ORIGINAL RESEARCH article

Front. Mar. Sci., 02 February 2023

Sec. Global Change and the Future Ocean

Volume 10 - 2023 | https://doi.org/10.3389/fmars.2023.1101725

Contribution of the TGFβ signaling pathway to pigmentation in sea cucumber (Apostichopus japonicus)

  • LY

    Linlin Yao 1

  • BZ

    Bin Zhao 1

  • QW

    Qi Wang 1

  • XJ

    Xuyang Jiang 2

  • SH

    Sha Han 1

  • WH

    Wei Hu 1

  • CL

    Chenglin Li 1*

  • 1. Shandong Key Laboratory of Intelligent Marine Ranch (under preparation), Marine Science Research Institute of Shandong Province (National Oceanographic Center, Qingdao), Qingdao, China

  • 2. Department of Breeding Technology, Country Conson CSSC (Qingdao) Ocean Technology CO., Ltd, Qingdao, China

Abstract

Pigmentation mediated by the transforming growth factor β (TGFβ) signaling pathway is a key trait for understanding environmental adaptability and species stability. In this study, TGFβ signaling pathway members and their expression patterns in different color morphs of the sea cucumber Apostichopus japonicus were evaluated. Using a bioinformatics approach, 22 protein sequences of TGFβ signaling pathway members in A. japonicus were classified, including 14 that were identified for the first time in the species, including 7 ligands, 6 receptors, and 1 R-Smad. We further evaluated mRNA expression data for different color morphs and pigmentation periods. These results support the hypothesis that both subfamilies of the TGFβ superfamily, i.e., the TGFβ/activin/Nodal and BMP/GDF/AMH subfamilies, are involved in the regulation of pigmentation in A. japonicus. The former subfamily was complete and contributes to the different color morphs. The BMP/GDF/AMH subfamily was incomplete. BMP2/4-induced differentiation of white adipocytes was regulated by the BMP2/4–ACVR2A–Smad1 signaling pathway. These findings provide insight into the TGFβ family in early chordate evolution as well as the molecular basis of color variation in an economically valuable species.

1 Introduction

The sea cucumber Apostichopus japonicus is a commercially important marine species in China (Chen et al., 2022). Color variation, one of the most important characteristics of A. japonicus, plays a significant role in determining market price (Kang et al., 2011) and is an important trait for breeding. In China, this species is mainly green, and purple and white morphs are very rare and highly valuable (Bai et al., 2016). Extensive studies have shown that the growth and development of sea cucumber are affected by various environmental factors, such as temperature and salinity (Chen et al., 2007; Wang et al., 2007; Ji et al., 2008). There are significant differences in the tolerance of sea cucumbers with different body colors to environmental factors (Bao, 2008; Guo et al., 2020; Li et al., 2020). For example, purple A. japonicus has a wider temperature range and stronger salt tolerance, while the white morph has a higher temperature tolerance but narrower range of salinity tolerance than those of the green morph (Zhao et al., 2018; Zhu et al., 2013).

Pigmentation is a tractable and relevant trait for understanding key issues in evolutionary biology such as adaptation, speciation and the maintenance of balanced polymorphisms (Henning et al., 2013).Substantial recent research has focused on the identification of genetic pathways that determine pigmentation variation (Hubbard et al., 2010; Henning et al., 2013). Studies of animal models have found that the TGFβ signaling pathway mediates many biological processes, such as pigmentation, tissue and organ development, and stress resistance (Cheng, 2008; Hubbard et al., 2010). Recent structural, biochemical, and cellular studies have provided significant insight into the mechanisms underlying TGFβ signaling. In brief, a TGFβ ligand initiates signaling by binding to and bringing together type I and type II receptor on the cell surface. This allows receptor II to phosphorylate receptor I, which then regulates target gene expression by the phosphorylation of Smad proteins. The number and type of TGFβ family members have been evaluated in model organisms, ranging from worms and flies to mammals (Massagué and Chen, 2000; Patterson and Padgett, 2000; ten Dijke et al., 2000). Six conserved cysteine residues characteristic of the TGFβ family are encoded by 6 open reading frames in worms, 9 in flies, and 42 in humans (Linton et al., 2001).

Although studies of the TGFβ family in non-model organisms are increasing, relatively little is known about functional changes and divergence in expression patterns between invertebrates and vertebrates (Lapraz et al., 2007; Weiss and Attisano, 2013; Zheng et al., 2018). Echinoderms, which first appeared in the early Cambrian period (Bottjer et al., 2006), occupy a critical phylogenetic position for understanding the origin of chordates (Lowe et al., 2015). The radiation of echinoderms was believed to be responsible for the Mesozoic Marine Revolution (Signor and Brett, 1984). In particular, sea cucumbers are an outstanding representative of the phylum, as they have survived ice ages and are considered “living fossils” (Bottjer et al., 2006). Despite the importance of pigmentation mediated by the TGFβ signaling pathway (Cheng, 2008; Hubbard et al., 2010; Henning et al., 2013), few studies have evaluated the TGFβ signaling pathway in sea cucumbers. Only 14 ligands (some sharing the same name), 6 receptors, and 2 R-Smads have been recorded in GenBank. In addition, some loci have informal names, such as Sj-BMP2/4 (accession no. PIK56114.1 and BAC53989.1), and some were not classified in detail, e.g., putative TGFβ (accession no. PIK61515.1). Accordingly, their functions and roles in morphs with different body colors are unclear. This can be explained, in part, by poor sampling of genomes (Sodergren et al., 2006; Cameron et al., 2015; Hall et al., 2017; Sun et al., 2017; Zhang et al., 2017). In this study, the types and quantities of TGFβ signaling pathway members in A. japonicus were characterized for the first time and expression levels in different color morphs and developmental stages were evaluated, providing an important basis for analyses of functions of TGFβ signaling in invertebrates.

2 Materials and methods

2.1 Sequence analysis

All TGFβ ligand receptors and Smad protein sequences of A. japonicus available on NCBI were obtained and compared using BLAST (Basic Local Alignment Search Tool) (Tables 13). Multiple sequence alignments were analyzed using the ClustalW Multiple Alignment program (http://www.ebi.ac.uk/clustalw/). Separate trees were generated based on ligand, receptor, and SMAD amino acid sequences using the neighbor-joining (NJ) algorithm within MEGA version 7.0. The reliability of the tree was assessed by 1000 bootstrap repetitions.

