Inlet increased by 0.19 °C/decade from the 1970s to the 2010s (). Such SST trends in Uranouchi Inlet and nearby sea areas may increase blooms of HAB species such as A. leei, which have been reported to occur in tropical and subtropical areas, such as Malaysia (), Singapore (), Thailand (), Vietnam (), and China (). This hypothesis was supported by the report that A. leei recently formed blooms and caused fish mortality in Nomi Bay in 2017 (), which is close to Uranouchi Inlet. Although it is difficult to directly link such changes in the bloom formation of HAB species with global warming, it may be important to consider global warming as at least one of the factors that caused the changes in the occurrence trends of HAB species in Uranouchi Inlet observed in this study.

In this study, we revealed the presence of eleven HAB species, with notable shifts from approximately 1977–1988 in Uranouchi Inlet, Kochi, Japan. This shift corresponded to two hypotheses: the development of aquaculture and the resulting eutrophication, or sea surface temperature rising due to global warming. Moreover, metabarcoding using vertical core sediment samples provides footprints of how HAB species composition has changed and maybe be affected by anthropogenic environmental changes.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Author contributions

HF: Conceptualization, Writing – original draft, Methodology, Visualization, Data curation, Formal analysis, Investigation. CG: Methodology, Data curation, Writing – original draft. TN: Data curation, Writing – original draft. KT: Writing – original draft, Resources. KK: Formal analysis, Writing – original draft, Data curation. TK: Data curation, Writing – original draft, Formal analysis. KN: Writing – original draft, Funding acquisition. MA: Writing – review & editing, Writing – original draft, Conceptualization, Supervision, Funding acquisition, Visualization, Validation.

Funding

The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by Ministry of Agriculture, Forestry and Fisheries (Project Number: JP005317).

Acknowledgments

We thank Kohei Ohnishi for allowing us to use his facilities and for this technical support for MiSeq sequencing. We also thank Michiko Takahashi for sharing sediment samples of Uranouchi Inlet. We thank Kazuno Arai and Masafumi Murayama for providing radiometric measurements and estimated dating data of sediment samples.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/frpro.2025.1612811/full#supplementary-material

References

  • 1

    AfganE.BakerD.BatutB.van den BeekM.BouvierD.ČechM.et al. (2018). The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2018 update. Nucleic Acids Res.46, W537W544. doi: 10.1093/nar/gky379

  • 2

    AndersonD. M.AlpermannT. J.CembellaA. D.CollosY.MasseretE.MontresorM. (2012). The globally distributed genus Alexandrium: Multifaceted roles in marine ecosystems and impacts on human health. Harmful Algae.14, 1035. doi: 10.1016/j.hal.2011.10.012

  • 3

    ArmbrechtL.BolchC. J. S.PaineB.CooperA.McMinnA.WoodwardC.HallegraeffG. (2024). Recovering sedimentary ancient DNA of harmful dinoflagellates accumulated over the last 9000 years off Eastern Tasmania, Australia. ISME Commun.4. doi: 10.1093/ismeco/ycae098

  • 4

    Astuya-VillalónA.RamírezA. E.AballayA.ArayaJ.SilvaJ.UlloaV.et al. (2015). Neurotoxin-like compounds from the ichthyotoxic red tide alga Heterosigma akashiwo induce a TTX-like synaptic silencing in mammalian neurons. Harmful Algae.47, 18. doi: 10.1016/j.hal.2015.04.006

  • 5

    Astuya-VillalónA.RiveraA.Vega-DrakeK.AburtoC.CruzatF.UlloaV.et al. (2018). Study of the ichthyotoxic microalga Heterosigma akashiwo by transcriptional activation of sublethal marker Hsp70b in Transwell co-culture assays. PloS One.13, e0201438. doi: 10.1371/journal.pone.0201438

  • 6

    Astuya-VillalónA.LópezB.AvelloV.RiveraA.Aballay-GonzálezA.UlloaV.et al. (2023). In vitro evaluation of the potential allelopathic and ichthyotoxic effect of the raphidophyte Heterosigma akashiwo and the dinoflagellate Alexandrium catenella. Mar. Environ. Res.183, 105800. doi: 10.1016/j.marenvres.2022.105800

  • 7

    BoereA. C.AbbasB.RijpstraW. I. C.VersteeghG. J. M.VolkmanJ. K.Sinninghe DamstÉJ. S.et al. (2009). Late-Holocene succession of dinoflagellates in an Antarctic fjord using a multiproxy approach: Paleoenvironmental genomics, lipid biomarkers and palynomorphs. Geobiology.7, 265281. doi: 10.1111/j.1472-4669.2009.00202.x

  • 8

    BoereA. C.Sinninghe DamstéJ. S.RijpstraW. I. C.VolkmanJ. K.CoolenM. J. L. (2011). Sourcespecific variability in post-depositional DNA preservation with potential implications for DNA based paleoecological records. Org. Geochem.42, 12161225. doi: 10.1016/J.ORGGEOCHEM.2011.08.005

  • 9

    BorsatoG. T.SalgueiroF.De’CarliG. A. L.MoraisA. M.GoulartA. S.de PaulaJ. C.et al. (2023). Taxonomy and abundance of epibenthic Prorocentrum (Dinophyceae) species from the tropical and subtropical Southwest Atlantic Ocean including a review of their global diversity and distribution. Harmful Algae.127, 102470. doi: 10.1016/j.hal.2023.102470

  • 10

    BrosnahanM. L.FischerA. D.LopezC. B.MooreS. K.AndersonD. M. (2020). Cyst-forming dinoflagellates in a warming climate. Harmful Algae.91, 101728. doi: 10.1016/j.hal.2019.101728

  • 11

    BrownE. R.MooreS. G.GaulD. A.KubanekJ. (2021). Differentiating toxic and nontoxic congeneric harmful algae using the non-polar metabolome. Harmful Algae.110, 102129. doi: 10.1016/J.HAL.2021.102129

  • 12

    CamachoC.CoulourisG.AvagyanV.MaN.PapadopoulosJ.BealerK.et al. (2009). BLAST+: architecture and applications. BMC Bioinformatics.10, 421. doi: 10.1186/1471-2105-10-421

  • 13

    CoolenM. J. L.OrsiW. D.BalkemaC.QuinceC.HarrisK.SylvaS. P.et al. (2013). Evolution of the plankton paleome in the Black Sea from the Deglacial to Anthropocene. Proc. Natl. Acad. Sci. U. S. A.110, 86098614. doi: 10.1073/PNAS.1219283110/SUPPL_FILE/SAPP.PDF

  • 14

    CucchiariE.PistocchiR.PezzolesiL.PennaA.BattocchiC.CerinoF.et al. (2010). Resting cysts of Fibrocapsa japonica (Raphidophyceae) from coastal sediments of the northern Adriatic Sea (Mediterranean Sea). Harmful Algae.10, 8187. doi: 10.1016/j.hal.2010.07.003

  • 15

    de BoerM. K.TylM. R.FuM.KulkG.LiebezeitG.TomasC. R.et al. (2009). Haemolytic activity within the species Fibrocapsa japonica (Raphidophyceae). Harmful Algae.8, 699705. doi: 10.1016/J.HAL.2012.03.005

  • 16

    DzhembekovaN.MonchevaS.IvanovaP.SlabakovaN.NagaiS. (2018). Biodiversity of phytoplankton cyst assemblages in surface sediments of the Black Sea based on metabarcoding. Biotechnol. Biotechnol. Equip.32, 15071513. doi: 10.1080/13102818.2018.1532816

  • 17

    EllegaardM.RibeiroS. (2018). The long-term persistence of phytoplankton resting stages in aquatic ‘seed banks.’. Biol. Rev.93, 166183. doi: 10.1111/brv.12338

  • 18

    EngesmoA.EikremW.SeoaneS.SmithK.EdvardsenB.HofgaardA.et al. (2016). New insights into the morphology and phylogeny of Heterosigma akashiwo (Raphidophyceae), with the description of. Heterosigma minor sp. nov. Phycologia.55, 279294. doi: 10.2216/15-115.1

  • 19

    FeifelK. M.FletcherS. J.WatsonL. R.MooreS. K.LessardE. J. (2015). Alexandrium and Scrippsiella cyst viability and cytoplasmic fullness in a 60-cm sediment core from Sequim Bay, WA. Harmful Algae.47, 5665. doi: 10.1016/j.hal.2015.05.009

  • 20

    FeifelK. M.MooreS. K.HornerR. A. (2012). An Alexandrium spp. cyst record from Sequim Bay, Washington State, USA, and its relation to past climate variability. J. Phycol.48, 550558. doi: 10.1111/j.1529-8817.2012.01175.x

  • 21

    Flores-LeñeroA.Vargas-TorresV.Paredes-MellaJ.NorambuenaL.FuenzalidaG.Lee-ChangK.et al. (2022). Heterosigma akashiwo in patagonian fjords: genetics, growth, pigment signature and role of PUFA and ROS in ichthyotoxicity. Toxins14, 577. doi: 10.3390/toxins14090577

  • 22

    FunakiH.GaonkarC. C.KataokaT.NishimuraT.TanakaK.YanagidaI.et al. (2022). Horizontal and vertical distribution of Gambierdiscus spp. (Dinophyceae) including novel phylotypes in Japan identified by 18S rDNA metabarcoding. Harmful Algae.111, 102163. doi: 10.1016/J.HAL.2021.102163

  • 23

    GuH.LuoZ.KrockB.WittM.TillmannU. (2013a). Morphology, phylogeny and azaspiracid profile of Azadinium poporum (Dinophyceae) from the China Sea. Harmful Algae.21–22, 6475. doi: 10.1016/J.HAL.2012.11.009

  • 24

    GuH.ZengN.LiuT.YangW.MüllerA.KrockB. (2013b). Morphology, toxicity, and phylogeny of Alexandrium (Dinophyceae) species along the coast of China. Harmful Algae.27, 6881. doi: 10.1016/j.hal.2013.05.008

  • 25

    GuillouL.BacharD.AudicS.BassD.BerneyC.BittnerL.et al. (2013). The Protist Ribosomal Reference database (PR2): A catalog of unicellular eukaryote Small Sub-Unit rRNA sequences with curated taxonomy. Nucleic Acids Res.41, D597D604. doi: 10.1093/nar/gks1160

  • 26

    HallegraeffG. M.AndersonD. M.CembellaA. D. (2003). “Manual on harmful marine microalgae,” in Monographs on oceanographic methodology, vol. 11. (UNESCO publishing, Paris, France).

  • 27

    HärnströmK.EllegaardM.AndersenT. J.GodheA. (2011). Hundred years of genetic structure in a sediment revived diatom population. Proc. Natl. Acad. Sci. U. S. A.108, 42524257. doi: 10.1073/pnas.1013528108

  • 28

    HashimotoT.MatsuokaS.YoshimatsuS.MikiK.NishiboriN.NishioS.et al. (2002). First paralytic shellfish poison (PSP) infestation of bivalves due to toxic dinoflagellate Alexandrium tamiyavanichii, in the southeast coasts of the Seto Inland Sea, Japan. J. Food Hyg. Soc Japan.43, 15. doi: 10.3358/shokueishi.43.1

  • 29

    HoriK.MineT.MasudaY. (2019). The population dynamic and environmental characteristic of Skeletonema spp. causing pyropia bleaching in the Ariake Sea off Saga Prefecture (In Japanese). Bull. Saga. Prefect. Ariake. Fish. Res. Dev. Cent.3. 29, 2529. Available at: https://www.pref.saga.lg.jp/kiji00371873/3_71873_152851_up_ng18m77n.pdf (Accessed April 14, 2024).

  • 30

    HoriguchiT. (1995). Heterocapsa circularisquama sp. nov. (Peridiniales, Dinophyceae): A new marine dinoflagellate causing mass mortality of bivalves in Japan. Phycol. Res.43, 129136. doi: 10.1111/j.1440-1835.1995.tb00016.x

  • 31

    ImaiI.YamaguchiM.HoriY. (2006). Eutrophication and occurrences of harmful algal blooms in the Seto Inland Sea, Japan. Plankton Benthos Res.1, 7184. doi: 10.3800/pbr.1.71

  • 32

    ImaiI.YamaguchiM. (2012). Life cycle, physiology, ecology and red tide occurrences of the fishkilling raphidophyte Chattonella. Harmful Algae.14, 4670. doi: 10.1016/j.hal.2011.10.014

  • 33

    ImaiI.InabaN.YamamotoK. (2021). Harmful algal blooms and environmentally friendly control strategies in Japan. Fish. Sci.87, 437464. doi: 10.1007/s12562-021-01524-7

  • 34

    IshikawaA.TakeiY.IshiiK.YamaguchiM. (2022). Population dynamics of Chattonella (Raphidophyceae), causative flagellates of noxious red tides in Ago Bay, central Japan, with an emphasis on cyst germination. Plankton Benthos Res.17, 383392. doi: 10.3800/pbr.17.383

  • 35

    ItakuraS.YamaguchiM. (2007). Environmental change and occurrence mechanism of harmful algal blooms in the seto inland sea (in Japanese with english abstract). Japanese J. Benthol.62, 5761. doi: 10.5179/benthos.62.57

  • 36

    ItakuraS.YamaguchiM.YoshidaM.FukuyoY. (2002). The seasonal occurrence of Alexandrium tamarense (Dinophyceae) vegetative cells in Hiroshima Bay, Japan. Fish. Sci.68, 7786. doi: 10.1046/J.1444-2906.2002.00392.X

  • 37

    IwasakiH. (1971). Studies on the red tide flagellates—VI - On Eutreptiella sp. and Exuviaella sp. appeared in Bingo-Nada, the Seto Inland Sea, in 1970 (in Japanese with English abstract). J. Oceanogr. Soc Japan.27, 152157. doi: 10.1007/BF02109134

  • 38

    Japan Meteorological Agency (2023). Climate change monitoring report 2022 (Tokyo: Japan Meteorological Agency). Available at: https://www.jma.go.jp/jma/en/NMHS/ccmr/ccmr2022.pdf.

  • 39

    KatanoT.YoshinoK.ItoY.HayamiY. (2014). Relationship between the number of cysts that germinate and the occurrence of red tides in the inner part of the Ariake Sea (In Japanese with English abstract). Bull. Plankton Soc. Japan.61, 814. doi: 10.24763/bpsj.61.1_8

  • 40

    KentM. L.WhyteJ. N. C.LaTraceC. (1995). Gill lesions and mortality in seawater pen-reared Atlantic salmon Salmo salar associated with a dense bloom of Skeletonema costatum and Thalassiosira species. Dis. Aquat. Organ.22, 7781. doi: 10.3354/dao022077

  • 41

    KitaT.FukuyoY.TokudaH.HiranoR. (1985). Life history and ecology of Goniodoma pseudogoniaulax (Pyrrhophyta) in a rockpool. Bull. Mar. Sci.37, 643651.

  • 42

    KodamaM.FukuyoY.OgataT.IgarashiT.KamiyaH.MatsuuraF. (1982). Comparison of toxicities of Protogonyaulax cells of various sizes. Bull. Japanese Soc. Sci. Fish.48, 567571. doi: 10.2331/suisan.48.567

  • 43

    KrockB.TillmannU.PotvinÉ.JeongH. J.DrebingW.KilcoyneJ.et al. (2015). Structure elucidation and in vitro toxicity of new azaspiracids isolated from the marine dinoflagellate Azadinium poporum. Mar. Drugs13, 66876702. doi: 10.3390/md13116687

  • 44

    LandsbergJ. H. (2002). The effects of harmful algal blooms on aquatic organisms. Rev. Fish. Sci.10, 113390. doi: 10.1080/20026491051695/ASSET//CMS/ASSET/3F871394-863B-45E1-B8CC-34518DF2398F/20026491051695.FP.PNG

  • 45

    LassusP.ChomératN.HessP.NézanE. (2016). Toxic and harmful microalgae of the world ocean (Denmark: IOC/UNESCO).

  • 46

    LewisD. A.SimpsonR.HermesA.BrownA.LlamasB. (2023). More than dirt: Sedimentary ancient DNA and Indigenous Australia. Mol. Ecol. Resour.25, 19. doi: 10.1111/1755-0998.13835

  • 47

    LiT. S.YuR. C.ZhouM. J. (2011). Short-term effects of different nitrogen substrates on growth and toxin production of dinoflagellate Alexandrium catenella Balech (strain ACDH). Harmful Algae.12, 4654. doi: 10.1016/J.HAL.2011.08.011

  • 48

    LimP. T.LeawC. P.UsupG.KobiyamaA.KoikeK.OgataT. (2006). Effects of light and temperature on growth, nitrate uptake, and toxin production of two tropical dinoflagellates: Alexandrium tamiyavanichii and Alexandrium minutum (Dinophyceae). J. Phycol.42, 786799. doi: 10.1111/j.1529-8817.2006.00249.x

  • 49

    LiuM.TillmannU.DingG.WangA.GuH. (2023). Metabarcoding revealed a high diversity of Amphidomataceae (Dinophyceae) and the seasonal distribution of their toxigenic species in the Taiwan Strait. Harmful Algae.124, 102404. doi: 10.1016/J.HAL.2023.102404

  • 50

    LundholmN.BernardC.ChurroC.EscaleraL.HoppenrathM.IwatakiM.et al. (2009). IOC-UNESCO taxonomic reference list of harmful micro algae. Available online at: https://www.marinespecies.org/hab (Accessed February 26, 2025).

  • 51

    LundholmN.RibeiroS.AndersenT. J.KochT.GodheA.EkelundF.et al. (2011). Buried alive - Germination of up to a century-old marine protist resting stages. Phycologia.50, 629640. doi: 10.2216/11-16.1

  • 52

    LuoZ.KrockB.MertensK. N.NézanE.ChomératN.BilienG.et al. (2017). Adding new pieces to the Azadinium (Dinophyceae) diversity and biogeography puzzle: Nontoxigenic Azadinium zhuanum sp. nov. from China, toxigenic A. poporum from the Mediterranean, and a non-toxigenic A. dalianense from the French Atlantic. Harmful Algae.66, 6578. doi: 10.1016/J.HAL.2017.05.001

  • 53

    LuoZ.KrockB.GiannakourouA.VenetsanopoulouA.PagouK.TillmannU.et al. (2018). Sympatric occurrence of two Azadinium poporum ribotypes in the Eastern Mediterranean Sea. Harmful Algae.78, 7585. doi: 10.1016/J.HAL.2018.08.003

  • 54

    MatsuyamaY. (2012). Impacts of the harmful dinoflagellate Heterocapsa circularisquama bloom on shellfish aquaculture in Japan and some experimental studies on invertebrates. Harmful Algae.14, 144155. doi: 10.1016/j.hal.2011.10.019

  • 55

    McQuoidM. R.HobsonL. A. (1996). Diatom resting stages. J. Phycol.32, 889902. doi: 10.1111/j.0022-3646.1996.00889.x

  • 56

    Mehdizadeh AllafM. (2023). Heterosigma akashiwo, a fish-killing flagellate. Microbiol. Res. (Pavia).14, 132147. doi: 10.3390/microbiolres14010012

  • 57

    Mehdizadeh AllafM.TrickC. G. (2023). Insights into Cellular Localization and Environmental Influences on the Toxicity of Marine Fish-Killing Flagellate, Heterosigma akashiwo. Int. J. Mol. Sci.24, 10333. doi: 10.3390/ijms241210333

  • 58

    MinamiuraN.YamaguchiS. (2019). Relationship between physical environment and 3 phytoplankton species, Skeletonema spp., Eucampia zodiacus, Asteroplanus karianus causing color bleaching of cultured nori in the Ariake Sea during winter (In Japanese with English abstract). J. Jpn. Soc. Civil Eng., Ser. B2 (Coast. Eng.).75, 991996. doi: 10.2208/kaigan.75.I_991

  • 59

    Ministry of AgricultureForestry and Fisheries (Japan) (2018). Statistics on Marine Fishery Production (in Japanese). Available at: https://www.e-stat.go.jp/stat-search/files?page=1&layout=datalist&toukei=00500216&tstat=000001015174&cycle=7&year=20180&month=0&tclass1=000001015175&tclass2=000001136043&tclass3val=0 (Accessed April 14, 2024).

  • 60

    MiyazonoA.NagaiS.KudoI.TanizawaK. (2012). Viability of Alexandrium tamarense cysts in the sediment of Funka Bay, Hokkaido, Japan: Over a hundred year survival times for cysts. Harmful Algae.16, 8188. doi: 10.1016/j.hal.2012.02.001

  • 61

    MontresorM. (1995). The life history of Alexandrium pseudogonyaulax (Gonyaulacales, Dinophyceae). Phycologia.34, 444448. doi: 10.2216/i0031-8884-34-6-444.1

  • 62

    MontresorM.MarinoD. (1996). Modulating effect of cold-dark storage on excystment in Alexandrium pseudogonyaulax (Dinophyceae). Mar. Biol.127, 5560. doi: 10.1016/S0040-4039(00)86674-5

  • 63

    MurakamiM.MakabeK.YamaguchiK.KonosuS.WälchliM. R. (1988). Goniodomin a, a novel polyether macrolide from the dinoflagellate goniodoma pseudogoniaulax. Tetrahedron Lett.29, 11491152. doi: 10.1016/S0040-4039(00)86674-5

  • 64

    MurakamiM.OkitaY.MatsudaH.OkinoT.YamaguchiK. (1998). From the dinoflagellate Alexandrium hiranoi. Phytochemistry.48, 8588. doi: 10.1016/S0031-9422(97)00756-5

  • 65

    NatsuikeM.ShiraishiT.IshiiK.-I.YamamotoK.NakajimaM.SawayamaS.et al. (2018a). Different Nutrient Availabilities of Surface and Bottom Water under Nutrient-depleted Conditions during Bloom Formation of the Toxic Dinoflagellate Alexandrium tamarense in Osaka Bay, Japan. Bull. Fish. Sci. Hokkaido Univ.68, 716. doi: 10.14943/bull.fish.68.1.7

  • 66

    NatsuikeM.YamamotoK.NakajimaM.SawayamaS.ImaiI. (2018b). Comparison of nutrient availabilities between the toxic dinoflagellate Alexandrium tamarense and the non-toxic diatom Skeletonema sp. in Osaka Bay, Japan (In Japanese with English abstract). Bull. Fish. Sci. Hokkaido Univ.68, 1726. doi: 10.14943/bull.fish.68.1.17

  • 67

    Nguyen-NgocL. (2004). An autecological study of the potentially toxic dinoflagellate Alexandrium affine isolated from Vietnamese waters. Harmful Algae.3, 117129. doi: 10.1016/S1568-9883(03)00062-3

  • 68

    NishikawaT.HoriY.NagaiS.MiyaharaK.NakamuraY.HaradaK.et al. (2010). Nutrient and phytoplankton dynamics in Harima-Nada, eastern Seto Inland Sea, Japan during a 35-year period from 1973 to 2007. Estuar. Coast.33, 417427. doi: 10.1007/s12237009-9198-0

  • 69

    PedersenM. W.Overballe-PetersenS.ErminiL.SarkissianC. D.HaileJ.HellstromM.et al. (2015). Ancient and modern environmental DNA. Phil. Trans. R. Soc. B, Biol. Sci.370, 111. doi: 10.1098/rstb.2013.0383

  • 70

    R Core Team (2023). R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. Available at: https://www.R-project.org. (Accessed April 14, 2024).

  • 71

    RStudio Team (2023). RStudio: Integrated Development Environment for R. Posit Software, PBC, Boston, MA. Available at: http://www.posit.co/. (Accessed April 14, 2024).

  • 72

    SaekiK.IhyoY.SakaiM.KunitoT. (2011). Strong adsorption of DNA molecules on humic acids. Environ. Chem. Lett.9, 505509. doi: 10.1007/s10311-011-0310-x

  • 73

    SagaraT.TaniyamaS.YoshimatsuS.TakataniT.HashimotoT.NishiboriN.et al. (2010). Toxicity and toxin profile of the dinoflagellate Alexandrium tamiyavanichii and toxic mussels in Harima-Nada of Seto Inland sea, Japan (In Japanese with English abstract). J. Food Hyg. Soc. Japan.51, 170177. doi: 10.3358/shokueishi.51.170

  • 74

    SakamotoS.LimW. A.LuD.DaiX.OrlovaT.IwatakiM. (2021). Harmful algal blooms and associated fisheries damage in East Asia: Current status and trends in China, Japan, Korea and Russia. Harmful Algae.102, 101787. doi: 10.1016/J.HAL.2020.101787

  • 75

    SatoM.InoueN.NambuR.FuruichiN.ImaizumiT.UshioM. (2021). Quantitative assessment of multiple fish species around artificial reefs combining environmental DNA metabarcoding and acoustic survey. Sci. Rep.11, 114. doi: 10.1038/S41598-021-98926-5

  • 76

    SchlossP. D.WestcottS. L.RyabinT.HallJ. R.HartmannM.HollisterE. B.et al. (2009). Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol.75, 75377541. doi: 10.1128/AEM.01541-09

  • 77

    ShikataT.TaniguchiE.SakamotoS.KitatsujiS.YamasakiY.YoshidaM.et al. (2020). Phylogeny, growth and toxicity of the noxious red-tide dinoflagellate Alexandrium leei in Japan. Reg. Stud. Mar. Sci.36, 101265. doi: 10.1016/J.RSMA.2020.101265

  • 78

    ShikataT.YuasaK.KitatsujiS.SakamotoS.AkitaK.FujinamiY.et al. (2021). Superoxide production by the red tide-producing Chattonella marina complex (Raphidophyceae) correlates with toxicity to aquacultured fishes. Antioxidants.10, 1635. doi: 10.3390/antiox10101635

  • 79

    ShiraishiT.HiroishiS.TainoS.IshikawaT.HayashiY.SakamotoS.et al. (2008). Identification of overwintering vegetative cells of the bivalve-killing dinoflagellate Heterocapsa circularisquama in Uranouchi Inlet, Kochi Prefecture, Japan. Fish. Sci.74, 128136. doi: 10.1111/j.1444-2906.2007.01502.x

  • 80

    SianoR.LassudrieM.CuzinP.BriantN.LoizeauV.SchmidtS.et al. (2021). Sediment archives reveal irreversible shifts in plankton communities after World War II and agricultural pollution. Curr. Biol.31, 26822689.e7. doi: 10.1016/J.CUB.2021.03.079

  • 81

    SmithV. H. (2003). Eutrophication of freshwater and coastal marine ecosystems: A global problem. Environ. Sci. pollut. Res.10, 126139. doi: 10.1065/espr2002.12.142

  • 82

    StenowR.OlofssonM.RobertsonE. K.KourtchenkoO.WhitehouseM. J.PlougH.et al. (2020). Resting stages of Skeletonema marinoi assimilate nitrogen from the ambient environment under dark, anoxic conditions. J. Phycol.56, 699708. doi: 10.1111/jpy.12975

  • 83

    TakahashiK.LumW. M.BenicoG.UchidaH.OzawaM.OikawaH.et al. (2021b). Toxigenic strains of Azadinium poporum (Amphidomataceae, Dinophyceae) from Japan and Vietnam, with first reports of A. poporum (ribotype A) and A. trinitatum in Asian Pacific. Phycol. Res.69, 175187. doi: 10.1111/pre.12455

  • 84

    TakahashiM.WadaK.TakanoY.MatsunoK.MasudaY.AraiK.et al. (2021a). Chronological distribution of dinoflagellate-infecting RNA virus in marine sediment core. Sci. Total Environ.770, 145220. doi: 10.1016/j.scitotenv.2021.145220

  • 85

    TanakaK.TainoS.HaraguchiH.PrendergastG.HiraokaM. (2012). Warming off southwestern Japan linked to distributional shifts of subtidal canopy-forming seaweeds. Ecol. Evol.2, 28542865. doi: 10.1002/ece3.391

  • 86

    TangY. Z.KongL.HolmesM. J. (2007). Dinoflagellate Alexandrium leei (Dinophyceae) from Singapore coastal waters produces a water-soluble ichthyotoxin. Mar. Biol.150, 541549. doi: 10.1007/S00227-006-0396-Z/FIGURES/3

  • 87

    Tavakoly SanyS. B.HashimR.RezayiM.SallehA.SafariO. (2014). A review of strategies to monitor water and sediment quality for a sustainability assessment of marine environment. Environ. Sci. pollut. Res.21, 813833. doi: 10.1007/s11356-013-2217-5

  • 88

    ThohaH.MuawanahBayu IntanM. D.RachmanA.SianturiO. R.SidabutarT.et al. (2019). Resting cyst distribution and molecular identification of the harmful dinoflagellate Margalefidinium polykrikoides (Gymnodiniales, dinophyceae) in Lampung Bay, Sumatra, Indonesia. Front. Microbiol.10. doi: 10.3389/fmicb.2019.00306

  • 89

    TillmannU.EdvardsenB.KrockB.SmithK. F.PatersonR. F.VoßD. (2018). Diversity, distribution, and azaspiracids of Amphidomataceae (Dinophyceae) along the Norwegian coast. Harmful Algae.80, 1534. doi: 10.1016/J.HAL.2018.08.011

  • 90

    TillmannU.ElbrächterM.JohnU.KrockB. (2011). A new non-toxic species in the dinoflagellate genus Azadinium: A. poporum sp. nov. Eur. J. Phycol.46, 7487. doi: 10.1080/09670262.2011.556753

  • 91

    TrikiH. z.LaabirM.MoellerP.ChomératN.Kéfi Daly-YahiaO. (2016). First report of goniodomin A production by the dinoflagellate Alexandrium pseudogonyaulax developing in southern Mediterranean (Bizerte Lagoon, Tunisia). Toxicon.111, 9199. doi: 10.1016/j.toxicon.2015.12.018

  • 92

    TsujiS.InuiR.NakaoR.MiyazonoS.SaitoM.KonoT.et al. (2022). Quantitative environmental DNA metabarcoding shows high potential as a novel approach to quantitatively assess fish community. Sci. Rep.12, 21524. doi: 10.1038/s41598-022-25274-3

  • 93

    TwinerM. J.RehmannN.HessP.DoucetteG. J. (2008). Azaspiracid shellfish poisoning: a review on the chemistry, ecology, and toxicology with an emphasis on human health impacts. Mar. Drugs6, 3972. doi: 10.3390/md20080004

  • 94

    UshioM.MurakamiH.MasudaR.SadoT.MiyaM.SakuraiS.et al. (2018). Quantitative monitoring of multispecies fish environmental DNA using highthroughput sequencing. Metabarcoding and Metagenomics.2, 115. doi: 10.3897/mbmg.2.23297

  • 95

    UsupG.PinL. C.AhmadA.TeenL. P. (2002). Alexandrium (Dinophyceae) species in Malaysian waters. Harmful Algae.1, 265275. doi: 10.1016/S1568-9883(02)00044-6

  • 96

    WangZ.PengL.XieC.WangW.ZhangY.XiaoL.et al. (2022a). Metabarcoding of harmful algal bloom species in sediments from four coastal areas of the southeast China. Front. Microbiol.13. doi: 10.3389/fmicb.2022.999886

  • 97

    WangZ.WangC.WangM.LiW.ZhongW.LiuL.et al. (2022b). Diversity and community structure of eukaryotic microalgae in surface sediments in the central Bohai Sea, China, based on a metabarcoding approach. J. Oceanol. Limnol.40, 22772291. doi: 10.1007/S00343-021-0481-7/METRICS

  • 98

    WangL.YanT.YuR.ZhouM. (2005). Experimental study on the impact of dinoflagellate Alexandrium species on populations of the rotifer Brachionus plicatilis. Harmful Algae.4, 371382. doi: 10.1016/j.hal.2004.06.014

  • 99

    YamadaM.TsurutaA.YoshidaY. (1980a). A list of phytoplankton as eutrophic level indicator (in Japanese with English abstract). Bull. Japanese Soc. Sci. Fish.46, 14351438. doi: 10.2331/suisan.46.1435

  • 100

    YamadaM.TsurutaA.YoshidaY. (1980b). Classification of Eutrophic level in Several Marine Regions (Japanese with English abstract). Bull. Japanese Soc. Sci. Fish.46, 14391444. doi: 10.2331/suisan.46.1439

  • 101

    YamadaM.UedaN.HamadaK.-I. (2011). Changes in red tide occurrence and organisms responsible for declining eutrophic level in hyper-eutrophic Dokai Bay, Japan. Nippon. Suisan. Gakkaishi.77, 647655. doi: 10.2331/suisan.77.647

  • 102

    YamaguchiM.ItakuraS.ImaiI.IshidaY. (1995). A rapid and precise technique for enumeration of resting cysts of Alexandrium spp. (Dinophyceae) in natural sediments. Phycologia.34, 207214. doi: 10.2216/i0031-8884-34-3-207.1

  • 103

    YamaguchiH.TanimotoY.HayashiY.SuzukiS.YamaguchiM.AdachiM. (2018). Bloom dynamics of noxious Chattonella spp. (Raphidophyceae) in contrastingly enclosed coastal environments: A comparative study of two coastal regions. J. Mar. Biol. Assoc. U. K.98, 657663. doi: 10.1017/S0025315417000017

  • 104

    YamamotoK. (2019). Long-Term Fluctuations in Phytoplankton and Marked Bloom of the Toxic Dinoflagellate Alexandrium tamarense in Osaka Bay, Eastern Seto Inland Sea, Japan (In Japanese with English abstract). Bull. Coast. Oceanogr.56, 6372. doi: 10.32142/ENGANKAIYO.56.2_63

  • 105

    YarimizuK.SildeverS.HamamotoY.TazawaS.OikawaH.YamaguchiH.et al. (2021). Development of an absolute quantification method for ribosomal RNA gene copy numbers per eukaryotic single cell by digital PCR. Harmful Algae.103, 102008. doi: 10.1016/j.hal.2021.102008

  • 106

    YoshimatsuS. (1987). The Cysts of Fibrocapsa japonica(Raphidophyceae) found in bottom sediment in Harima-Nada, Eastern Inland Sea of Japan (Japanese with English abstract). Bull. Plankton Soc. Japan.34, 2531.

  • 107

    ZingoneA.Oksfeldt EnevoldsenH. (2000). The diversity of harmful algal blooms: A challenge for science and management. Ocean Coast. Manage.43, 725748. doi: 10.1016/S0964-5691(00)00056-9

Summary

Keywords

metabarcoding, 18S rDNA, eutrophication, anthropogenic impact, HABs, core sample

Citation

Funaki H, Gaonkar CC, Nishimura T, Tanaka K, Kamimura K, Kaji T, Nagasaki K and Adachi M (2025) Vertical distribution of harmful algae in the sediment of Uranouchi Inlet by metabarcoding. Front. Protistol. 3:1612811. doi: 10.3389/frpro.2025.1612811

Received

16 April 2025

Accepted

30 May 2025

Published

30 June 2025

Volume

3 - 2025

Edited by

Kirsty Smith, Cawthron Institute, New Zealand

Reviewed by

Laura Biessy, Cawthron Institute, New Zealand

Tiago Pereira, University of São Paulo, Brazil

Updates

Copyright

*Correspondence: Masao Adachi,

†Present addresses: Chetan Chandrakant Gaonkar, Department of Oceanography, Texas A&M University, College Station, TX, United States; Tomohiro Nishimura, Fisheries Technology Institute, Japan Fisheries Research and Education Agency, Hatsukaichi, Japan

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics