Abstract
Deficiency in a principal epidermal barrier protein, filaggrin (FLG), is associated with multiple allergic manifestations, including atopic dermatitis and contact allergy to nickel. Toxicity caused by dermal and respiratory exposures of the general population to nickel-containing objects and particles is a deleterious side effect of modern technologies. Its molecular mechanism may include the peptide bond hydrolysis in X1-S/T-c/p-H-c-X2 motifs by released Ni2+ ions. The goal of the study was to analyse the distribution of such cleavable motifs in the human proteome and examine FLG vulnerability of nickel hydrolysis. We performed a general bioinformatic study followed by biochemical and biological analysis of a single case, the FLG protein. FLG model peptides, the recombinant monomer domain human keratinocytes in vitro and human epidermis ex vivo were used. We also investigated if the products of filaggrin Ni2+-hydrolysis affect the activation profile of Langerhans cells. We found X1-S/T-c/p-H-c-X2 motifs in 40% of human proteins, with the highest abundance in those involved in the epidermal barrier function, including FLG. We confirmed the hydrolytic vulnerability and pH-dependent Ni2+-assisted cleavage of FLG-derived peptides and FLG monomer, using in vitro cell culture and ex-vivo epidermal sheets; the hydrolysis contributed to the pronounced reduction in FLG in all of the models studied. We also postulated that Ni-hydrolysis might dysregulate important immune responses. Ni2+-assisted cleavage of barrier proteins, including FLG, may contribute to clinical disease associated with nickel exposure.
Introduction
Prevalence of nickel alloys in the industry and daily use items is inadvertently associated with the occupational and environmental exposure to airborne particles containing nickel oxides and salts, and to Ni2+ ions present in water and food and released from nickel alloys (by dermal contact) (; ; ; ; ). While medicinal aspects of the resulting nickel toxicity have been thoroughly described, the underlying molecular mechanisms remain the subject of research (; ). The Ni2+-assisted peptide bond hydrolysis (Ni-hydrolysis) is one such reaction, occurring selectively before S/T in proteins bearing X1-S/T-c/p-H-c-X2 motifs (Ni-hydrolytic motifs, excluding P at the third and reduced C at the first, third and fifth residues within the motif) exposed to Ni2+ ions in solution (; ; ). It proceeds via the N-O acyl shift in the X1-S/T moiety, followed by ester hydrolysis (Figure 1A). The reaction rate depends on pH, temperature and the bulkiness of the first, third and fifth residues, being significantly faster for X1 = G (fast motifs) (). The effectiveness this process was proven for Cu2+ () and Pd2+ ions (), but Ni-hydrolysis was investigated to the largest extent, due to its higher efficiency. On the other hand, Co2+ and Zn2+ ions were proven to be non-reactive in this respect ().
FIGURE 1
Filaggrin (FLG) plays key roles in maintaining skin homeostasis, epidermal structure and the barrier function (
The key role of FLG in the skin barrier formation and its enrichment in Ni-hydrolytic motifs inspired us to study its interaction with Ni2+ ions in cell-free and biological systems.
Here we present the hydrolytic cleavage pattern search tool which allowed us to analyse the distribution of such cleavable motifs in the human proteome and catalogued them according to their physiological function. Fast G-motifs are generally abundant, but particularly highly enriched in proteins supporting the epidermal barrier of the human body, e.g. FLG, expressed predominantly in keratinocytes.
Materials and Methods
Database Creation
For our in silico research the UniProt database—release 2017_05—was used. We decided to leave all protein isomers as a full representation of functional proteome. But we keep only a non-redundant protein set to avoid duplicates after clustering with the cd-hit tool version 4.6.8 and these parameters: “-c 0.98 -d 0 -aS 0.98 -p 1 -g 1”. Two patterns—following the PROSITE Pattern syntax (https://prosite.expasy.org/prosuser.html)—were searched with the/Pattern Search/ tool version 1 from MyHits (https://www.ncbi.nlm.nih.gov/pubmed/17545200): “x-[ST]-{CP}-H-{C}-x” or “G-[ST]-{CP}-H-{C}-x”. Perl 5.18.2 (script get_motif_stat.pl) was used to parse results. Additionally results containing proteins with those words in their description were discarded: “(Fragment)” or “Truncated”. Here a correction has been made. In the case of overlapping motives, we counted them as one. The following research tasks were considered: estimation of the number of motifs per protein, estimation of the number of motifs normalized by the length of proteins, estimation of the number of motifs by type (specific amino acids at specific positions). On the base of such prepared data, further statistical analyses were performed.
Amino Acid Enrichment
Experimental amino acid occurrences on position X1 of X1-S/T-c/p-H-c-X2 motif were corrected for the abundance of each amino acid in the whole proteome. Positive value indicates that a particular residue type is found on X-position more frequently than in the whole proteome.
Cumulative Distribution Function (CDF)
Cumulative distribution functions were obtained according to the standard approach (
Quantitative Analysis of Hydrolytic Motifs Frequency Within the Human Proteome
The number of X1-S/T-c/p-H-c-X2 motifs was determined for each individual protein. The distribution of these numbers was then analysed assuming Poisson distribution, which assumes no correlations between particular motifs. The analysis was performed using Origin software (version 9.7, www.originlab.com).
Single-Term GO Functional Enrichment Analysis
Gene Ontology functional enrichment analysis was performed using topGO R package with custom GO mapping files based on Gene Ontology human annotations files from April 2018. Only Gene Ontology terms from Biological Process were used for annotation. Initial datasets G-S/T-c/p-H-c-X2 and X1-S/T-c/p-H-c-X2 included 4111 and 31099 proteins denoted with UniProt accession numbers. As GO annotations are provided for UniProtKB identifier, the first step involved translation UniProt accession numbers to Uniprot KB identifiers and filtering out isoforms. After the filtering step, the datasets G-S/T-c/p-H-c-X2 and X1-S/T-c/p-H-c-X2 2938 and 23120 protein identifiers respectively. To assess the statistical significance of GO terms enrichment in both datasets, Fisher Exact test was used with Benjamin-Hochberg adjustment for multiple testing corrections.
Analysis of Hydrolytic Motifs Within Filaggrins From Various Species
In order to create the list of proteins from diverse organisms we used the ScanProSite Tool which allows to scan a protein database against a motif. We used the X1-S/T-c/p-H-c-X2 motif for this purpose. We then normalized the number of cleavage sites dividing it by the total sequence length (# of motifs * 100/seq length). Dataset has been used to create a circular phylogenetic tree in NCBI CommonTree (https://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi) and visualized in iTOL https://itol.embl.de/(
In Silico Analysis of proFLG Sequence and Selection of Peptides
In silico analysis of proFLG sequence was performed on the base available in NCBI database human proFLG amino acid sequence (Ref. NP_002007.1) and information about FLG repeats (
Peptide Synthesis
All peptides were synthesized in the solid phase according to the Fmoc protocol (
Ni2+-Assisted FLG Peptides Hydrolysis
The hydrolysis experiments were performed in a 20 mM HEPES buffer (Sigma-Aldrich), using 0.5 mM peptide and 2 mM Ni(NO3)2 (Sigma-Aldrich). The samples were incubated in pH 8.2, at 50°C and pH 7.4, at 37°C. The aliquots were periodically collected from the samples and acidified by addition 2% (v/v) TFA. Control samples, containing peptide and buffer, but without Ni2+, were gathered at the same time points. For analysis, reaction mixtures were diluted by water 4 to 1 and injected into the HPLC system (Waters), equipped with an analytical C18 column. The eluting solvent A was 0.1% (v/v) TFA in water, and solvent B was 0.1% (v/v) TFA in 90% (v/v) acetonitrile. The chromatograms were obtained at 220 and 280 nm. After separation, the products of hydrolysis were identified using electrospray ionization mass spectrometry (ESI-MS). The relative amounts of these fractions in each chromatogram were calculated by peak integration using data analysis software Origin 8.1 or Origin Pro 2017 (OriginLab Corporation).
Kinetic Analysis
To calculate the rate constants of the acyl shift step (k1) and the ester hydrolysis step (k2) of the hydrolysis reaction the set of three equations (Kinet A, Kinet B, and Kinet C) was used, similarly to previous studies (
In these equations y is a molar fraction of a given species, x is the time axis, and A0 denotes the initial concentration of the substrate.
UV−Visible and Circular Dichroism Spectroscopies
The UV-visible spectra were recorded in the range of 850–330 nm, on a LAMBDA 950 UV/vis/NIR spectrophotometer (PerkinElmer). The path length was 1 cm. Complexometric titrations were performed for the samples containing 0.95 mM peptide and 0.9 mM Ni(NO3)2 dissolved in H2O. The pH of the solution was adjusted manually in the range of 3–11.5 by titrating with small amounts of concentrated NaOH. Circular dichroism (CD) spectra of Ni2+ complexes with peptides were recorded in the range of 270–800 nm, on a Jasco J-815 spectropolarimeter, using the same samples as for UV-vis experiments. The pKa values for the complex formation were obtained by fitting the absorption value at the band maximum to the Hill equation (
Molecular Modeling of Ni2+ Complexes
All molecular mechanics simulations were performed using YASARA2 force-field (
FLG Recombinant Protein: Plasmid Construction
Plasmids were constructed using a sequence- and ligation-independent cloning (SLIC) method (
Protein Production and Purification
The constructs were transformed into E. coli BL21-CodonPlus-RIL and propagated overnight in LB liquid media containing kanamycin and chloramphenicol at 37°C. The bacterial cultures were diluted 1:100 in LB liquid media supplemented by antibiotics and incubated at 37°C until the culture has reached the mid-log phase of growth. Protein expression was induced by IPTG (1 mM) for 2 h at 37°C. The cells were harvested by centrifugation (10 min, 5,000 × g, 4°C). The pellets were mixed with lysis buffer (10 mM Tris pH 8, 150 mM NaCl, 10 mM imidazole) supplemented with protease inhibitors cocktail and lysed by sonication. The cell lysate was clarified by centrifugation (60 min, 24,000 × g, 4°C) and used for affinity purification on a HisPur™ Cobalt Resin (Thermo Fisher). Pure protein was eluted by an elution buffer (10 mM Tris pH 8, 150 mM NaCl, 300 mM imidazole). Samples were dialysed (10 mM Tris pH 8.5, 150 mM NaCl, MWCO: 12–14000 Da) and analyzed on SDS-PAGE. Bands of interest were cut out and identified by MALDI-TOF MS after trypsin digestion.
Ni2+-Assisted FLG Monomer Hydrolysis
FLG protein domains (30 µM) were incubated in 10 mM TRIS/150 mM NaCl buffer with or without nickel ions [1 mM Ni(NO3)2] under optimal (pH 8.2, 50°C) and physiological (pH 7.4, 37°C) conditions. The reactions were stopped by freezing the collected samples in liquid nitrogen. Samples from different time points were separated using the Tricine-SDS page technique and Bio-Rad system. The experiment was repeated for CK2α control protein. Gels after electrophoresis were scanned (E-gel imager Camera, Life Technologies) and the scans used for densitometric analyses (ImageJ program).
Cell Proliferation Assay
In order to find out the toxic concentration of Ni(NO3)2 for keratinocytes, the cell proliferation assay (MTT) was performed. Cells were cultured in a 96-well plate and after 24 h of exposure to a gradient of Ni(NO3)2 concentrations (10−2 to 10−7 M final concentration) the test was performed according to manufacturer’s protocol (CellTiter 96® Non-Radioactive Cell Proliferation Assay, Promega). The assay determined the half maximal inhibitory concentration value IC50 as approximately 1 mM Ni(NO3)2.
Normal Human Epidermal Keratinocyte Culture
Normal human epidermal keratinocytes (NHEKs) (purchased from Lonza) were cultured in monolayers in a dedicated medium (Lonza, KBM-2) at the Ca2+ level of 0.06 mM. To stimulate differentiation and FLG expression, a calcium switch was conducted over a period of 24 h by replacing the culture media with fresh media adjusted to a 1.5 mM final calcium concentration. A Ni(NO3)2 (Sigma) solution was added to achieve various final concentrations (10 μM, 100 μM and 1 mM). Doses were chosen based on MTT test results (Supplementary Figure S1). After 24 h of incubation, the cells were fixed, permeabilized and immunostained with anti-FLG antibodies (Anti-FLG goat G20 (Santa Cruz), and secondary anti-goat Alexa-488 and anti-rabbit Alexa-568 (Life Technologies) antibodies were used. Staining was carried out in PBS and nuclei were visualized by Hoechst (NucBlue, Life Technologies). The slides were coversliped with Mowiol 4-88 (Sigma). Data acquisition was carried out on the Zeiss 780 inverted confocal microscope. Images from three separate experiments were analysed; KHG diameter and integrated intensity from the signal were measured using Fiji: ImageJ program (
Exposure of Epidermal Sheets to Nickel
Skin samples were obtained from healthy donors undergoing surgery under ethical approval from the UK National Research Ethics Service (14.NW.1153). Epidermal sheets were separated from dermal tissues by overnight incubation in dispase (5 U/ml; Sigma Aldrich) and cultured up to 48 h in KGM-2 keratinocyte medium (Lonza) adjusted with CaCl2 to a 1.5 mM final calcium concentration. The Ni(NO3)2 solution was added at the 1 mM final concentration. Experiments were repeated on skin explants from 10 donors. For fluorescent antibody staining epidermal sheets were fixed with 4% formaldehyde (Sigma), followed by 0.1% Triton X-100 (Sigma Aldrich) and incubated in a blocking buffer (5% FCS, 2% BSA in PBS) for 1 h. Anti-FLG goat G20 (Santa Cruz), and the secondary anti-goat Alexa488 (Life Technologies) antibody staining was carried out in PBS for 1 h. The nuclei were visualized by Hoechst (NucBlue, Life Technologies). The sheets were mounted on microscope cover-slides with Mowiol 4-88 (Sigma) for imaging. Data acquisition was carried out on the Zeiss 780 inverted confocal microscope by recording z-stacks of 2D images (at 0.38 µM intervals) and images taken using inverted confocal microscope (Zeiss 780) by recording 2D images in a 3D z-stack.
Western Blot Analysis
Isolated epidermal sheets were washed in PBS and incubated in an 8M urea buffer (ReadyPrep™ Sequential Extraction Kit, Reagent 2 with reducing reagent; Bio-Rad) and sonicated in a water bath for 30 min. Lysates were spun at 4°C (13,000 rpm, 15 min). Proteins from supernatants were fractionated 7% Tris-Acetate NuPage gels (Life Technologies). Proteins were transferred onto PVDF membranes (iBlot Dry Blot system stacks and iBlot transfer device; LifeTechnologies). Membranes were blocked in a 5% solution of non-fat milk powder in PBS and incubated overnight with desired primary antibodies (anti-FLG goat G-20 (Santa Cruz). Li-Cor infrared secondary antibodies and Li-Cor scanning system (Li-Cor Biosciences) were used for detection.
RNA Isolation and the Assessment of RNA Integrity
Isolation of total RNA from N-HEK cells was performed using the PureLink® RNA Mini Kit (Ambion) according to the manufacturer’s protocol. The RNA concentration and purity was estimated using NanoDrop 2000 (Thermo). The assessment of RNA quality was carried out on the Agilent 2100 Bioanalyzer System and Eukaryote Total RNA Nano Assay kit (Agilent) was used, according to the manufacturer’s protocol.
Reverse Transcription
Isolated RNA was used as a template for the reverse transcription. The reaction was performed in a S1000™ Thermal Cycler (Bio-Rad) in 20 µl using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem) according to the manufacturer’s protocol. The ingredients contained: 1,000 ng RNA per sample, reaction buffer, random primers, mix of dNTPs, RNase inhibitor (1.0 U/μl) and MultiScribe™ reverse transcriptase (2.5 U/μl). Conditions of RT reaction are presented in the table below.
Quantitative Real-Time PCR
Gene expression assay was counducted using the StepOne™ Real-Time PCR System and the TaqMan® Gene Expression Assay (Applied Biosystems). Briefly the reaction (holding stage I: 2 min, 50°C; holding stage II: 5 min, 95°C; Cycling stage (40x): 15 s, 95°C and 1 min, 60°C) was performed in 10 µl total volume with 12.5 ng of cDNA (or water as a negative control) addition. TaqMan® Universal Master Mix II with the AmpErase® UNG (uracil-N-glycosylase) (Applied Biosystems) was used. The primers (forward: 5′–GGAAAAGGAATTTCGGCAAAT–3′, reverse: 5′–TCCATGAAGACATCAACCATATCTG–3′) and the TaqMan® MGB probe (5′–FAM CTGAAGAATCCAGATGAC-NFQ-MGB–3′, Applied Biosystems) set for FLG gene was designed using Primer Express software (Applied Biosystems) and the specificity was checked using PrimerBLAST tool (NCBI). The specificity of the primers and probe set was confirmed by adequate negative controls. Results were calculated based on a ΔCT method and TBP1 (TATA-box binding protein 1) gene (commercially available primer and probe set, accession number: Hs00427620, Applied Biosystems) was used as a reference. For statistical analyses the t-test was used.
Langerhans Cell-like Cells
Peripheral blood mononuclear cells (PBMCs) were isolated from blood collected from healthy adult donors under local ethics approval (09/H0606/71). Samples were diluted and centrifuged in a density gradient using a Lymphoprep™ reagent (STEMCELL Technologies Inc.). The CD14+ cells were separated with a MACS MicroBead (Miltenyi Biotec) magnetic separation system according to the manufacturer’s protocol. Subsequently, the monocytes were cultured in a 1 × 106/ml density in the RPMI medium supplemented with 10% fetal calf serum, penicillin/streptomycin mix and 2 mM L-glutamine, with addition of cytokines: 250 ng/ml GM-CSF, 100 ng/ml IL-4, 10 ng/ml TGF-β1, all obtained from Pepro-Tech. After 5 days of culture, the cells were exposed to a Ni(NO3)2 solution (1 mM), peptides (50 µM) or Ni2+-peptide complexes with the same concentrations of peptides and of the nickel salt. After 48 h the cells were harvested for the flow cytometry analysis.
Flow Cytometry
The cells were harvested by decantation into a conical tube and centrifuged (10 min, 1,400 rpm, 4°C). Supernatants were collected and frozen until further analysis. Next, the cells were washed in ice cold 10% FCS in PBS and stained. All staining was carried out on ice and protected from light. Conjugated primary antibodies: anti-human CD86 (APC) and HLA DR (PE), CD80 (FITC) were added in 0.1–10 μg/ml concentration range and incubated for 1 h in the dark at 4°C. The cells were washed three times in PBS and centrifuged (5 min, 1,400 rpm, 4°C), and resuspended in 1 ml of ice cold PBS, containing 10% FCS and 1% sodium azide. The cells were fixed in 1% paraformaldehyde solution and kept in the dark on ice until the analysis. The cytometric analysis was performed on CyAn™ ADP (Beckman Coulter). First, using unstained cells and compensation beads (Anti-Mouse Ig, κ/Negative Control Compensation Particles Set, BD), the compensation procedure was performed. The FCS Express 7 Flow Cytometry Software—RUO, DeNovo Software were used for the final analysis. The results were analysed with the t-test.
Analysis of Cytokine Secretion
Cytokine levels (TNFa, IFNa2, IL1b, IL-6, IL-8, IL-10) in the cultures medium was measured by the Luminex 200™ System (Merck Millipore) and Milliplex HCYTOMAG-60K-07 Human Cytokine MAGNETIC Kit (Merck Millipore). The assay was performed according to the manufacturer’s protocol. The results were analysed with the t-test.
Results
Ni-Hydrolytic Motifs Are Common in the Human Proteome and Enriched Within Sequences of the Epidermal Barrier Proteins
Our first goal was to characterize and catalogue the distribution of Ni-cleavable motifs within amino acid sequences of human proteins. To this end, the initial UniProt data were cleaned by suitable word filters to eliminate duplicates (partial, truncated or fragmented proteins), while all protein isomers were included to obtain full representation of the functional proteome. This initial data set of 79,077 proteins was searched for the general X1-S/T-c/p-H-c-X2 motifs and for the particularly interesting G-S/T-c/p-H-c-X2 motifs, obtaining 31,099 (Supplementary Table S1) and 4,111 (Supplementary Table S2) records, respectively. We also prepared complementary lists of proteins without X- (Supplementary Table S3) and G- (Supplementary Table S4) motifs. We then determined the absolute number of motifs per protein, their frequency (the count normalized by the length of a given protein, Supplementary Table S1, S2) and the number of motifs by the type (Supplementary Tables S5, S6).
Overall, we determined that as many as 40% of human proteins contain at least one Ni-hydrolytic motif, and 5% of all human proteins contain at least one fast motif (Figure 1B). The analysis of amino acid frequencies in these motifs revealed a significant overrepresentation of X1 = G in both S and T motif variants (Figures 1C,D). The cumulative distribution function (CDF) of X1 = G illustrates this finding (Figure 1E).
Notably, we obtained 13 statistically significant gene ontology (GO) terms for the proteins containing the G-motifs (p-value ≤ 0.05 after multiple testing correction); these relate mainly to organ development, organization and morphogenesis (Supplementary Tables S7, S8). For general Ni-hydrolytic motifs the number of statistically significant GO terms after correction was 145, with 56 related to the mechanisms of regulation of biological processes. We also distinguished a group of 27 GO terms related to the nervous system development, such as regulation of neuron projection development, axon guidance, brain development, neurogenesis and synapse assembly. Further 11 GO terms are related to transcription and gene expression. Detailed classifications of GO terms are provided in Supplementary Tables S9, S10. Overall, the quantitation of occurrence of the Ni-hydrolytic motifs suggests a significant coincidence with the developmental and neuronal functions. Using our database we have also selected immune-related proteins potentially susceptible to Ni-hydrolysis including tumor necrosis factor superfamily, interleukins and interleukin receptors, toll-like receptors and cluster of differentiation proteins (Supplementary Table S11).
The occurrence of hydrolytic motifs in the individual human proteins was compared quantitatively with the expected frequencies of the amino acids (Figures 1F,G). Central portions of those occurrences adhered to the Poisson distributions for both general and G-motifs. However, in both cases there were groups of proteins which substantially deviated from the Poisson distributions, especially those with more than 34 occurrences of the general motifs and 20 occurrences of the G-motifs. Strikingly, proteins with the higher than expected number of these motifs are mostly involved in the epidermal (filaggrin, filaggrin-2, hornerin) and mucosal (mucins) barrier functions (Supplementary Tables S12, S13) which could be important, given that the skin and airway mucosa provide the first line of defence against toxic nickel materials.
Ni-Hydrolysis Occurs in Filaggrin Model Peptides and the Recombinant Filaggrin Monomer Domain
The barrier proteins abundant in the Ni-hydrolytic motifs are potential targets for Ni2+ ions and their concomitant hydrolysis might compromise their function. We chose FLG for the in vitro and ex vivo experimental verification of this hypothesis due to its largest number of G-motifs (67 in proFLG) and its importance in protection from allergic sensitization, including to nickel (
The FLG monomer domains were identified on the basis of the amino acid sequence of human proFLG, (NCBI database Ref. NP_002007.1) and a prior study on the proFLG component domains (
FIGURE 2

FLG structure and susceptibility to Ni-hydrolysis. (A) The FLG gene, located on chromosome 1q21, consists of three exons and two introns. ProFLG protein contains several nearly identical FLG monomer units (green) flanked by partial monomer repeats and the N- and a C-terminal domains (dark grey). Each FLG monomer unit is separated from the other repeats by a linker region that is proteolytically cleaved during processing of proFLG into monomers [adapted from
Subsequently, we studied the kinetics of FPs hydrolysis as in our previous work (
Next, we confirmed the occurrence of Ni-hydrolysis for the FLG monomer domain, using the recombinant 10th FLG monomer domain (FLG-10, full sequence in Supplementary Table S17). The nickel concentration differed from that used in the peptide model experiments (2 and 1 mM respectively). Nickel hydrolysis has been the subject of extensive investigations in our research group. The conditions chosen for model oligopeptide studies corresponded to previously described experiments on similar peptides (
Ni-Hydrolysis of Filaggrin Occurs in Human Keratinocytes In Vitro and in Human Epidermis Ex Vivo
Having determined that the recombinant FLG monomer domain and its model peptides are cleaved by Ni-hydrolysis, we went on to investigate the biological meaning of this phenomenon at both the cellular and tissue levels. Since FLG is expressed predominantly in keratinocytes which are well differentiated, for the cellular study we used normal human epidermal keratinocytes, NHEKs, cultured in the differentiation-promoting medium, i.e. previously well-established calcium-switch model (
FIGURE 3

FLG hydrolysis in human keratinocytes in vitro and human epidermis ex vivo. (A) 2D scanning confocal images of fixed NHEK cells immunostained for FLG (green)) and nucleus (blue) after 24 h of treatment with Ni(NO3)2. Scale bar (10 µM). Diameter of KHGs and integrated intensity from the signal are presented on the Tukey box plots (n∼100 pooled counts from images from 3 independent experiments). In 1 mM nickel concentration it was not possible to observe granules. Error bars represent standard deviation. p-value = 0.031 (t-test). The main body of the boxplot indicates the interquartile ranges (IQR). Whiskers represent 1.5 x IQR. The median is marked by horizontal lines. Statistical significance is marked with asterisks: (**) p-value = 0.0012, (***) p-value < 0.0001 (Mann–Whitney U test). (B) Western blot analysis of FLG level in human epidermal sheets ex vivo after treatment 1 mM Ni(NO3)2 for 36 h, using internal G-20 anti-FLG antibody. Arrows mark the appearance of additional bands due to the cleavage. (C) Immunostaining of epidermal sheets with anti-FLG antibodies (green and nucleus (blue). 2D planes and 3D reconstructions from z-stack are presented. Scale bar (10 µM). (D) Changes in FLG mRNA expression in NHEK cells upon treatment with Ni(NO3)2 for 24 h. The graph presents ΔCT values with relative to the TBP1 housekeeping gene expression. Error bars represent standard deviation. p-value = 0.031 (t-test).
To investigate the effect of Ni2+ on the abundance of FLG in the stratified epidermis, we used ex vivo epidermal sheets obtained from skin samples collected from healthy donors (Figures 3B,C). The exposure to Ni2+ resulted in pronounced reduction in the abundance of FLG+ KHGs compared to the control samples incubated in the absence of Ni2+, as seen in confocal microscope 2D- and Z-stack images. Incubation with 1 mM of Ni2+ resulted in a complete disappearance of KGHs. Western blot assessment confirmed this reduction at the protein level in the epidermal sheets exposed to the Ni2+ salt. The reduction in the signal coming from the proFLG band (the highest band above 400 kDa) was accompanied by disappearance of the signal of lower molecular weight bands and appearance of unusual bands (marked by arrows on Figure 3B); this was confirmed for the epidermis obtained from three different donors.
The observed reduction in the FLG-related signal was due to the protein degradation and not to the mRNA level suppression, as demonstrated by the quantitative real time PCR performed on NHEKs, where we observed FLG mRNA upregulation with the increasing Ni2+ concentration (Figure 3D), likely as a compensatory mechanism.
Products of Filaggrin Ni-Hydrolysis Affect Langerhans Cells Activation Profile
Finally, we evaluated the impact of Ni-assisted FLG hydrolysis on the phenotype of antigen presenting cells. Here, monocyte derived Langerhans cells (MDLCs) were used to investigate the activation potential of Ni2+ complexed to products of hydrolysis of ex-FLG peptides (HP, Figure 2A). Their full amino acid sequences are presented in Supplementary Table S15. For comparative purposes the CD and UV-vis spectroscopic pH titrations of these complexes were performed in a broad pH range. The spectra and titration curves are presented in Supplementary Figure S7. The complex formation process was monophasic, and spectral parameters could be readily assigned to 4N complexes in all cases. In the CD spectra the alternate pattern of d-d bands was observed, typical for the ATCUN motifs (
MDLCs were incubated with mixed peptides (HP-02, HP-06, HP-07, HP-12, HP-13, HP-14) and the Ni2+-complexes (Ni-HPs) formed in molar nickel excess; NiSO4 serving as a control; the MDLCs activation was assessed using flow cytometry. In order to gain deeper insights into possible immune pathways that may be affected by the HPs, we also quantified the release of six cytokines from MDLCs, five of which are pro-inflammatory (IFN-α, TNF-α, IL-1β, IL-6, IL-8) and one anti-inflammatory (IL-10). The Luminex assay was performed for HP-06, HP-07 and HP-12.
We noted statistically significant changes between the experimental conditions in results obtained from the same monocyte donor. However, the analysis of pooled results from different biological experiments (between different donors) did not show statistical significance, possibly due to the interindividual variation or relatively low sample number (Supplementary Table S19, S20). Observed trends showed that while the presence of FLG-derived peptides alone did not affect the MDLCs profile in a substantial way, the addition of Ni-HPs resulted in an upregulation of the activation markers (CD86 and HLA-DR) on the cells and a parallel complete loss of the CD80-positivity (Supplementary Figure S9). Ni2+ and Ni-HPs conditions are correlated with the increased percentage of CD86+ and HLA-DR+ cells and loss of the CD80-positivity. As far as the cytokine responses are concerned, we noticed a trend of increased levels of TNFa, IL-6, IL-8 in Ni-HPs in comparison to the nickel only condition (Supplementary Figure S10).
Analysis of Hydrolytic Motifs Within Filaggrins From Various Species
Comparison of numbers of cleavage motifs between species shows a number of details. The full list of motif counts is presented in Supplementary Table S21 and visualised by the tree of life annotated with hydrolytic motifs datasets (Figure 4). Filaggrin, filaggrin-2 and filaggrin-like proteins were taken into consideration. Analysed species are assigned to the following orders: Primates (23), Artiodactyla (15), Carnivora (11), Rodentia (8), Perissodactyla (3), Chiroptera (2), Lagomorpha (2), Tubulidentata (1), Pholidota (1), Proboscidea (1), Dermoptera (1), Scandentia (1), Afrosoricida (1), Sirenia (1), Eulipotyphla (1), Macroscelidea (1), Didelphimorphia (1), Cingulata (1), Dasyuromorphia (1). Filaggrin-like proteins from Cichliformes and Cyprinodontiformes (Pisces) were also included. In all groups of more than 2 species, one can notice differentiation in terms of the number of motifs. In Primates however, filaggrins seem to be enriched; count at least 40 motifs per protein in most cases. Filaggrin in H.sapiens is at the top of the list here. Interesting outcome is the startling difference between the number of sites between humans and rodents. Since mice and rats are experimental species this difference shows possible issues when comparing human and rodent data.
FIGURE 4

Nickel cleavage sites dataset visualization in iTOL (
Discussion
The dermal contact with nickel mostly results from surface corrosion of metal objects of daily use by human sweat (
The Ni-hydrolysis of specific susceptible protein motifs is a candidate molecular mechanism of nickel allergy and additional adverse effects of nickel exposure in humans (
The gene ontology analysis revealed that proteins containing those Ni-hydrolytic motifs take part in diverse biological processes including transcription and gene expression; thus, we propose that unspecific proteome degradation may lead to a disturbance of cell homeostasis, contributing to both the known mechanisms of nickel toxicity as well as additional underlying adverse processes not yet ascribed to the nickel exposure. Strikingly, at the organism level, FLG and other barrier proteins known for their role in maintaining the integrity of the epidermal barrier and the mucosa, exhibit high incidence of Ni-hydrolytic motifs, making them susceptible to nickel-induced degradation. FLG seems to be especially susceptible, since a single FLG domain contains 17 individual hydrolytic motifs in a repetitive pattern, conserved within all the monomer domains; this results in nearly 200 potential cleavage sites in a single proFLG molecule.
Information about FLG evolution in vertebrate is limited. Comparison nucleotide diversity between FLG repeat regions in primates showed that FLG repeats evolved under the birth-and-death model probably as a consequence of species-specific divergence and expansion (
Based on our results, we could expect rapid degradation of FLG domains. Interestingly, the hydrolytic sequence present in the inter-domain linker was very poorly reactive, indicating that Ni2+ ions would not assist the release of FLG monomers from proFLG with and only the intradomain cleavage resulting in abnormal FLG fragments is likely. The pK values for the complex formation obtained from spectroscopic titrations indicate that hydrolytically productive complexes can form only above pH 7. Due to the locality of Ni2+ binding to FLG this feature can be extrapolated over the entire protein. However, the hydrolysis is extremely slow below the pH of 7, as it is enabled by a pH-dependent square-planar Ni2+ complex (
However, skin inflammation and keratinocyte differentiation defects lead to a reduction in the content of acidic FLG breakdown products constituting the natural moisturising factor (NMF, i.e., urocanic acid, UA and pyrrolidone carboxylic acid, PCA) within stratum corneum. This may result in the elevation of pH up to 9 locally (
We have indeed shown a decrease in KHGs-concentrated proFLG levels compared to controls incubated without Ni(NO3)2 both at the cellular and tissue levels. However, there are some limitations to this study that could be addressed in future research. First, the work focused on estimating changes in FLG concentration mainly on the basis of immunolocalization and immunodetection techniques. We performed RT-qPCR experiments on Flg mRNA levels. This should also be repeated on the epidermal sheets. We could possibly use an additional method to measure the detrimental effect of nickel on the FLG. Quantification of the NMF compartments such as PCA or UCA NMF might be a solution (
While the rate constant for the FLG domain decay is roughly equal to the sum of rates at individual hydrolysis sites under harsh reaction conditions, it is several fold higher than expected from these data for the physiological conditions. This can be tentatively interpreted as follows: at harsh conditions all His side chains have lost their positive charges, which may result in the loss of prestructuring of Ni2+ binding sites enabled by ionic interactions and H-bonds. Such prestructuring was shown to accelerate the hydrolysis (
The studied process yields C-terminal reaction products of FLG cleavage in the Ni2+-complexed form. Dissociation constants of these complexes at pH 7.4 are in the range of 0.1–1 μM (
In this context, we may propose that the similarity of effects on dendritic cells between free vs complexed Ni2+ results from the ability of added Ni2+ ions to recruit ligands in the vicinity or on the cell surface which may provide chemical environment for Ni2+ similar to that present in FLG peptides. Not only the abundance of such “prêt-à-porter” ligands in the extracellular space of the skin may be high, e.g., the serum albumin is present in the extracellular fluid at sub millimolar concentrations. The formation of Ni2+ 4N complex with this sequence is a spontaneous process that takes about an hour at neutral pH (
On the other hand, the presence of 50 µM Ni2+-complexed HPs seemingly caused a stronger effect, which should be however confirmed with more biological replicates. Furthermore, it is important to stress that the database of human proteins highlighted many more targets potentially susceptible to Ni-hydrolysis, including some immune-related. Those include cytokines produced by dendritic cells upon the Ni2+ exposure (such TNF-α, IL-6), cluster of differentiation markers playing an important role in T-cell activation (CD80, CD86) and innate recognition receptors such as TLRs; these induce proinflammatory cytokine production and antigen presentation to T-cells. Thus, Ni-hydrolysis might dysregulate important immune responses. On the other hand we cannot exclude a possibility of spontaneous nickel-assisted degradation of those protein compartments similar to that observed for FLG; this factor could hinder the interpretation and should be taken into account. An interesting extension of our research work would be to study cytokine levels after keratinocyte exposure to nickel. Keratinocytes may act as instigators of cutaneous inflammation (
The results presented above indicate that Ni2+ ions can cause FLG degradation via direct, non-enzymatic hydrolysis within minutes, and suggest that the hydrolysis products may trigger activation of Langerhans cells with accompanied proinflammatory milieu in the skin during nickel contact skin allergy. Indeed, Ni2+ ions have been previously shown to modulate intracellular pathways in dendritic cells via NF-κB activity and p38 MAPK regulation (
Proteomic studies with human monocytes identified protein species linked to distinct molecular processes including cell death, that are specifically regulated by Ni2+; the regulation mechanism was not clarified (
Ni2+-assisted cleavage of barrier proteins, including FLG, may contribute to clinical disease associated with nickel exposure.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.
Author contributions
This project was conceived and designed by EIP, DG-O, MG, and WB. GO supervised the work. All of the experimental work was performed by EIP, DG-O, MK, AB, and DP. Selection of some FLG model peptides (QAASSHEQA, YQVSTHEQS, ADSSRHSGI) at the initial stage of the project was performed by TF. Computational analyses were performed by SM, AG, and JP. The manuscript was written and prepared by EIP, DG-O, and WB.
Funding
The study was funded in part by the project carried out as part of the Foundation for Polish Science program (TEAM/2009-4/1) co-financed from European Regional Development Fund resources within the framework of Operational Program Innovative Economy. The equipment used was sponsored in part by the Centre for Preclinical Research and Technology (CePT), a project co-sponsored by European Regional Development Fund and Innovative Economy, The National Cohesion Strategy of Poland. EIP is a scholar of the Mazovia Scholarship Program for Innovative Mazovian District co-financed by the European Union under the European Social Fund (No. 493/ES/ZS-III/W-POKL/14), Preludium 5 (No. DEC-2013/09/N/NZ6/02405) and the ETIUDA 2 (No. DEC-2014/12/T/NZ6/00505) projects, funded by the National Science Centre. DG-O and GO are grateful for the support from the Medical Research Council (UK) and the NIHR Oxford Biomedical Research Centre. DG-O also acknowledged funding from the British Skin Foundation.
Acknowledgments
We thank MSc Małgorzata Orłowska for her help with the iTOL visualization.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmolb.2022.828674/full#supplementary-material
References
1
AbramoffM. (2007). ImageJ as an Image Processing Tool and Library. Micros. Microanal.13 (S02), 1672–1673. 10.1017/s1431927607079652
2
AcerenzaL.MizrajiE. (1997). Cooperativity: a Unified View. Biochim. Biophys. Acta (Bba) - Protein Struct. Mol. Enzymol.1339, 155–166. 10.1016/s0167-4838(96)00228-2
3
AdeN.AntoniosD.Kerdine-RomerS.BoisleveF.RoussetF.PallardyM. (2007). NF-κB Plays a Major Role in the Maturation of Human Dendritic Cells Induced by NiSO4 but Not by DNCB. Toxicol. Sci.99, 488–501. 10.1093/toxsci/kfm178
4
AhlströmM. G.ThyssenJ. P.MennéT.MidanderK.JulanderA.LidénC.et al (2018). Short Contact with Nickel Causes Allergic Contact Dermatitis: an Experimental Study. Br. J. Dermatol.179, 1127–1134. 10.1111/bjd.16935
5
AhlströmM. G.ThyssenJ. P.WennervaldtM.MennéT.JohansenJ. D. (2019). Nickel Allergy and Allergic Contact Dermatitis: A Clinical Review of Immunology, Epidemiology, Exposure, and Treatment. Contact Dermatitis81, 227–241. 10.1111/cod.13327
6
AntoniosD.RousseauP.LarangéA.Kerdine-RömerS.PallardyM. (2010). Mechanisms of IL-12 Synthesis by Human Dendritic Cells Treated with the Chemical Sensitizer NiSO4. J.I.185, 89–98. 10.4049/jimmunol.0901992
7
ArianiH. H.Polkowska-NowakowskaA.BalW. (2013). Effect of D-Amino Acid Substitutions on Ni(II)-assisted Peptide Bond Hydrolysis. Inorg. Chem.52, 2422–2431. 10.1021/ic3022672
8
BalW.ChmurnyG. N.HiltonB. D.SadlerP. J.TuckerA. (1996). Axial Hydrophobic Fence in Highly-Stable Ni(II) Complex of Des-Angiotensinogen N-Terminal Peptide. J. Am. Chem. Soc.118, 4727–4728. 10.1021/ja953988j
9
BalW.ChristodoulouJ.SadlerP. J.TuckerA. (1998). Multi-metal Binding Site of Serum Albumin. J. Inorg. Biochem.70, 33–39. 10.1016/s0162-0134(98)00010-5
10
BalW.LiangR.LukszoJ.LeeS.-H.DizdarogluM.KasprzakK. S. (2000). Ni(II) Specifically Cleaves the C-Terminal Tail of the Major Variant of Histone H2A and Forms an Oxidative Damage-Mediating Complex with the Cleaved-Off Octapeptide. Chem. Res. Toxicol.13, 616–624. 10.1021/tx000044l
11
BarkerJ. N. W. N.GriffithsC. E. M.NickoloffB. J.MitraR. S.DixitV. M.NickoloffB. J.et al (1991). Keratinocytes as Initiators of Inflammation. Lancet337, 211–214. 10.1016/0140-6736(91)92168-2
12
BoisleveF.KerdineromerS.PallardyM. (2005). Implication of the MAPK Pathways in the Maturation of Human Dendritic Cells Induced by Nickel and TNF-?Toxicology206, 233–244. 10.1016/j.tox.2004.08.015
13
BrownS. J.Irwin McLeanW. H. (2012). One Remarkable Molecule: Filaggrin. J. Invest. Dermatol.132, 751–762. 10.1038/jid.2011.393
14
CandiE.SchmidtR.MelinoG. (2005). The Cornified Envelope: a Model of Cell Death in the Skin. Nat. Rev. Mol. Cel. Biol.6, 328–340. 10.1038/nrm1619
15
CangulH.BrodayL.SalnikowK.SutherlandJ.PengW.ZhangQ.et al (2002). Molecular Mechanisms of Nickel Carcinogenesis. Toxicol. Lett.127, 69–75. 10.1016/s0378-4274(01)00485-4
16
ChanW.WhiteP. (2000). Fmoc Solid Phase Peptide Synthesis: A Practical Approach. Oxford, United Kingdom: Peterson’s.
17
ChenH.DavidsonT.SingletonS.GarrickM. D.CostaM. (2005). Nickel Decreases Cellular Iron Level and Converts Cytosolic Aconitase to Iron-Regulatory Protein 1 in A549 Cells. Toxicol. Appl. Pharmacol.206, 275–287. 10.1016/j.taap.2004.11.011
18
CrooksG. E.HonG.ChandoniaJ.-M.BrennerS. E. (2004). WebLogo: a Sequence Logo Generator. Genome Res.14, 1188–1190. 10.1101/gr.849004
19
FluhrJ. W.EliasP. M.ManM.-Q.HupeM.SeldenC.SundbergJ. P.et al (2010). Is the Filaggrin-Histidine-Urocanic Acid Pathway Essential for Stratum Corneum Acidification?J. Invest. Dermatol.130, 2141–2144. 10.1038/jid.2010.74
20
FullertonA.HoelgaardA. (1988). Binding of Nickel to Human Epidermis In Vitro. Br. J. Dermatol.119, 675–682. 10.1111/j.1365-2133.1988.tb03482.x
21
FunakoshiT.InoueT.ShimadaH.KojimaS. (1997). The Mechanisms of Nickel Uptake by Rat Primary Hepatocyte Cultures: Role of Calcium Channels. Toxicology124, 21–26. 10.1016/s0300-483x(97)00131-5
22
GenchiG.CarocciA.LauriaG.SinicropiM. S.CatalanoA. (2020). Nickel: Human Health and Environmental Toxicology. Int. J. Environ. Res. Public Health17, 679. 10.3390/ijerph17030679
23
GibbsN. K.TyeJ.NorvalM. (2008). Recent Advances in Urocanic Acid Photochemistry, Photobiology and Photoimmunology. Photochem. Photobiol. Sci.7, 655–667. 10.1039/b717398a
24
GruberR.EliasP. M.CrumrineD.LinT.-K.BrandnerJ. M.HachemJ.-P.et al (2011). Filaggrin Genotype in Ichthyosis Vulgaris Predicts Abnormalities in Epidermal Structure and Function. Am. J. Pathol.178, 2252–2263. 10.1016/j.ajpath.2011.01.053
25
Gutowska-OwsiakD.OggG. S. (2012). The Epidermis as an Adjuvant. J. Invest. Dermatol.132, 940–948. 10.1038/jid.2011.398
26
Gutowska-OwsiakD.de La SernaJ. B.FritzscheM.NaeemA.PodobasE. I.LeemingM.et al (2018). Orchestrated Control of Filaggrin–Actin Scaffolds Underpins Cornification. Cel. Death Dis.9, 412. 10.1038/s41419-018-0407-2
27
Gutowska-OwsiakD.PodobasE. I.EggelingC.OggG. S.de la SernaJ. B. (2020). Addressing Differentiation in Live Human Keratinocytes by Assessment of Membrane Packing Order. Front. Cel. Dev. Biol.8, 573230. 10.3389/fcell.2020.573230
28
HagvallL.PourM. D.FengJ.KarmaM.HedbergY.MalmbergP. (2021). Skin Permeation of Nickel, Cobalt and Chromium Salts in Ex Vivo Human Skin, Visualized Using Mass Spectrometry Imaging. Toxicol. Vitro76, 105232. 10.1016/j.tiv.2021.105232
29
IARC Working Group on the Evaluation of Carcinogenic Risks to Humans, and International Agency for Research on Cancer (2016). Outdoor Air Pollution. Lyon, France: International Agency for Research on Cancer, World Health Organization.
30
JakobA.MussotterF.OhnesorgeS.DietzL.PardoJ.HaidlI. D.et al (2017). Immunoproteomic Identification and Characterization of Ni-Regulated Proteins Implicates Ni in the Induction of Monocyte Cell Death. Cell Death Dis.8, e2684. 10.1038/cddis.2017.112
31
KaraczynA. A.BalW.NorthS. L.BareR. M.HoangV. M.FisherR. J.et al (2003). The Octapeptidic End of the C-Terminal Tail of Histone H2A Is Cleaved off in Cells Exposed to Carcinogenic Nickel(II). Chem. Res. Toxicol.16, 1555–1559. 10.1021/tx0300277
32
KasprzakK. S.SundermanF. W.JrSalnikowK. (2003). Nickel Carcinogenesis. Mutat. Res.533, 67–97. 10.1016/j.mrfmmm.2003.08.021
33
KezicS.KempermanP. M. J. H.KosterE. S.de JonghC. M.ThioH. B.CampbellL. E.et al (2008). Loss-of-function Mutations in the Filaggrin Gene lead to Reduced Level of Natural Moisturizing Factor in the Stratum Corneum. J. Invest. Dermatol.128, 2117–2119. 10.1038/jid.2008.29
34
KlugerN. (2021). Nickel and Tattoos: Where Are We?Contact Dermatitis. 10.1111/cod.13869
35
KoperaE.KrezelA.ProtasA. M.BelczykA.BonnaA.Wysłouch-CieszyńskaA.et al (2010). Sequence-specific Ni(II)-dependent Peptide Bond Hydrolysis for Protein Engineering: Reaction Conditions and Molecular Mechanism. Inorg. Chem.49, 6636–6645. 10.1021/ic1005709
36
KoppesS. A.KempermanP.Van TilburgI.Calkoen-KwaF.EngebretsenK. A.PuppelsG. J.et al (2017). Determination of Natural Moisturizing Factors in the Skin: Raman Microspectroscopy versus HPLC. Biomarkers22, 502–507. 10.1080/1354750x.2016.1256428
37
KrezelA.KoperaE.ProtasA. M.PoznańskiJ.Wysłouch-CieszyńskaA.BalW. (2010). Sequence-specific Ni(II)-dependent Peptide Bond Hydrolysis for Protein Engineering. Combinatorial Library Determination of Optimal Sequences. J. Am. Chem. Soc.132, 3355–3366. 10.1021/ja907567r
38
KriegerE.DardenT.NabuursS. B.FinkelsteinA.VriendG. (2004). Making Optimal Use of Empirical Energy Functions: Force-Field Parameterization in crystal Space. Proteins57, 678–683. 10.1002/prot.20251
39
LetunicI.BorkP. (2021). Interactive Tree of Life (iTOL) V5: an Online Tool for Phylogenetic Tree Display and Annotation. Nucleic Acids Res.49, W293–W296. 10.1093/nar/gkab301
40
LiM. Z.ElledgeS. J. (2007). Harnessing Homologous Recombination In Vitro to Generate Recombinant DNA via SLIC. Nat. Methods4, 251–256. 10.1038/nmeth1010
41
LiQ.LiuH.AlattarM.JiangS.HanJ.MaY.et al (2015). The Preferential Accumulation of Heavy Metals in Different Tissues Following Frequent Respiratory Exposure to PM2.5 in Rats. Sci. Rep.5, 16936. 10.1038/srep16936
42
MadshusI. H. (1988). Regulation of Intracellular pH in Eukaryotic Cells. Biochem. J.250, 1–8. 10.1042/bj2500001
43
MaherB. A.AhmedI. A. M.KarloukovskiV.MacLarenD. A.FouldsP. G.AllsopD.et al (2016). Magnetite Pollution Nanoparticles in the Human Brain. Proc. Natl. Acad. Sci. U. S. A.113, 10797–10801. 10.1073/pnas.1605941113
44
MatoltsyA. G.MatoltsyM. N. (1970). The Chemical Nature of Keratohyalin Granules of the Epidermis. J. Cel Biol.47, 593–603. 10.1083/jcb.47.3.593
45
MidanderK.PanJ.WallinderI. O.HeimK.LeygrafC. (2007). Nickel Release from Nickel Particles in Artificial Sweat. Contact Dermatitis56, 325–330. 10.1111/j.1600-0536.2007.01115.x
46
MontgomeryD. C.RungerG. C. (2007). Applied Statistics and Probability for Engineers. 3RD ED. United States of America: John Wiley & Sons. With CD.
47
NestleF. O.Di MeglioP.QinJ.-Z.NickoloffB. J. (2009). Skin Immune Sentinels in Health and Disease. Nat. Rev. Immunol.9, 679–691. 10.1038/nri2622
48
NieminenT. M.UkonmaanahoL.RauschN.ShotykW. (2007). Biogeochemistry of Nickel and its Release into the Environment. Nickel Its Surprising Impact Nat., 1–29. 10.1002/9780470028131.ch1
49
NovakN.BaurechtH.SchäferT.RodriguezE.WagenpfeilS.KloppN.et al (2008). Loss-of-function Mutations in the Filaggrin Gene and Allergic Contact Sensitization to Nickel. J. Invest. Dermatol.128, 1430–1435. 10.1038/sj.jid.5701190
50
OberdörsterG.ElderA.RinderknechtA. (2009). Nanoparticles and the Brain: Cause for Concern?J. Nanosci. Nanotechnol.9, 4996–5007. 10.1166/jnn.2009.gr02
51
PappasR. S. (2011). Toxic Elements in Tobacco and in Cigarette Smoke: Inflammation and Sensitization. Metallomics3, 1181–1198. 10.1039/c1mt00066g
52
PodobasE. I.BonnaA.Polkowska-NowakowskaA.BalW. (2014). Dual Catalytic Role of the Metal Ion in Nickel-Assisted Peptide Bond Hydrolysis. J. Inorg. Biochem.136, 107–114. 10.1016/j.jinorgbio.2014.03.008
53
ProtasA. M.ArianiH. H. N.BonnaA.Polkowska-NowakowskaA.PoznańskiJ.BalW. (2013). Sequence-specific Ni(II)-dependent Peptide Bond Hydrolysis for Protein Engineering: Active Sequence Optimization. J. Inorg. Biochem.127, 99–106. 10.1016/j.jinorgbio.2013.07.037
54
Rietz LiljedahlE.JohansonG.Korres de PaulaH.FanibandM.AssarssonE.LittorinM.et al (2021). Filaggrin Polymorphisms and the Uptake of Chemicals through the Skin-A Human Experimental Study. Environ. Health Perspect.129, 17002. 10.1289/EHP7310
55
RomeroV.HosomichiK.NakaokaH.ShibataH.InoueI. (2017). Structure and Evolution of the Filaggrin Gene Repeated Region in Primates. BMC Evol. Biol.17, 10. 10.1186/s12862-016-0851-5
56
RossA. A.MüllerK. M.WeeseJ. S.NeufeldJ. D. (2018). Comprehensive Skin Microbiome Analysis Reveals the Uniqueness of Human Skin and Evidence for Phylosymbiosis within the Class Mammalia. Proc. Natl. Acad. Sci. U. S. A.115, E5786–E5795. 10.1073/pnas.1801302115
57
Sainte-MarieI.JumbouO.TenaudI.DrenoB. (1998). Comparative Study of the In Vitro Inflammatory Activity of Three Nickel Salts on Keratinocytes. Acta Derm. Venereol.78, 169–172. 10.1080/000155598441459
58
SandilandsA.SutherlandC.IrvineA. D.McLeanW. H. I. (2009). Filaggrin in the Frontline: Role in Skin Barrier Function and Disease. J. Cel Sci.122, 1285–1294. 10.1242/jcs.033969
59
SchneiderT. D.StephensR. M. (1990). Sequence Logos: a New Way to Display Consensus Sequences. Nucleic Acids Res.18, 6097–6100. 10.1093/nar/18.20.6097
60
SchremlS.MeierR. J.WolfbeisO. S.LandthalerM.SzeimiesR.-M.BabilasP. (2011). 2D Luminescence Imaging of pH In Vivo. Proc. Natl. Acad. Sci.108, 2432–2437. 10.1073/pnas.1006945108
61
SeggerD.AßmusU.BrockM.ErasmyJ.FinkelP.FitznerA.et al (2008). Multicenter Study on Measurement of the Natural pH of the Skin Surface. Int. J. Cosmet. Sci.30, 75. 10.1111/j.1468-2494.2007.00403_1.x
62
SigelH.TriboletR.YamauchiO. (1990). The Imidazole Group and its Stacking Properties in Mixed Ligand Metal Ion Complexes. Comments Inorg. Chem.9, 305–330. 10.1080/02603599008035813
63
SokolowskaM.KrezelA.DybaM.SzewczukZ.BalW. (2002). Short Peptides Are Not Reliable Models of Thermodynamic and Kinetic Properties of the N-Terminal Metal Binding Site in Serum Albumin. Eur. J. Biochem.269, 1323–1331. 10.1046/j.1432-1033.2002.02772.x
64
TallkvistJ.HenrikssonJ.d’ArgyR.TjälveH. (1998). Transport and Subcellular Distribution of Nickel in the Olfactory System of Pikes and Rats. Toxicol. Sci.43, 196–203. 10.1093/toxsci/43.2.196
65
ThierseH.-J.MoulonC.AllespachY.ZimmermannB.DoetzeA.KuppigS.et al (2004). Metal-Protein Complex-Mediated Transport and Delivery of Ni2 to TCR/MHC Contact Sites in Nickel-Specific Human T Cell Activation. J. Immunol.172, 1926–1934. 10.4049/jimmunol.172.3.1926
66
ThierseH.-J.GamerdingerK.JunkesC.GuerreiroN.WeltzienH. U. (2005). T Cell Receptor (TCR) Interaction with Haptens: Metal Ions as Non-classical Haptens. Toxicology209, 101–107. 10.1016/j.tox.2004.12.015
67
ThyssenJ. P.JohansenJ. D.LinnebergA.MennéT.NielsenN. H.MeldgaardM.et al (2010). The Association between Null Mutations in the Filaggrin Gene and Contact Sensitization to Nickel and Other Chemicals in the General Population. Br. J. Dermatol.162, 1278–1285. 10.1111/j.1365-2133.2010.09708.x
68
VoukV. B.PiverW. T. (1983). Metallic Elements in Fossil Fuel Combustion Products: Amounts and Form of Emissions and Evaluation of Carcinogenicity and Mutagenicity. Environ. Health Perspect.47, 201–225. 10.1289/ehp.8347201
69
WangH.SongL.JuW.WangX.DongL.ZhangY.et al (2017). The Acute Airway Inflammation Induced by PM2.5 Exposure and the Treatment of Essential Oils in Balb/c Mice. Sci. Rep.7, 44256. 10.1038/srep44256
70
WezynfeldN. E.BossakK.GochW.BonnaA.BalW.FrączykT. (2014). Human Annexins A1, A2, and A8 as Potential Molecular Targets for Ni(II) Ions. Chem. Res. Toxicol.27, 1996–2009. 10.1021/tx500337w
71
WezynfeldN. E.FrączykT.BalW. (2016). Metal Assisted Peptide Bond Hydrolysis: Chemistry, Biotechnology and Toxicological Implications. Coord. Chem. Rev.327-328, 166–187. 10.1016/j.ccr.2016.02.009
72
World Health Organization (2000). Air Quality Guidelines for Europe. WHO Reg. Publ. Eur. Ser.V–X, 1–273.
73
ZambelliB.UverskyV. N.CiurliS. (2016). Nickel Impact on Human Health: An Intrinsic Disorder Perspective. Biochim. Biophys. Acta1864, 1714–1731. 10.1016/j.bbapap.2016.09.008
Summary
Keywords
filaggrin, human proteome, protein degradation, Ni2+-assisted hydrolysis, nickel toxicity, nickel allergy
Citation
Podobas EI, Gutowska-Owsiak D, Moretti S, Poznański J, Kulińczak M, Grynberg M, Gruca A, Bonna A, Płonka D, Frączyk T, Ogg G and Bal W (2022) Ni2+-Assisted Hydrolysis May Affect the Human Proteome; Filaggrin Degradation Ex Vivo as an Example of Possible Consequences. Front. Mol. Biosci. 9:828674. doi: 10.3389/fmolb.2022.828674
Received
03 December 2021
Accepted
31 January 2022
Published
10 March 2022
Volume
9 - 2022
Edited by
Kourosh Honarmand Ebrahimi, King’s College London, United Kingdom
Reviewed by
Michel Simon, Université de Toulouse, France
Leonid Breydo, West Pharmaceutical Services, United States
Updates

Check for updates
Copyright
© 2022 Podobas, Gutowska-Owsiak, Moretti, Poznański, Kulińczak, Grynberg, Gruca, Bonna, Płonka, Frączyk, Ogg and Bal.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Ewa Izabela Podobas, ei.podobas@uw.edu.pl; Marcin Grynberg, mr.cingg@gmail.com
This article was submitted to Cellular Biochemistry, a section of the journal Frontiers in Molecular Biosciences
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.