Table 1

Accession no.Protein nameSpecies
PIK34829.1putative TGFβ1 likeApostichopus japonicus
QHG11580.1putative TGFβ1X1Apostichopus japonicus
PIK56215.1putative TGFβ1X1Apostichopus japonicus
XP_029964045.1TGFβ1X2Salarias fasciatus
XP_041850924.1TGFβ1X1Melanotaenia boesemani
XP_031614329.1TGFβ1Oreochromis aureus
XP_033486555.1TGFβ1X1Epinephelus lanceolatus
XP_040902844.1TGFβ1Toxotes jaculatrix
XP_033851930.2TGFβ1X1Acipenser ruthenus
XP_035241816.1TGFβ1X1Anguilla anguilla
XP_026865903.2TGFβ1X2Electrophorus electricus
XP_036440909.1TGFβ1X1Colossoma macropomum
KAG9273341.1TGFβ1X1Astyanax mexicanus
PIK45926.1BMP2AApostichopus japonicus
PIK48439.1BMP2Apostichopus japonicus
PIK57098.1BMPApostichopus japonicus
AAF19841.1BMP2/4Branchiostoma belcheri
QYF06707.1BMP2/4Holothuria scabra
PIK56114.1Sj-BMP2/4Apostichopus japonicus
BAC53989.1Sj-BMP2/4Apostichopus japonicus
AAD28038.1BMP2/4Lytechinus variegatus
ACA04460.1BMP2/4Strongylocentrotus purpuratus
ABG00199.1BMP2/4Paracentrotus lividus
BBC77411.1BMP2/4Temnopleurus reevesii
PIK37799.1BMP3/3BApostichopus japonicus
KAF3695343.1BMP3Channa argus
XP_033946079.1BMP3Pseudochaenichthys georgianus
XP_007425424.1BMP3Python bivittatus
XP_042727338.1BMP3Lagopus leucura
XP_021252303.1BMP3Numida meleagris
PIK42868.1TGFβ family member nodalApostichopus japonicus
ACF32774.1NodalHeliocidaris erythrogramma
ACF32773.1NodalHeliocidaris tuberculata
XP_036937551.1Nodal2Acanthopagrus latus
XP_034426535.1Nodal2Hippoglossus hippoglossus
KFM00388.1NodalAptenodytes forsteri
XP_035248296.1NodalAnguilla anguilla
RXN30610.1NodalLabeo rohita
QYF06711.1GDF8Holothuria scabra
AJQ81037.1GDF8Apostichopus japonicus
XP_013394669.1GDF8Lingula anatina
XP_014253049.1GDF8Cimex lectularius
XP_046672106.1GDF8Homalodisca vitripennis
RWS12911.1GDF8Dinothrombium tinctorium
XP_023223240.1GDF8Centruroides sculpturatus
QYF06710.1inhibinHolothuria scabra
PIK34215.1putative inhibin beta C chain-likeApostichopus japonicus
QYF06712.1activinHolothuria scabra
PIK48233.1putative activin B X1Apostichopus japonicus
XP_037927328.1INHβBTeleopsis dalmanni
XP_022218905.1INHβADrosophila obscura
XP_017154392.1INHβADrosophila miranda
XP_002028363.1INHβADrosophila persimilis
XP_033236864.1INHβADrosophila pseudoobscura
QYF06713.1TGFβ2Holothuria scabra
PIK61515.1putative TGFβ2Apostichopus japonicus
XP_022090565.1TGFβ2Acanthaster planci
XP_038073348.1TGFβ2Patiria miniata
BCB62973.1TGFβPatiria pectinifera
XP_041467929.1TGFβ2Lytechinus variegatus
XP_030855505.1TGFβ2Strongylocentrotus purpuratus
QAV52899.1TGFβMesocentrotus nudus
XP_041951915.1TGFβ3Alosa sapidissima
XP_042562890.1TGFβ3Clupea harengus
XP_039597176.1TGFβ3Polypterus senegalus
XP_028678165.1TGFβ3Erpetoichthys calabaricus
XP_042593951.1TGFβ2Cyprinus carpio
KAA0709699.1TGFβ2Triplophysa tibetana
XP_039388520.1TGFβ2X2Mauremys reevesii
XP_037751639.1TGFβ2Chelonia mydas
XP_005307005.1TGFβ2Chrysemys picta bellii
XP_003800184.1TGFβ2X2Otolemur garnettii
XP_008825028.1TGFβ2Nannospalax galili
CAA40672.1TGFβ2Mus musculus
XP_021016320.1TGFβ2X2Mus caroli

Ligand protein sequences included in the present study.

Table 2

Accession no.Protein nameSpecies
XP_026886611.2TβR2Electrophorus electricus
TSK92904.1TβR2Bagarius yarrelli
XP_017324951.1TβR2Ictalurus punctatus
XP_026802727.2TβR2Pangasianodon hypophthalmus
PIK56848.1putative TβR2Apostichopus japonicus
XP_033116886.1TβR2Anneissia japonica
XP_030828751.1TβR2Strongylocentrotus purpuratus
XP_038058105.1TβR2Patiria miniata
XP_033624779.1TβR2Asterias rubens
PIK56867.1putative TβR3Apostichopus japonicus
CAC5417350.1TβR3Mytilus coruscus
CAG2237547.1TβR3Mytilus edulis
XP_038129033.1TβR3Cyprinodon tularosa
XP_040482976.1TβR3X2Ursus maritimus
XP_036901372.1TβR3X1Sturnira hondurensis
XP_025893663.1TβR3Nothoprocta perdicaria
XP_005238531.1TβR3X1Falco peregrinus
XP_040466106.1TβR3X2Falco naumanni
PIK46054.1putative BMPR2Apostichopus japonicus
XP_033099609.1BMPR2Anneissia japonica
XP_790983.2BMPR2Strongylocentrotus purpuratus
XP_041459768.1BMPR2Lytechinus variegatus
XP_033624844.1BMPR2Asterias rubens
XP_038058132.1BMPR2Patiria miniata
XP_022088502.1BMPR2Acanthaster planci
PIK52453.1putative ACVR2AX2Apostichopus japonicus
XP_030828527.1ACVR2AStrongylocentrotus purpuratus
XP_041458652.1ACVR2ALytechinus variegatus
XP_038079379.1ACVR2AX1Patiria miniata
XP_033624296.1ACVR2AAsterias rubens
XP_042301709.1ACVR2AX2Sceloporus undulatus
XP_032880604.1ACVR2AX2Amblyraja radiata
XP_043550051.1ACVR2AX1Chiloscyllium plagiosum
XP_041056629.1ACVR2ACarcharodon carcharias
XP_022103314.1ACVR1X4Acanthaster planci
XP_033113857.1ACVR1X4Anneissia japonica
PIK59495.1putative ACVR1Apostichopus japonicus
NXL14502.1ACVR1Setophaga kirtlandii
NWI57693.1ACVR1Calyptomena viridis
NXY49840.1ACVR1Ceuthmochares aereus
NXB24442.1ACVR1Rhagologus leucostigma
NP_001383423.1ACVR1Gallus gallus
KFP78435.1ACVR1Apaloderma vittatum
XP_032435030.1BMPR1BX3Xiphophorus hellerii
XP_005795012.2BMPR1BXiphophorus maculatus
XP_027890208.1BMPR1BX3Xiphophorus couchianus
PIK51009.1putative BMPR1BApostichopus japonicus
XP_797469.4BMPR1BStrongylocentrotus purpuratus
XP_041485680.1BMPR1BLytechinus variegatus
XP_033644308.1BMPR1BAsterias rubens
XP_038060789.1BMPR1BPatiria miniata
XP_022089444.1BMPR1BAcanthaster planci

Receptor protein sequences included in the present study.

Table 3

Accession no.full nameSpecies
XP_041459990.1Smad4X1Lytechinus variegatus
XP_030827838.1Smad4X1Strongylocentrotus purpuratus
XP_033109387.1Smad4X2Anneissia japonica
XP_033646664.1Smad4X1Asterias rubens
XP_022081844.1Smad4X1Acanthaster planci
XP_038058605.1Smad4X1Patiria miniata
XP_032649614.1Smad4Chelonoidis abingdonii
XP_035384718.1Smad4Electrophorus electricus
XP_030421567.1Smad4X1Gopherus evgoodei
XP_035314530.1Smad4X1Cricetulus griseus
XP_016004267.1Smad4X1Rousettus aegyptiacus
XP_030885493.1Smad4Leptonychotes weddellii
XP_033127281.1Smad6Anneissia japonica
ADW95340.1Smad6Paracentrotus lividus
XP_798238.2Smad6Strongylocentrotus purpuratus
XP_022083936.1Smad6Acanthaster planci
XP_038077875.1Smad6Patiria miniata
XP_026878186.2Smad6bElectrophorus electricus
XP_015996485.2Smad6X1Rousettus aegyptiacus
XP_003500538.2Smad6X1Cricetulus griseus
XP_032621963.1Smad6Chelonoidis abingdonii
XP_030434864.1Smad6Gopherus evgoodei
XP_016003943.1Smad7X1Rousettus aegyptiacus
XP_007644509.3Smad7X1Cricetulus griseus
XP_032637417.1Smad7X1Chelonoidis abingdonii
XP_030423387.1Smad7X1Gopherus evgoodei
XP_033124235.1Smad3Anneissia japonica
XP_041460773.1Smad3Lytechinus variegatus
XP_033624249.1Smad3X1Asterias rubens
XP_022083075.1Smad3X2Acanthaster planci
XP_038076479.1Smad3X1Patiria miniata
XP_006749953.1Smad3Leptonychotes weddellii
XP_026860560.1Smad3aElectrophorus electricus
XP_015996478.1Smad3Rousettus aegyptiacus
XP_007639432.2Smad3X1Cricetulus griseus
XP_028706267.1Smad3X1Macaca mulatta
XP_030434068.1Smad3X1Gopherus evgoodei
XP_032620241.1Smad3Chelonoidis abingdonii
XP_035391548.1Smad2X1Electrophorus electricus
XP_032654336.1Smad2X1Chelonoidis abingdonii
XP_003501086.1Smad2X1Cricetulus griseus
XP_006738743.2Smad2Leptonychotes weddellii
XP_028693529.1Smad2X2Macaca mulatta
XP_036085916.1Smad2X1Rousettus aegyptiacus
PIK47643.1mothers against decapentaplegic-like protein 1Apostichopus japonicus
XP_032620791.1Smad1X2Chelonoidis abingdonii
XP_030420831.1Smad1X2Gopherus evgoodei
XP_036089426.1Smad1X1Rousettus aegyptiacus
XP_030895811.1Smad1Leptonychotes weddellii
XP_026859416.1Smad5Electrophorus electricus
XP_032631983.1Smad5Chelonoidis abingdonii
XP_030428443.1Smad5Gopherus evgoodei
XP_003503786.1Smad5Cricetulus griseus
XP_014996357.1Smad5X1Macaca mulatta
XP_015993196.1Smad5Rousettus aegyptiacus
XP_022079499.1Smad5X2Acanthaster planci
XP_033632185.1Smad5Asterias rubens
XP_038055290.1Smad5Patiria miniata
XP_041455371.1Smad5Lytechinus variegatus
XP_030836187.1Smad5Strongylocentrotus purpuratus
ACU12852.1Smad1Paracentrotus lividus
PIK47644.1Smad1Apostichopus japonicus

Smad protein sequences included in the present study.

2.2 Animals

2.2.1 Sea cucumbers of different color morphs

Healthy sea cucumbers aged 2 years and weighing 120 ± 10 g were collected from green, purple, and white cultivated populations (Figure 1). The purple and white morphs are genetically stable and have been bred by our research team for nearly 20 years.

Figure 1

2.2.2 Purple sea cucumber at different developmental stages

9 purple sea cucumbers with a body weight of >180 g were screened as the parent population. Artificial labor was stimulated by drying in the shade and running water (20.5°C). Male individuals were removed from the incubator immediately after ejaculation. All parents were removed when the egg density was 20–30 eggs/mL. Then, the water temperature was increased to 21.0 ± 0.2°C for incubation. During the incubation period, the incubator was agitated once an hour, and micro-aerated continuously for 24 h to ensure an even distribution of fertilized eggs. Marine red yeast was fed to early auricularia after hatching. When 10% to 20% of doliolaria formed, a corrugated plate frame after disinfection was placed as the attachment matrix. After the larvae were attached, they were gradually transitioned to artificial compound feed. The feeding amount was 0.5% to 2% of the body weight. Juveniles were randomly selected every 3 days after the larvae developed to pentactula and were placed in a Petri dish to observe the change in body color. The pigmentation stage was defined at the point at which 80% of individuals were completely pigmented.

2.3 mRNA expression of TGFβ signaling pathway genes mRNA in A. japonicas

9 body walls from each sample of different color morphs and purple sea cucumber at different developmental stages were peeled away carefully, flash-frozen in liquid nitrogen, and stored at −80°C for subsequent total RNA extraction. Specific primers for BMP2/4, ACVR2A, Smad1, TGFβR2, Smad2/3, and grb2 (a housekeeping gene used as an internal reference) based on known A. japonicus sequences (Table 4) were designed using Oligo 7.0. Primers were synthesized by Invitrogen Biotechnology Co., Ltd. (Shanghai, China). TRIzol Reagent was used to isolate total RNA from the body walls according to the manufacturer’s instructions (Invitrogen, Waltham, MA, USA) and contaminating genomic DNA was eliminated using RNase-free DNase (Takara, Tokyo, Japan). The RNA samples were reverse-transcribed using the Prime Script RT-PCR Kit (Takara, Tokyo, Japan). Equal amounts of cDNA were used for real-time quantitative RT-PCR using in a PikoReal 96-well RT-PCR System (Thermo Scientific., Waltham, MA, USA). Amplification was performed in a total volume of 10 μL, containing 5 μL of 2× SYBR Green master Mix, 1 μL of diluted cDNA, 0.4 μL of each primer, and 3.2 μL of PCR-grade water. The PCR cycling conditions were 95°C for 5 min followed by 35 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 1 min, and a final elongation step at 72°C for 7 min. Each sample was run in triplicate along with the internal control gene (grb2). The PCR products were visualized on a UV-transilluminator after electrophoresis on a 1.5% agarose gel containing ethidium bromide.

Table 4

GeneAccession no.Primer sequence
BMP2/4AB057451.1Forward5’- CCAAAAGGCAGAAAAGCA -3’
Reverse5’- ACCCACAATGGCAAAGTC -3’
ACVR2ABSL78_25911Forward5’- ACAGAGAAGCGTGGTGAAG -3’
Reverse5’- GGTAGTCATAGAGGGAGCCA -3’
Smad1BSL78_15508Forward5’- ATTCTCCTTTACCAGTCCAGTT -3’
Reverse5’- AGCCTTCTCCAGTTCTTCC -3’
TβR2BSL78_06251Forward5’- GAGCCGAAAGAAGACAGAAC -3’
Reverse5’- TATCGTAGAGGGAAGGACTCA -3’
Smad 2/3BSL78_11878Forward5’- GCTACCGCCTCCATCTTT -3’
Reverse5’- CCTCCATACTGTTGTCATTGG -3’
grb2C112121_gl_ilForward5’- ATCTTTCACATATTGCGAGCCAG -3’
Reverse5’- ATGACCATTCCGATGCCCTAA -3’

Oligonucleotide primers for A. japonicus.

2.4 Statistical analysis

Statistical analyses were performed using GraphPad Prism 5.0, and all data were assessed using one-way ANOVA. Differences in means between groups were assessed using Tukey’s honestly significant difference test for post hoc multiple comparisons. All data are expressed as the mean ± standard deviation (SD). Values of p < 0.05 indicated a statistically significant difference.

3 Results

3.1 Phylogenetic analysis based on ligand sequences

In a phylogenetic tree based on amino acid sequences from multiple TGFβ ligands, the ligands of the same type formed clusters. The phylogenetic tree is shown in Figure 2 and the corresponding sequences are shown in Table 1. According to the phylogenetic tree, 14 known TGFβ ligands from A. japonicus were assigned to 7 classes: TGFβ1, TGFβ2, Nodal, Activin/Inhibin, BMP2/4, BMP3, and GDF8 (Growth Differentiation Factor 8, alternative name myostatin (de Caestecker, 2004)). Notably, TGFβ2 of A. japonicus was classified as TGFβ2 but was also closely related to TGFβ3. The BMP2/4 cluster contained BMP2A, BMP2, BMP, and Sj-BMP2/4 of A. japonicus. BMP3/3B of A. japonicus was classified into BMP3. Putative activin BX1 and putative inhibin beta C chain-like of A. japonicus were included in the Activin/Inhibin cluster.

Figure 2

3.2 Phylogenetic analysis of receptors

In a phylogenetic tree based on amino acid sequences from multiple TGFβ receptors proteins, each type of receptor assembled in a cluster. The phylogenetic tree is shown in Figure 3 and corresponding sequences are shown in Table 2. According to the phylogenetic tree, six TGFβ receptors from A. japonicus were classified into six classes: TGFβR2 [transforming growth factor beta receptor 2, alternative name TβR2 (Hart et al., 2002)], TGFβR3 (transforming growth factor beta receptor 3, alternative name TβR3), BMPR1B [bone morphogenetic protein receptor type 1B, alternative name ALK6, FecB (Li et al., 2021)], BMPR2 (bone morphogenetic protein receptor type 2), ACVR1 [activin receptor type 1, alternative name ACTR1, ALK2 (Lee et al., 2017)], and ACVR2A [activin receptor type 2A, alternative name ACTR2A (Bondulich et al., 2017)].

Figure 3

3.3 Phylogenetic analysis of Smads

In a phylogenetic tree based on amino acid sequences of multiple Smads, the each type of Smad assembled in a cluster. The phylogenetic tree is shown in Figure 4 and the corresponding sequences are shown in Table 3. According to the phylogenetic tree, two kinds of known R-Smads from A. japonicus were classified into one class, the Smad1 class. Notably, they were closely related to Smad5.

Figure 4

3.4 mRNA levels of TGFβ signaling pathway genes in A. japonicus color morphs

Three different color morphs of A. japonicus are shown in Figure 1. mRNA levels of TGFβ signaling pathway genes in A. japonicus with different colors are shown in Figure 5. Compared to levels in green A. japonicus, the mRNA expression levels of all TGFβ signaling pathway genes were much higher in purple A. japonicus, with significant differences in TGFβR2 and Smad2/3 levels between morphs (p < 0.05). The mRNA expression levels of BMP2/4, ACVR2A, Smad1, and TGFβR2 of the purple individuals were significantly lower than those in the white morph (p < 0.05), with no difference in Smad 2/3 (p > 0.05).

Figure 5

3.5 mRNA levels of TGFβ signaling pathway genes during pigmentation in A. japonicus

The pigmentation process in purple sea cucumber was divided into four stages: A, B, C, and D (Figure 6). mRNA levels of TGFβ signaling pathway genes at each stage are shown in Figure 7. BMP2/4 and Smad2/3 levels did not differ among pigmentation stages in A. japonicus (p > 0.05). Compared to levels at stage A, the mRNA expression of ACVR2A was lower at stage C and higher at stage D. The mRNA expression levels of Smad1 and TGFβR2 were significantly higher at stages B and C than at stage A. As time progressed, the expression level of TGFβR2 began to decrease, with lower levels at stage D than at stages B and C.

Figure 6

4 Discussion

The TGFβ superfamily consists of over 50 structurally related ligands and can be divided into two subfamilies based on sequence similarity and the specific signaling pathways they activate: the TGFβ/activin/Nodal subfamily and BMP/GDF/AMH (anti-Mullerian hormone) subfamily (Shi and Massagué, 2003; Massagué, 2012; Miyazono et al., 2018). These have been described in a large number of studies of TGFβ superfamily ligand, receptor, and R-Smad interactions in various species (Piek et al., 1999; Attisano and Wrana, 2002; de Caestecker, 2004; Schilling et al., 2008; Romano et al., 2012) and were detected in the sea cucumber genome (Tables 13) . Ligand–receptor–R-Smad interactions in A. japonicus were inferred, as shown in Table 5, and putative TGFβ-mediated signaling pathways in A. japonicus are shown in Graphical Abstract. In the first subfamily, ligands (TGFβ1, TGFβ2, Activin B, Inhibin, and Nodal), Receptor II (TGFβR2 and ACVR2A/ACTR2A), and R-Smads (Smad2, 3) were found in A. japonicus. In the second subfamily, ligands (BMP2, BMP4, BMP3, and BMP3B), Receptor I (BMPR1B/ALK6), Receptor II (ACVR2A/ACTR2A and BMPR2), and R-Smad (Smad1, 5 and Smad2, 3) were found in A. japonicus.

Table 5

SubfamilyLigandReceptor IReceptor IIR-Smad
TGFβ/activin/NodalTGFβ1no recordsTGFβR2Smad2, 3
TGFβ2no recordsTGFβR2Smad2, 3
Activin Bno recordsACVR2A/ACTR2ASmad2, 3
InhibinNo type I receptorACVR2Ano specific R-Smads
Nodalno recordsACVR2A/ACTR2ASmad2, 3
BMP/GDF/AMHBMP2BMPR1B/ALK6ACVR2A/ACTR2A and BMPR2Smad1, 5
BMP4BMPR1B/ALK6ACVR2A/ACTR2A and BMPR2Smad1, 5
BMP3No type I receptorno recordsno records
BMP3Bno recordsACVR2A/ACTR2ASmad2, 3

TGFβ superfamily ligand-receptor-Smad specificity.

The TGFβ signaling pathway is considered a good marker for the evolution of animal genomes (Long, 2019). Three TGFβ isoforms are known in mammals (Derynck et al., 1985; Van Obberghen-Schilling et al., 1987; ten Dijke et al., 1988; Miller et al., 1989a; Miller et al., 1989b) and in birds (TGFβ2, β3, and β4) (Jakowlew et al., 1988a; Jakowlew et al., 1988c; Jakowlew et al., 1988b; Jakowlew et al., 1990), two in amphibians (TGFβ2 and TGFβ5) (Kondaiah et al., 1990; Rebbert et al., 1990), and four in fish (TGFβ1, β2, β3 and β6) (Funkenstein et al., 2010). In the present study, two TGFβ ligand isoforms (TGFβ1 and TGFβ2) were identified in A. japonicus (Figure 2). A BLAST search against GenBank entries (putative TGFβ1 like, PIK34829.1, putative TGFβ1X1, PIK56215.1, and putative TGFβ1X1, QHG11580.1) revealed high amino acid sequence homology with TGFβ1 (Figure 2 and Table 1). It is worth noting that although TGFβ2 was classified as TGFβ2, it was closely related to TGFβ3 (Figure 2 and Table 1). Activin is the dimer of β-subunits, activin A (βA-βA), activin B (βB-βB), and activin AB (βA-βB). Inhibin A, B, C are dimers composed of an α-subunit associated with βA, βB, and βC (Burger, 1988; Mellor et al., 2000; Ushiro et al., 2006). Accordingly, the putative activin BX1 and putative inhibin beta C chain-like of A. japonicus clustered in the Activin/Inhibin cluster on the phylogenetic tree and showed a relatively low identity (Figure 2 and Table 1). The TGFβ family member nodal of A. japonicus were assigned to the Nodal cluster (Figure 2 and Table 1). In summary, sea cucumber possessed the complete TGFβ/activin/Nodal ligand subfamily.

Although no typical receptor I was found in the TGFβ/activin/Nodal subfamily (Table 5), significant differences in the mRNA expression levels of TGFβR2, ACVR2A, and Smad2/3 were detected in sea cucumbers with different body colors (Figure 5). Expression levels of TGFβR2 during different pigmentation stages of purple A. japonicus were significantly higher than those during the unpigmented period; however, the expression levels of Smad2/3 did not differ significantly (p > 0.05) (Figure 7). This indicates that TGFβR2 is involved in the regulation of the coloration process of A. japonicus; however, its specific regulatory mechanism is still unclear. TGFβR2 and Smad2/3 also differ significantly between peripheral blood lymphocytes of patients with systemic lupus erythematosus and a normal control group (Sun et al., 2013). When ACVR2A function is reduced in melanocytes, gray hair develops (Han et al., 2012). These findings are consistent with the higher expression of ACVR2A in the white morph than in the other color morphs of A. japonicus. More broadly, there are ethnic differences in TGFβ signaling in African American and Caucasian skin (Fantasia et al., 2013). Taken together, these studies support the hypothesis that the TGFβ/activin/Nodal subfamily is involved in the regulation of body color of A. japonicas.

The second subfamily involved BMP/GDF/AMH. BMP is the largest subfamily of TGFβ ligands. In the current study, two BMPs, BMP2/4 and BMP3, were found. The BMPs (PIK57098.1) of A. japonicus were classified as BMP2/4. Sj-BMP2/4 was recorded in GenBank with two different accession numbers (PIK56114.1 and BAC53989.1). A Blast analysis showed that the two proteins were highly homologous (query cover: 100%, identity: 99.29%). A. japonicus and Stichopus japonicus are two different names for the same species (Chang et al., 2009). Accordingly, Sj-BMP2/4 corresponds to BMP2/4 of A. japonicus. In this study, the mRNA expression of BMP2/4 did not differ among pigmentation stages of purple A. japonicus (Figure 7). However, BMP2/4 expression was significantly higher in the white morph than in the green and purple morphs (Figure 5), suggesting that BMP2/4 is closely related to formation of the white body color. Numerous studies have shown that BMP2 and BMP4 can induce stem cells to differentiate into adipocytes and to differentiate into white adipocytes (Ahrens et al., 1993; Wang et al., 1993; Sottile and Seuwen, 2000; Bowers and Lane, 2007; Gomes et al., 2012). White sea cucumbers are uniformly white on the dorsal and ventral sides, while purple and green sea cucumbers have obvious color differences, i.e., the dorsal side is darker than the ventral side (Figures 1, 6). The specificity of BMP2/4 was receptor I (BMPR1B)–receptor II (ACVR2A and BMPR2)–R-Smad (Smad1,5). In A. japonicus, their expression levels in white sea cucumber were significantly higher than those in the purple and green sea cucumbers (Figure 5). These results suggest that the BMP2/4-induced differentiation of white adipocytes in A. japonicus is regulated by this signaling pathway. Functional tests, including gain- or loss-of-function assays, using exogenous BMPs or BMP antagonists are necessary to validate the roles of this pathway in A. japonicus. In the GDF gene family, only GDF8 was detected in A. japonicus (Figure 2 and Table 1). There was no record of AMH in sea cucumber. Accordingly, the BMP/GDF/AMH ligand subfamily in sea cucumber is incomplete.

Figure 7

5 Conclusions

In summary, 14 TGFβ signaling pathway members were identified in A. japonicus for the first time, including 7 ligands, 6 receptors, and 1 R-Smad. Detailed phylogenetic and gene expression analyses support the hypothesis (Graphical Abstract) that both subfamilies of the TGFβ superfamily were involved in the regulation of pigmentation in different color morphs of A. japonicus. The TGFβ/activin/Nodal subfamily was complete and contributed to the regulation of different color morphs. The BMP/GDF/AMH subfamily was incomplete, and the BMP2/4-induced differentiation of white adipocytes was regulated by the BMP2/4–ACVR2A–Smad1 signaling pathway.

Statements

Data availability statement

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.

Author contributions

LY and CL conceived and designed the experiments. Material preparation, data collection and analysis were performed by LY, BZ, QW, XJ, SH, WH. The first draft of the manuscript was written by LY and all authors commented on previous versions of the manuscript. All authors contributed to the article and approved the submitted version.

Funding

This study was supported by the Shandong Provincial Natural Science Foundation (ZR2022QC183), Key R&D Plan of Shandong Province (2021TZXD008), National Key Research and Development Program “Blue Granary Scientific and Technological Innovation” (2018YFD0901602).

Conflict of interest

Author XJ was employed by the company Country Conson CSSC Qingdao Ocean Technology CO., Ltd.

The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1

    AhrensM.AnkenbauerT.SchröderD.HollnagelA.MayerH.GrossG. (1993). Expression of human bone morphogenetic proteins-2 or-4 in murine mesenchymal progenitor C3H10T½ cells induces differentiation into distinct mesenchymal cell lineages. DNA Cell Biol.12 (10), 871880. doi: 10.1089/dna.1993.12.871

  • 2

    AttisanoL.WranaJ. L. (2002). Signal transduction by the TGF-β superfamily. Science296 (5573), 16461647. doi: 10.1126/science.1071809

  • 3

    BaiY.ZhangL.XiaS.LiuS.RuX.XuQ.et al. (2016). Effects of dietary protein levels on the growth, energy budget, and physiological and immunological performance of green, white and purple color morphs of sea cucumber, apostichopus japonicus. Aquaculture. 437, 297–303. doi: 10.1016/j.aquaculture.2015.08.021

  • 4

    BaoJ. (2008). Effects and mechanism of environment on growth of green and red sea cucumber, apostichopus japonicus (Ocean University of China).

  • 5

    BondulichM. K.JolinonN.OsborneG. F.SmithE. J.RattrayI.NeuederA.et al. (2017). Myostatin inhibition prevents skeletal muscle pathophysiology in huntington’s disease mice. Sci. Rep.7 (1), 114. doi: 10.1038/s41598-017-14290-3

  • 6

    BottjerD. J.DavidsonE. H.PetersonK. J.CameronR. A. (2006). Paleogenomics of echinoderms. Science.314 (5801), 956–960. doi: 10.1126/science.1132310

  • 7

    BowersR. R.LaneM. D. (2007). A role for bone morphogenetic protein-4 in adipocyte development. Cell Cycle6 (4), 385389. doi: 10.4161/cc.6.4.3804

  • 8

    BurgerH. G. (1988). Inhibin: definition and nomenclature, including related substances. J. Endocrinol.117 (2), 159160. doi: 10.1677/joe.0.1170159

  • 9

    CameronR. A.KudtarkarP.GordonS. M.WorleyK. C.GibbsR. A. (2015). Do echinoderm genomes measure up? Mar. Genomics22, 19. doi: 10.1016/j.margen.2015.02.004

  • 10

    ChangY.FengZ.YuJ.DingJ. (2009). Genetic variability analysis in five populations of the sea cucumber stichopus (Apostichopus) japonicus from China, Russia, south Korea and Japan as revealed by microsatellite markers. Mar. Ecol.30 (4), 455461. doi: 10.1111/j.1439-0485.2009.00292.x

  • 11

    ChengK. C. (2008). Skin color in fish and humans: Impacts on science and society. Zebrafish5 (4), 237242. doi: 10.1089/zeb.2008.0577

  • 12

    ChenY.GaoF.LiuG.ShaoL.ShiG. (2007). The effects of temperature,salinity and light cycle on the growth and behavior of apostichopus japonicus. J. Fisheries China31 (5), 687691. doi: 1000-0615(2007)05-0687-05

  • 13

    ChenJ.LvZ.GuoM. (2022). Research advancement of apostichopus japonicus from 2000 to 2021. Front. Mar. Sci., 1595. doi: 10.3389/fmars.2022.931903

  • 14

    de CaesteckerM. (2004). The transforming growth factor-β superfamily of receptors. Cytokine Growth factor Rev.15 (1), 111. doi: 10.1016/j.cytogfr.2003.10.004

  • 15

    DerynckR.JarrettJ. A.ChenE. Y.EatonD. H.BellJ. R.AssoianR. K.et al. (1985). Human transforming growth factor-β complementary DNA sequence and expression in normal and transformed cells. Nature316 (6030), 701705. doi: 10.1038/316701a0

  • 16

    FantasiaJ.LinC. B.WiwiC.KaurS.HuY.ZhangJ.et al. (2013). Differential levels of elastin fibers and TGF-β signaling in the skin of caucasians and African americans. J. Dermatol. Sci.70 (3), 159165. doi: 10.1016/j.jdermsci.2013.03.004

  • 17

    FunkensteinB.OlekhE.JakowlewS. B. (2010). Identification of a novel transforming growth factor-β (TGF-β6) gene in fish: regulation in skeletal muscle by nutritional state. BMC Mol. Biol.11 (1), 116. doi: 10.1186/1471-2199-11-37

  • 18

    GomesS. P.DeliberadorT. M.GonzagaC. C.KlugL. G.OliveiraL.UrbanA. C.et al. (2012). Bone healing in critical-size defects treated with immediate transplant of fragmented autogenous white adipose tissue. J. Craniofacial Surg.23 (5), 12391244. doi: 10.1097/SCS.0b013e31825da9d9

  • 19

    GuoZ.WangZ.HouX.ZhangH. (2020). Comparative study on genetic structure of three color variants of the sea cucumber ( apostichopus japonicus) based on mitochondrial and ribosomal genes. J. Shandong Univ. ( Natural Science)55 (11), 7. doi: 10.6040/j.issn.1671-9352.0.2020.231

  • 20

    HallM. R.KocotK. M.BaughmanK. W.Fernandez-ValverdeS. L.GauthierM. E.HatlebergW. L.et al. (2017). The crown-of-thorns starfish genome as a guide for biocontrol of this coral reef pest. Nature544 (7649), 231234. doi: 10.1038/nature22033

  • 21

    HanR.BeppuH.LeeY. K.GeorgopoulosK.LarueL.LiE.et al. (2012). A pair of transmembrane receptors essential for the retention and pigmentation of hair. Genesis50 (11), 783800. doi: 10.1002/dvg.22039

  • 22

    HartP. J.DeepS.TaylorA. B.ShuZ.HinckC. S.HinckA. P. (2002). Crystal structure of the human TβR2 ectodomain–TGF-β3 complex. Nat. Struct. Biol.9 (3), 203208. doi: 10.1038/nsb766

  • 23

    HenningF.JonesJ. C.FranchiniP.MeyerA. (2013). Transcriptomics of morphological color change in polychromatic Midas cichlids. BMC Genomics14 (1), 171171. doi: 10.1186/1471-2164-14-171

  • 24

    HubbardJ. K.UyJ.HauberM. E.HoekstraH. E.SafranR. J. (2010). Vertebrate pigmentation: from underlying genes to adaptive function. Trends Genet.26 (5), 231239. doi: 10.1016/j.tig.2010.02.002

  • 25

    JakowlewS. B.DillardP. J.KondaiahP.SpornM. B.RobertsA. B. (1988a). Complementary deoxyribonucleic acid cloning of a novel transforming growth factor-beta messenger ribonucleic acid from chick embryo chondrocytes. Mol. Endocrinol. (Baltimore Md.)2 (8), 747755. doi: 10.1210/mend-2-8-747

  • 26

    JakowlewS. B.DillardP. J.SpornM. B.RobertsA. B. (1988b). Complementary deoxyribonucleic acid cloning of a messenger ribonucleic acid encoding transforming growth factor β 4 from chicken embryo chondrocytes. Mol. Endocrinol.2 (12), 11861195. doi: 10.1210/mend-2-12-1186

  • 27

    JakowlewS. B.DillardP. J.SpornM. B.RobertsA. B. (1988c). Nucleotide sequence of chicken transforming growth factor-beta 1 (TGF-beta 1). Nucleic Acids Res.16 (17), 8730. doi: 10.1093/nar/16.17.8730

  • 28

    JakowlewS. B.DillardP. J.SpornM. B.RobertsA. B. (1990). Complementary deoxyribonucleic acid cloning of an mRNA encoding transforming growth factor-β2 from chicken embryo chondrocytes. Growth Factors2 (2), 123133. doi: 10.3109/08977199009071499

  • 29

    JiT.DongY.DongS. (2008). Growth and physiological responses in the sea cucumber, apostichopus japonicus selenka: Aestivation and temperature. Aquaculture283 (1), 180187. doi: 10.1016/j.aquaculture.2008.07.006

  • 30

    KangJ. H.YuK. H.ParkJ. Y.AnC. M.JunJ. C.LeeS. J. (2011). Allele-specific PCR genotyping of the HSP70 gene polymorphism discriminating the green and red color variants sea cucumber (Apostichopus japonicus). J. Genet. Genomics38 (8), 351355. doi: 10.1016/j.jgg.2011.06.002

  • 31

    KondaiahP.SandsM. J.SmithJ. M.FieldsA.RobertsA. B.SpornM. B.et al. (1990). Identification of a novel transforming growth factor-beta (TGF-beta 5) mRNA in xenopus laevis. J. Biol. Chem.265 (2), 10891093. doi: 10.1016/S0021-9258(19)40162-2

  • 32

    LaprazF.DubocV.ThierryL. (2007). A genomic view of TGF-β signal transduction in an invertebrate deuterostome organism and lessons from the functional analyses of nodal and BMP2/4 during sea urchin development. Signal Transduction.7 (2), 187–206. doi: 10.1002/sita.200600125

  • 33

    LeeH.ChongD. C.OlaR.DunworthW. P.MeadowsS.KaJ.et al. (2017). Alk2/ACVR1 and Alk3/BMPR1A provide essential function for bone morphogenetic protein–induced retinal angiogenesis. Arteriosclerosis thrombosis Vasc. Biol.37 (4), 657663. doi: 10.1161/ATVBAHA.116.308422

  • 34

    LiJ.LiuJ.CaoX.WangF.LiJ.ZhengL.et al. (2020). Effects of light intensity on growth, digestion and immunity of green, white and purple sea cucumber apostichopus japonicus selenka. J. Dalian Ocean Univ. 35 (02), 184–189. doi: 10.16535/j.cnki.dlhyxb.2019-057

  • 35

    LintonL. M.BirrenB. W.LanderE. (2001). International human genome sequencing consortium. Nature409 (6822), 860921. doi: 10.1038/35057062

  • 36

    LiH.XuH.AkhatayevaZ.LiuH.LinC.HanX.et al. (2021). Novel indel variations of the sheep FecB gene and their effects on litter size. Gene767, 145176. doi: 10.1016/j.gene.2020.145176

  • 37

    LongJ. (2019). Bioinformatic analysis of TGF-β signaling pathway members and their expression in Nile tilapia (Southwest University).

  • 38

    LoweC. J.ClarkeD. N.MedeirosD. M.RokhsarD. S.RokhsarJ. (2015). The deuterostome context of chordate origins. Nature. 520 (7548), 456–465. doi: 10.1038/nature14434

  • 39

    MassaguéJ. (2012). TGFβ signalling in context. Nat. Rev. Mol. Cell Biol.13 (10), 616630. doi: 10.1038/nrm3434

  • 40

    MassaguéJ.ChenY. (2000). Controlling TGF-β signaling. Genes Dev.14 (6), 627644. doi: 10.1101/gad.14.6.627

  • 41

    MellorS. L.CranfieldM.RiesR.PedersenJ.CancillaB.KretserD. D.et al. (2000). Localization of activin βA-, β b-, andβ c-subunits in human prostate and evidence for formation of new activin heterodimers ofβ c-subunit. J. Clin. Endocrinol. Metab.85 (12), 48514858. doi: 10.1210/jcem.85.12.7052

  • 42

    MillerD. A.LeeA.MatsuiY.ChenE. Y.MosesH. L.DerynckR. (1989a). Complementary DNA cloning of the murine transforming growth factor-β3 (TGFβ3) precursor and the comparative expression of TGFβ3 and TGFβ1 messenger RNA in murine embryos and adult tissues. Mol. Endocrinol.3 (12), 19261934. doi: 10.1210/mend-3-12-1926

  • 43

    MillerD. A.LeeA.PeltonR. W.ChenE. Y.MosesH. L.DerynckR. (1989b). Murine transforming growth factor-β2 cDNA sequence and expression in adult tissues and embryos. Mol. Endocrinol.3 (7), 11081114. doi: 10.1172/JCI67521

  • 44

    MiyazonoK.KatsunoY.KoinumaD.EhataS.MorikawaM. (2018). Intracellular and extracellular TGF-β signaling in cancer: some recent topics. Front. Med.12 (4), 387411. doi: 10.1007/s11684-018-0646-8

  • 45

    PattersonG. I.PadgettR. W. (2000). TGFβ-related pathways: roles in caenorhabditis elegans development. Trends Genet.16 (1), 2733. doi: 10.1242/dev.00863

  • 46

    PiekE.HeldinC.DijkeP. T. (1999). Specificity, diversity, and regulation in TGF-β superfamily signaling. FASEB J.13 (15), 21052124. doi: 10.1096/fasebj.13.15.2105

  • 47

    RebbertM. L.BhatiadeyN.DawidI. B. (1990). The sequence of TGF-beta 2 from xenopus laevis. Nucleic Acids Res.18 (8), 2185. doi: 10.1093/nar/18.8.2185

  • 48

    RomanoV.RaimondoD.CalvaneseL.D’AuriaG.TramontanoA.FalcignoL. (2012). Toward a better understanding of the interaction between TGF-β family members and their ALK receptors. J. Mol. modeling18 (8), 36173625. doi: 10.1007/s00894-012-1370-y

  • 49

    SchillingS. H.HjelmelandA. B.RichJ. N.WangX. (2008). 3 TGF-β: A multipotential cytokine. Cold Spring Harbor Monograph. Arch.50, 45–77. doi: 10.1101/087969752.50.45

  • 50

    ShiY.MassaguéJ. (2003). Mechanisms of TGF-β signaling from cell membrane to the nucleus. cell113 (6), 685700. doi: 10.1016/s0092-8674(03)00432-x

  • 51

    SignorP. W.BrettC. E. (1984). The mid-Paleozoic precursor to the mesozoic marine revolution. Paleobiology10 (2), 229245. doi: 10.1017/S0094837300008174

  • 52

    SodergrenE.WeinstockG. M.DavidsonE. H.CameronR. A.GibbsR. A.AngererR. C.et al. (2006). The genome of the sea urchin strongylocentrotus purpuratus. Science314 (5801), 941952. doi: 10.1126/science.1133609

  • 53

    SottileV.SeuwenK. (2000). Bone morphogenetic protein-2 stimulates adipogenic differentiation of mesenchymal precursor cells in synergy with BRL 49653 (rosiglitazone). FEBS Lett.475 (3), 201204. doi: 10.1016/s0014-5793(00)01655-0

  • 54

    SunB.TanY.HongX.LiuD. (2013). Expressions of TGFβR2 and Smad2 in peripheral lymphocytes in patients with systemic lupus erythematosus. J. Pract. Med29 (8), 1255–1257. doi: 10.3969/j.issn.1006-5725.2013.08.019

  • 55

    SunJ.ZhangY.XuT.ZhangY.MuH.ZhangY.et al. (2017). Adaptation to deep-sea chemosynthetic environments as revealed by mussel genomes. Nat. Ecol. Evol.1 (5), 121. doi: 10.1038/s41559-017-0121

  • 56

    ten DijkeP.HansenP.IwataK. K.PielerC.FoulkesJ. G. (1988). Identification of another member of the transforming growth factor type beta gene family. Proc. Natl. Acad. Sci.85 (13), 47154719. doi: 10.1073/pnas.85.13.4715

  • 57

    ten DijkeP.MiyazonoK.HeldinC.-H. (2000). Signaling inputs converge on nuclear effectors in TGF-β signaling. Trends Biochem. Sci.25 (2), 6470. doi: 10.1016/s0968-0004(99)01519-4

  • 58

    UshiroY.HashimotoO.SekiM.HachiyaA.ShojiH.HasegawaY. (2006). Analysis of the function of activin betaC subunit using recombinant protein. J. Reprod. Dev. 52 (4), 487–495. doi: 10.1262/jrd.17110. 0604200034-0604200034.

  • 59

    Van Obberghen-SchillingE.KondaiahP.LudwigR. L.SpornM. B.BakerC. C. (1987). Complementary deoxyribonucleic acid cloning of bovine transforming growth factor-β1. Mol. Endocrinol.1 (10), 693698. doi: 10.1210/mend-1-10-693

  • 60

    WangE. A.IsraelD. I.KellyS.LuxenbergD. P. (1993). Bone morphogenetic protein-2 causes commitment and differentiation in C3Hl0T1/2 and 3T3 cells. Growth factors9 (1), 5771. doi: 10.3109/08977199308991582

  • 61

    WangG.ZhuW.LiZ.FuR. (2007). Effects of water temperature and salinity on the growth of apostichopus japonicus. Shandong Science.20 (3), 6–9. doi: 10.3969/j.issn.1002-4026.2007.03.002

  • 62

    WeissA.AttisanoL. (2013). The TGFbeta superfamily signaling pathway. Wiley Interdiscip. Reviews: Dev. Biol.2 (1), 4763. doi: 10.1002/wdev.86

  • 63

    ZhangX.SunL.YuanJ.SunY.GaoY.ZhangL.et al. (2017). The sea cucumber genome provides insights into morphological evolution and visceral regeneration. PloS Biol.15 (10), e2003790. doi: 10.1371/journal.pbio.2003790

  • 64

    ZhaoB.HuW.LiC.HanS. (2018). Effects of temperature and salinity survival, growth, and coloration of juvenile apostichopus japonicus selenta. Oceanologia Limnologia Sin. 36 (5), 1835–1842. doi: 10.11693/hyhz20170800211

  • 65

    ZhengS.LongJ.LiuZ.TaoW.WangD. (2018). Identification and of TGF-β signaling pathway members in twenty-four animal species and expression in tilapia. Int. J. Mol. Sci.19 (4), 1154. doi: 10.3390/ijms19041154

  • 66

    ZhuH.KongL.LiQ.WangY.ZhaoQ. (2013). Effects of Salinity,Temperature and stocking density on the growth and srvival of white race Sea Cucumber(Apostichopus japonicus) larvae (Periodical of Ocean University of China). doi: 10.16441/j.cnki.hdxb.2013.07.006

Summary

Keywords

TGFβ signaling pathway, regulatory mechanism, pigmentation, Apostichopus japonicas, gene family divergence

Citation

Yao L, Zhao B, Wang Q, Jiang X, Han S, Hu W and Li C (2023) Contribution of the TGFβ signaling pathway to pigmentation in sea cucumber (Apostichopus japonicus). Front. Mar. Sci. 10:1101725. doi: 10.3389/fmars.2023.1101725

Received

18 November 2022

Accepted

09 January 2023

Published

02 February 2023

Volume

10 - 2023

Edited by

Hongsheng Yang, Institute of Oceanology, Chinese Academy of Sciences (CAS), China

Reviewed by

Yi Yang, Hainan University, China; Xinran Li, Foshan University, China

Updates

Copyright

*Correspondence: Chenglin Li,

This article was submitted to Global Change and the Future Ocean, a section of the journal Frontiers in Marine Science

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics