In the published article, 'Argonne National Laboratory' was erroneously listed as a present address for author Mark D. McDonald. It should have been captured in the Affiliations section.
In the published article, there was an error in Table 1. The primer sequences for the Target group 16S rRNA were incorrectly written as "Eub338: ATCATGGTSCTGCCGCG" and "Eub518: GCCTCGATCAGRTTGTGGTT". In addition, references for all target groups were incorrect as published. The corrected Table 1 and its caption appear below:
Table 1
| Target group | Primer Name | Sequence (5’→3’) | Thermal profile | Average Amplification efficiency (R2 > 0.95) (%) | References |
|---|---|---|---|---|---|
| 16S rRNA | Eub338 | ACTCCTACGGGAGGCAGCAG | 95°C for 15 min; 95°C for 1 min, 53°C for 30 s, 72°C for 1 min × 40 cycles | 97 | (33) |
| Eub518 | ATTACCGCGGCTGCTGG | ||||
| Bacterial amoA | AOB amoA-1F | GGGGWTTCTACTGGTGGT | 95°C for 5 min; 94°C for 45 s, 60°C for 45 s, 72°C for 1.5 min × 40 cycles | 100 | (34) |
| AOB amoa-2R | CCCCTCKGSAAAGCCTTCTTC | ||||
| nirS | nirS4F | GTSAACGTSAAGGARACSGG | 94°C for 2 min; 94°C for 30 s, 58°C for 1 min, 72°C for 1 min × 40 cycles, 72°C for 10 min | 104 | (35) |
| R3cd | GASTTCGGRTGSGTCTTGA | ||||
| nirK | nirK876 | ATYGGCGGVCAYGGCGA | 94°C for 2 min; 94°C for 30 s, 58°C for 1 min, 72°C for 1 min × 40 cycles | 95 | (36,37) |
| nirK1055 | GCYTCGATVAGRTTRTGGTT | ||||
| nosZ clade I | nosZ2F | CGCRACGGCAASAAGGTSMSSGT | 50°C for 2 min, 95°C for 3 min; 95°C for 15 s, 67-62°C for 30 s, 72°C for 30 s; 95°C for 15 s, 62°C for 1 min, 72°C for 1 min × 34 cycles | 97 | (38) |
| nosZ2R | CAKRTGCAKSGCRTGGCAGAA | ||||
| nosZ clade II | clade II F | CTIGGICCIYTKCAYAC | 95°C for 2 min; 95°C for 30 s, 56°C for 30 s, 72°C for 40 s × 40 cycles | 90 | (39) |
| clade II R | GCIGARCARAAITCBGTRC |
Primer sequences and thermal profiles for total bacterial and bacterial N-cycle functional gene abundances.
Statements
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Summary
Keywords
nitrous oxide, pore-space gases, microbial abundance, semi-arid soils, no-tillage, cover crop
Citation
McDonald MD, Lewis KL, DeLaune PB, Hux BA, Boutton TW and Gentry TJ (2023) Corrigendum: Nitrogen fertilizer driven nitrous and nitric oxide production is decoupled from microbial genetic potential in low carbon, semi-arid soil. Front. Soil Sci. 3:1283367. doi: 10.3389/fsoil.2023.1283367
Received
25 August 2023
Accepted
15 September 2023
Published
22 September 2023
Volume
3 - 2023
Edited and reviewed by
Jacobo Arango, International Center for Tropical Agriculture (CIAT), Colombia
Updates
Copyright
© 2023 McDonald, Lewis, DeLaune, Hux, Boutton and Gentry.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Mark D. McDonald, mcdonaldm@anl.gov
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.