ORIGINAL RESEARCH article

Front. Microbiol., 10 July 2020

Sec. Fungi and Their Interactions

Volume 11 - 2020 | https://doi.org/10.3389/fmicb.2020.01426

A Fungal Diterpene Synthase Is Responsible for Sterol Biosynthesis for Growth

  • 1. Beijing Key Laboratory of Genetic Engineering Drug and Biotechnology, Institute of Biochemistry and Biotechnology, College of Life Sciences, Beijing Normal University, Beijing, China

  • 2. Zhejiang Medicine Co., Ltd., Zhejiang, China

  • 3. Department of Microbiology, College of Life Sciences, Nankai University, Tianjin, China

Abstract

A conserved open reading frame, dps, is described in Pestalotiopsis microspora, sharing a remarkable similarity with fungal diterpene synthases whose function is less studied. Loss-of-function approach manifested that dps was necessary for the growth and the development of the fungus. A deletion strain, dpsΔ, showed a fundamental retardation in growth, which could deliberately be restored by the addition of exogenous sterols to the media. Gas chromatography–mass spectrometry analysis confirmed the loss of the ability to produce certain sterols. Thus, the tolerance and the resistance of dpsΔ to several stress conditions were impaired. Secondary metabolites, such as the polyketide derivative dibenzodioxocinones, were significantly diminished. At the molecular level, the deletion of dps even affected the expression of genes in the mevalonate pathway. This report adds knowledge about fungal diterpene synthases in Pestalitiopsis microspora.

Introduction

Terpenoids are known as one of the most abundant natural products (Ruan et al., 2019). In fungi, terpenoids are usually synthesized from two C5 units, isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) (Li et al., 2015). These two units were condensed via the mevalonate (MVA) pathway and undergo a cyclization step to form terpenoid precursors by various terpene synthases, e.g., monoterpene synthase (Lange, 2015), sesquiterpene synthase (Wang et al., 2016), diterpene synthase, triterpene synthase (Dhingra and Cramer, 2017), and even taxadiene synthase (Bian et al., 2017). Due to bioactivities, many of them have been used in diverse fields, such as medicinal chemistry (Austin et al., 1988), food additives (Ravichandran et al., 2018), and biofuels (Wu et al., 2017). Acquiring terpenoids at the industrial level suffers difficulties, e.g., low content in natural materials. Fermentation by microorganisms is an attractive strategy to obtain these natural products, owing to its large scale and comparatively lower cost if compared to other methods, i.e., extraction from raw material or plant cell culture (Gauvin et al., 2000; Kobayashi and Shigemori, 2002). Many fungi have been reportedly used in the production of terpenoids, i.e., pinene, limonene, camphor, and likely artemisinin (Wu et al., 2017).

P. microspora strain NK17 was isolated by our laboratory and characterized as a producer of a number of dibenzodioxocinones (Niu et al., 2015), with promising application in drug development. A previous study showed that in NK17 there was a diterpene synthase, dps, and it is the only enzyme of this kind in the genome (Chen et al., 2015). Intriguingly, this diterpene synthase shows similarity, to some extent, to the taxadiene synthase which catalyzes the first committed step in the biosynthesis of the antitumor drug paclitaxel in Pacific yew and to the bacterial ent-kaurene synthase in cladogram (Figure 1A). To characterize the role of this ubiquitous enzyme in fungi, we employed gene expression information and metabolite profiling comparatively in the wild type and the mutant strain dpsΔ. We demonstrated that dps played a critical role in the biosynthesis of fungal sterols and was indispensable for the growth of P. microspora NK17.

FIGURE 1

Materials and Methods

Strains and Plasmids

The fungus P. microspora NK17 was isolated by our laboratory and was maintained in potato lactose broth (PLB) at 28°C and 200 rpm or on PLA [PLB with 2% (w/w) agar] at 28°C. The orotidine 5’-phosphate decarboxylase-deficient strain ura3Δ was constructed by Chen et al. (2017).

Escherichia coli DB3.1 (Invitrogen, Carlsbad, CA, United States) was used to propagate the pOSCAR plasmid (Chen et al., 2017), while the other plasmids used in this study were generally propagated in E. coli DH5α. Agrobacterium tumefaciens LBA4404 was used for A. tumefaciens-mediated transformation (ATMT) of NK17 (Yu et al., 2015). All of the bacterial strains were cultured in Luria–Bertani medium with appropriate antibiotics at 37°C (for E. coli) or 28°C (for A. tumefaciens) and 200 rpm when needed. An inducing medium (IM) with 200 mg/ml uracil and 20 mg/ml acetosyringone (AS, Sigma, St. Louis, MO, United States) was used as the minimal medium for the selection of NK17 transformants.

Construction of the Deletion Vector pOSCAR-dpsΔ

The deletion vector of dps was constructed by the in-fusion method. A pOSCAR plasmid containing the ura3 gene was used as the marker (Chen et al., 2017). First, the 5’-flank and the 3’-flank were amplified from the NK17 genome via PCR and purified by a DNA Gel Extraction Kit (Axygen, Union City, CA, United States). Then, the plasmid was cut by the enzyme EcoRI, and an in-fusion reaction was performed to add the 5’-flank to pOSCAR, resulting in the intermediate plasmid pOSCAR-dpsΔ-up. The primer pair dpsΔ-up-F/ura3-R (Table 1) was used to verify the plasmid. This intermediate plasmid was next cut by enzyme HindIII, and the 3’-flank was added to the plasmid via an in-fusion reaction. The primer pair ura3-F/dpsΔ-down-R (Table 1) was applied for PCR to verify the final plasmid by the size of the bonds. Thus, the dps deletion vector pOSCAR-dpsΔ was constructed completely.

TABLE 1

PrimerSequence (5′–3′)
aact-SATTCCCAGATCGCCACCT
aact-ASCTACGACCAGTTCCACATG
hmgs-STGACCTTCTGCGATGACA
hmgs-ASAGACGTGCTCCATGTAGG
hmgr-SGCGTCACCAGTAGTAGTC
hmgr-ASAAGATTCGTCGTTCCATCA
mk-SGCAGCGTCAATGGTGTAA
mk-ASGCCGAGTTCTTGTGAATCT
pmk-SGGTTACCTGGTGCTGGAT
pmk-ASGTGGAGATGTAGGTCAAGAC
idi-SCCGAGATTGATACGACTTC
idi-ASGTGCCTTGTAGTGAATGC
ggpps-SATAATGCTTCTCTGCTTGTC
ggpps-ASGGATCGAATGGAGTGTATAAC
actin-STCGTGACATCAAGGAGAAG
actin-ASGAAGCGAGAATGGAACCA
dps-up-FAGCTCAAGCTAAGCTTGACAAGTCCAAGCCTGAG
dps-up-RTGGCTAGGACAAGCTTCGAATACATCCAAGAAGTCTC
dps-down-FAACATCAAGGGAATTCTCTAGACATCGTCAGCCTGAAGATAT
dps-down-RACGCCGAATTGAATTCAAGACATGCACGTTGGTT
dps-up-upCGCCAATGTCAAGTTCCA
ura3-RACTGGTAGTGTGGTAGGTA
Qdps-FCCTCATAATCTTGTTCCAGTC
Qdps-RCAATCTTCCTTACGATCTTCC

Primers used in this study.

Construction of dps Deletion Strain dpsΔ

Ten micrograms of the pOSCAR-dpsΔ vector was transformed into A. tumefaciens LBA4404 by ATMT following the protocol described by Chen et al. (2017) and Wang et al. (2017). Then, A. tumefaciens LBA4404 transformants harboring pOSCAR-dpsΔ were co-cultured with 106 conidia of ura3Δ at 28°C on a nitrocellulose filter, which was spread on an IM minimal medium plate. After 2 days, the filter was transferred to a selection medium PLA plate supplemented with kanamycin (100 mg/ml). Another 2 days later, three transformants were transferred to a new PLA plate. Single-spore isolation was applied for every transformant after it had grown for 5 days. Then, the total DNA from each transformant was extracted from mycelium after growing in 100 ml of PLB for 4 days. The primer pair dpsΔ-up/ura3-R was used to verify the transformants. In addition, the strains were further verified by Southern blot following the protocol of Zhang et al. (2016).

RNA Preparation, Reverse-Transcription PCR, and qRT-PCR

TRIzol Kit was used to prepare total RNA from lyophilized mycelia after they had grown for 4 days. Then, reverse-transcription PCR (RT-PCR) was performed as described previously by Zhang et al. (2016).

To examine the expression of dps in dpsΔ, two pairs of primers, actin-F/actin-R for the actin-encoding gene ACT and Qdps-F/Qdps-R for dps, were designed to amplify the cDNA of NK17 and dpsΔ by RT-PCR and qRT-PCR. The assay was also performed to examine the expression of MVA genes. The primers used in this assay are listed in Table 1.

Analysis of Secondary Metabolites

The particular metabolites, dibenzodioxocinones, and some other secondary metabolites of NK17 and dpsΔ were analyzed by high-performance liquid chromatography (HPLC) and gas chromatography–mass spectrometry (GC–MS), respectively. First, the two strains, NK17 and dpsΔ, were cultured in 100 ml of PLA medium for 7 days. Then, 1 ml of spore suspension was added to 500 g of sweet potato waste medium for solid fermentation. After 15 days, 500 ml of methyl alcohol was added into the fermentation medium to extract the metabolites. Next, the extracts were collected by filtration and concentrated to approximately 50 ml. Finally, the extracts of NK17 and dpsΔ were analyzed by HPLC or GC–MS. The HPLC analysis (Agilent 1100, Agilent Technologies, Santa Clara, CA, United States) was conducted at 40°C, using A Kromasil C18 ODS column (4.6 mm × 250 mm, AKZO Nobel, Gland, Switzerland). The mobile phase of HPLC was MeOH/H2O (70/30, v/v) at a flow rate of 1 ml/min, and 20 μl of the sample was injected and analyzed at 227 nm. In the GC–MS condition, 1 μl of sample was injected into GC–MS (Bruker 320), using a DB-3 MS (0.25 μm × 0.25 μm × 30 m) column at analyzing temperature of 250°C, scan range, 45–8,000 Da. In this experiment, the sweet potato waste medium without inoculation was analyzed as the negative control.

Drug and Stress Sensitivity Assay

To test the effect of dps on the growth and the drug sensitivity of NK17, 2 and 4 μg/ml of amphotericin (AmB) and 300 and 600 μg/ml of hydroxyurea (HU) were added to the PLA plates. In addition, 0.5 and 1 M NaCl were added to the PLA plate to test the osmotic sensitivity of these mutants. The temperature susceptibility of the dpsΔ mutant strains was tested at 15, 22, and 28°C. The wild-type NK17 was used as control. Each set of conditions was applied in triplicates, and the growth of the strains in each assay was recorded daily.

Results

Characterization of dps in NK17

Via functional domain alignment, a diterpene synthase gene in NK17, which shared a remarkable similarity (44.66%) to ent-kaurene synthase in Hypoxylon sp. EC38 (Wu et al., 2017; Figure 1), was found and thus designated as dps (dps in P. microspora NK17). A phylogenetic tree was built by the software MEGA7 package based on the deduced protein sequence of dps and terpene synthase in other fungi (Figure 1A). There is a conserved ent-copalyl diphosphate synthase domain, PLN05290, in the protein (Figure 1B). The sequence similarity suggests that dps was potentially responsible for the biosynthesis of diterpenes in NK17.

To test the function of dps, we created a disruption of dps by homologous targeting via ATMT in NK17 ura3Δ using the selection marker ura3 complementation (Figure 2A). One of the mutation strains, named dpsΔ, was selected for Southern blotting. The 5’ flanking region was used as the probe to hybridize to a fragment of 988 bp (in wild type) and a fragment of 2,452 bp in dpsΔ (Figure 2B). The blotting confirmed the disruption of dps. The result of real-time PCR also showed the loss of expression of dps in dpsΔ (Figure 2C).

FIGURE 2

Roles of dps in the Biosynthesis of Secondary Metabolites

Diterpene synthase is a key enzyme in the biosynthesis of diterpenes (Koksal et al., 2011; Pelot et al., 2019). To investigate whether dps was required for the group of secondary metabolites, we first conducted HPLC profiling for the deletion strain dpsΔ. Extracts were prepared from sweet potato waste cultures statically grown for 13 days at 28°C. In HPLC profiling, we found that in dpsΔ strains the production of dibenzodioxocinones was reduced to 37% of the wild-type level (Figure 3A). In a previous study, we have reported that dibenzodioxocinones are the number of polyketides and a dominant group of secondary metabolites in NK17 (Figure 3B; Niu et al., 2015; Liu Y. et al., 2019). In this analysis, dibenzodioxocinone 1’,2’-epoxy-3’,4’-didehydropenicillide (Liu Y. et al., 2019) was monitored at a retention time of 17.6 min. In addition, the HPLC analysis found no new compounds after the deletion of the dps gene (Figure 3A).

FIGURE 3

To better understand the roles of dps in secondary metabolism, GC–MS was applied to compare the production of terpenes in the extracts of dpsΔ and the wild type. As a result, we found that the peak corresponding to sterols, at a retention time of 19.636 min in the total ion current, was absent in the metabolites of dpsΔ (Figure 3C). Sterols are triterpenoids that are usually cyclized by sterol synthase, such as lanosterol synthase and cycloartenol synthase (Nes, 2011), instead of diterpene synthase. Additionally, in the GC–MS spectrum, the peak corresponding to squalene, the key precursor of sterols (Nes, 2011), was observed at a retention time of 19.526 min in both dpsΔ and the wild type (Figure 3C and Supplementary Figure S1). These data suggest that dps participates in the biosynthesis of precursors of triterpenoids, e.g., sterols, in NK17 and we were unable to detect any new diterpenes in the metabolites of the wild-type NK17.

dps Is Required for the Growth of NK17 and Resistance to External Stress

As components in cellular membranes, sterols play a critical role in the physiology of eukaryotic cells, such as in oxidative stress and in membrane structure (Gold et al., 2016; Liu Z. et al., 2019). We observed, as discussed above, that dps could affect the biosynthesis of sterols in NK17 (Figure 3C). To test the role of dps in the growth of NK17, we further analyzed the colony diameters of dpsΔ and the wild type on the PLA plates at 28°C (Figure 4A) and lower temperature, i.e., 15 and 22°C (Figure 4B). The colony diameter of dpsΔ was nearly 50% smaller than that of the wild type (Figure 4A). These results clearly demonstrate that dps plays an important role in the growth of NK17.

FIGURE 4

Furthermore, to observe the function of dps against external stress, different concentrations of sodium chloride (NaCl), AmB, and HU were added to the culture (Figure 4B). NaCl is an osmotic reagent that can regulate the osmotic pressure in the cell (Wang et al., 2017), and AmB and HU were added to detect resistance to antifungal fungicides. Treatment with 1 M NaCl or 600 μg/ml HU led to colonies with the diameters of dpsΔ only at 35% that of the wild type (Figure 4B). In addition, dpsΔ was more sensitive than the wild type to AmB and rarely grew in the presence of 2 μg/ml AmB (Figure 4B). The data demonstrated that the growth status of dpsΔ worsened under external stress, which may be due to a disruption of the sterol biosynthesis pathway (Kim and London, 2015; Gold et al., 2016).

Phenotypic Defects of dpsΔ Are Restorable by the Addition of Exogenous Sterols

Because deleting dps affected the synthesis of sterols, which may further inhibit the growth of NK17, we added three sterols, β-sitosterol, stigmasterol, and ergosterol, to a final concentration of 5 mg/L on the PLA plates. As expected, all the sterols restored the growth of dpsΔ (Figure 5A), declaring the direct relation between the biosynthesis of sterols and fungal growth. Besides that, we noticed that the colony diameter of dpsΔ was a little larger than that of the wild type after the addition of stigmasterol after culturing for 3 days (Figures 5A,B). Therefore, it was very likely that the exogenous stigmasterol generated an inhibitory effect in the wild-type NK17 strain.

FIGURE 5

Disruption of dps Affects the Expression of MVA Pathway Genes

A previous study demonstrated that the biosynthesis of sterols started with IPP and DMAPP, two C5 isoprene units synthesized by the MVA pathway (Engels et al., 2008; Cha et al., 2012; Bian et al., 2017). Total genome sequencing and mRNA sequencing of NK17 were performed to identify the MVA pathway genes in NK17 via protein sequence BLASTP on NCBI. All seven genes in the MVA pathway could be found and the transcriptome sequencing (mRNA-seq) of NK17 suggested that these genes (aact, hmgs, hmgr, mk, pmk, idi, and ggpps) in the MVA pathway could be constitutively expressed (Table 2). Real-time PCR amplification was set to confirm the RNA sequencing data (Figure 6). To detect whether disrupting dps could affect the expression of the MVA pathway, qRT-PCR was applied to analyze the expression of the seven genes in the pathway. Five genes of the seven, aact, hmgs, hmgr, mk, and idi, had a significant lower expression in dpsΔ compared to the wild type (Figure 6), and among them, hmgs (8.3% of the wild-type level in dpsΔ) and hmgr (4.9% in dpsΔ) had the largest decrease in expression (Figure 6). Interestingly, the expression of the other two genes, pmk and ggpps, turned out to be activated instead by more than 60 and 30%, respectively (Figure 6).

TABLE 2

GeneSize/bpBlastp homologueIdentity (100%)E valueFPKMa
aact1,296/431Pestalotiopsis fici W106-196.290.086.61
hmgs1,386/461Pestalotiopsis fici W106-193.490.0111.38
hmgr3,510/1,169Pestalotiopsis fici W106-195.630.042.59
mk1,569/522Colletotrichum trifolii71.370.061.65
pmk1,173/390Hypoxylon sp. EC3857.214e−16422.81
idi765/254Pestalotiopsis fici w106-196.850.0203.83
ggpps1,203/400Pestalotiopsis fici W106-193.980.0112.73
dps3,015/1,004Hypoxylon sp. EC3844.660.08.19

Identification and RNA-seq analysis of dps and genes in MVA pathway.

aFragment per kilobase of exon model per million of mapped fragments.

FIGURE 6

Discussion

P. microspora is an endophytic fungus that is well known for producing a great number of secondary chemicals, including paclitaxel (Strobel et al., 1996). However, it seems that the fungus in our lab lost its capability to produce paclitaxel after extended subculture in the laboratory, although some terpenoids and their derivatives were identified from solid fermentation metabolites by GC–MS, i.e., squalene and sterols (Figure 3C). The biosynthesis of sterols and paclitaxel relied on the common precursors, IPP and DMAPP, the two C5 units (Dhingra and Cramer, 2017). By far, the best-studied biosynthesis pathways of these two C5 units were the methyl-D-erythritol 4-phosphate pathway and the MVA pathway (Nes, 2011). Isotope labeling method in plants and microorganisms demonstrated that both of these two routes existed in higher plants, while in fungi, the biosynthesis of IPP and DMAPP mainly depended on the MVA pathway (Lichtenthaler, 1999; Masse et al., 2004). In this report, we defined the upstream pathway that putatively leads to the biosynthesis of diterpenoids, i.e., the MVA pathway for terpenoid biosynthesis (Engels et al., 2008). As a result, all seven genes in this pathway were determined to be constitutively expressed (Figure 6). The identification of the sterols, which were biosynthesized from squalene, another polymer of IPP and DMAPP (Dhingra and Cramer, 2017), by GC–MS verified this conclusion.

The diterpene synthase in fungi has been well studied to increase the production of diterpenoids or to synthesize new diterpenoids via heterologous expression (Driller et al., 2019). However, there was no report about the function of diterpene synthase on the biosynthesis of triterpenes. By genome sequencing, only one copy of the gene encoding a diterpene synthase was found in NK17, which was initially speculated to be involved in the biosynthesis of paclitaxel. Via ATMT, the diterpene synthase, dps, was disrupted for the purpose of defining its function in NK17 in our study (Figure 2). Interestingly, the peaks of sterols in the GC–MS spectrum were absent in the deletion mutant (Figure 3C). A wide peak, a rather sharp peak, at 19.636 min in the GC–MS spectrum demonstrated that NK17 could produce more than one sterol. Additionally, many sterols could be matched with high scores of R. Match and F. Match by comparing the molecular fragments (Supplementary Figure S2). These findings, together with the changes of MVA pathway gene expression in dpsΔ (Figure 6) and the appearance of squalene in the GC–MS spectrum (Supplementary Figure S1), suggest that dps participates in the biosynthesis of sterols.

Sterols have been extensively studied because of their important roles in drug resistance, developmental regulation, cell signaling, and cell growth. Therefore, a large number of sterols isolated from bacteria, fungi, and plants have been reported and researched (Kim and London, 2015; Lamberson et al., 2017; Rivas-Marin et al., 2019; Ruan et al., 2019). Some sterols have even been implicated in human diseases, including Alzheimer’s disease and cancers (Liu Z. et al., 2019). The disruption of dps in NK17 resulted in increased sensitivity to high osmotic stress and antifungals and decreased growth (Figures 4A,B), which could be improved by the addition of sterols to the medium (Figure 5). In addition, we also noticed that the colony diameters of NK17 with exogenous sterols were smaller than those of the wild type without sterols (Figure 5), demonstrating that the oversupplied sterols in the media could significantly suppress the growth of NK17, in consistence with the result that sterols were particularly important for several cellular processes in fungi and would become a risk factor regardless of whether there was an excess or a shortage (Liu Z. et al., 2019). These data also reinforce the point that the dps of NK17 participated in the biosynthesis of sterols, although the synthesis of squalene was rarely affected (Liu Z. et al., 2019). In addition, the growth of NK17 was apparently slower when dps was knocked out (Figure 4A), which likely is the result from the impaired biosynthesis of sterol production (Gold et al., 2016; Liu Z. et al., 2019). However, when we measured the biomass of the wild type and dpsΔ in PLB, there was hardly a measurable difference between these two strains (Figure 4A). This result demonstrates the fact that there was a great difference between solid and liquid cultures of filamentous fungi in many aspects, for instance, the growth rate, gene expression, colonial morphology, and secondary metabolite biosynthesis (Bigelis et al., 2006). Thus, our data showed that DPS was only indispensable when the fungus was grown on solid plate such as PLA.

In conclusion, by disrupting the diterpene synthase (dps) in NK17, we revealed for the first time that this protein has two functions. One is that dps affects the biosynthesis of triterpenes, such as sterols, although the role, if any, of dps in the biosynthesis of paclitaxel is still uncertain. The other role of the enzyme is that dps is required for the growth and the development of fungi by affecting the biosynthesis of sterols.

Statements

Data availability statement

All datasets generated for this study are included in the article/Supplementary Material.

Author contributions

XZ and YLiu conceived and designed the study. YLiu, AD, LC, DW, QX, BX, and YLin performed the experiment. LC and XH provided the plasmids. YLiu and XZ wrote the manuscript. QX and XZ reviewed and edited the manuscript. All the authors read and approved the manuscript.

Funding

This work is supported in part by grants from the National Science Foundation of China (#81871629) and the by the National High Technology Research and Development Program (#2012AA023405).

Acknowledgments

We thank Prof. Changqi Zhao and Mengxia Xie (Beijing Normal University) for helping us with the characterization of the secondary metabolites.

Conflict of interest

LC was employed by Zhejiang Medicine Co., Ltd., Zhejiang, China. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2020.01426/full#supplementary-material

References

  • 1

    AustinC. A.ShephardE. A.PikeS. F.RabinB. R.PhillipsI. R. (1988). The effect of terpenoid compounds on cytochrome P-450 levels in rat liver.Biochem. Pharmacol.372223–2229. 10.1016/0006-2952(88)90585-0

  • 2

    BianG.YuanY.TaoH.ShiX.ZhongX.HanY.et al (2017). Production of taxadiene by engineering of mevalonate pathway in Escherichia coli and endophytic fungus Alternaria alternata TPF6.Biotechnol. J.12:1600697. 10.1002/biot.201600697

  • 3

    BigelisR.HeH.YangH. Y.ChangL. P.GreensteinM. (2006). Production of fungal antibiotics using polymeric solid supports in solid-state and liquid fermentation.J. Ind. Microbiol. Biotechnol.33815–826. 10.1007/s10295-006-0126-z

  • 4

    ChaM.-J.ShimS.-H.KimS.-H.KimO.-T.LeeS.-W.KwonS.-Y.et al (2012). Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene.BMB Rep.45589–594. 10.5483/BMBRep.2012.45.10.085

  • 5

    ChenL.LiY.ZhangQ.WangD.AkhberdiO.WeiD.et al (2017). Improved pestalotiollide B production by deleting competing polyketide synthase genes in Pestalotiopsis microspora.J. Ind. Microbiol. Biotechnol.44237–246. 10.1007/s10295-016-1882-z

  • 6

    ChenL.WeiD.QianZ.XiY.YuW.ZhuX. (2015). Orotidine 5’-phosphate decarboxylase-based reusable in situ genetic editing system: development and application in taxol-producing Pestalotiopsis microspora.Eng. Life Sci.15542–549. 10.1002/elsc.201400220

  • 7

    DhingraS.CramerR. A. (2017). Regulation of sterol biosynthesis in the human fungal pathogen Aspergillus fumigatus: opportunities for therapeutic development.Front. Microbiol.8:92. 10.3389/fmicb.2017.00092

  • 8

    DrillerR.GarbeD.MehlmerN.FuchsM.RazK.MajorD. T.et al (2019). Current understanding and biotechnological application of the bacterial diterpene synthase CotB2.Beilstein J. Org. Chem.152355–2368. 10.3762/bjoc.15.228

  • 9

    EngelsB.DahmP.JenneweinS. (2008). Metabolic engineering of taxadiene biosynthesis in yeast as a first step towards Taxol (Paclitaxel) production.Metab. Eng.10201–206. 10.1016/j.ymben.2008.03.001

  • 10

    GauvinA.SmadjaJ.AkninM.FaureR.GaydouE. (2000). Isolation of bioactive 5α,8α-epidioxy sterols from the marine sponge L.Can. J. Chem.78986–992. 10.1139/v00-083

  • 11

    GoldD. A.GrabenstatterJ.MendozaA. D.RiesgoA.RuiztrilloI.SummonsR. E. (2016). Sterol and genomic analyses validate the sponge biomarker hypothesis.PNAS1132684–2689. 10.1073/pnas.1512614113

  • 12

    KimJ.LondonE. (2015). Using sterol substitution to probe the role of membrane domains in membrane functions.Lipids50721–734. 10.1007/s11745-015-4007-y

  • 13

    KobayashiJ.ShigemoriH. (2002). Bioactive taxoids from the Japanese yew Taxus cuspidata.Med. Res. Rev.22305–328. 10.1002/med.10005

  • 14

    KoksalM.JinY.CoatesR. M.CroteauR.ChristiansonD. W. (2011). Taxadiene synthase structure and evolution of modular architecture in terpene biosynthesis.Nature469116–120. 10.1038/nature09628

  • 15

    LambersonC. R.MuchalskiH.McDuffeeK. B.TallmanK. A.XuL.PorterN. A. (2017). Propagation rate constants for the peroxidation of sterols on the biosynthetic pathway to cholesterol.Chem. Phys. Lipids207(Pt B), 51–58. 10.1016/j.chemphyslip.2017.01.006

  • 16

    LangeB. M. (2015). Biosynthesis and biotechnology of high-Value p-Menthane monoterpenes, including menthol, carvone, and limonene.Adv. Biochem. Eng. Biotechnol.148319–353. 10.1007/10_2014_289

  • 17

    LiM.JiangF.YuX.MiaoZ. (2015). Engineering isoprenoid biosynthesis in Artemisia annua L. for the production of taxadiene: a key intermediate of taxol.Biomed. Res. Int.2015:504932. 10.1155/2015/504932

  • 18

    LichtenthalerH. K. (1999). The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants.Annu. Rev. Plant Physiol. Plant Mol. Biol.5047–65. 10.1146/annurev.arplant.50.1.47

  • 19

    LiuY.ChenL.XieQ.YuX.DuanA.LinY.et al (2019). A gene cluster for the biosynthesis of dibenzodioxocinons in the endophyte Pestalotiopsis microspora, a Taxol Producer.J. Microbiol. Biotechnol.291570–1579. 10.4014/jmb.1905.05051

  • 20

    LiuZ.JianY.ChenY.KistlerH. C.HeP.MaZ.et al (2019). A phosphorylated transcription factor regulates sterol biosynthesis in Fusarium graminearum.Nat. Commun.10:1228. 10.1038/s41467-019-09145-6

  • 21

    MasseG.BeltS. T.RowlandS. J.RohmerM. (2004). Isoprenoid biosynthesis in the diatoms Rhizosolenia setigera (Brightwell) and Haslea ostrearia (Simonsen).Proc. Natl. Acad. Sci. U.S.A.1014413–4418. 10.1073/pnas.0400902101

  • 22

    NesW. D. (2011). Biosynthesis of cholesterol and other sterols.Chem. Rev.1116423–6451. 10.1021/cr200021m

  • 23

    NiuX.HaoX.HongZ.ChenL.YuX.ZhuX. (2015). A putative histone deacetylase modulates the biosynthesis of Pestalotiollide B and conidiation in Pestalotiopsis microspora.J. Microbiol. Biotechnol.25579–588. 10.4014/jmb.1409.09067

  • 24

    PelotK. A.HagelthornD. M.HongY. J.TantilloD. J.ZerbeP. (2019). Diterpene synthase-catalyzed biosynthesis of distinct clerodane stereoisomers.Chembiochem20111–117. 10.1002/cbic.201800580

  • 25

    RavichandranC.BadgujarP. C.GundevP.UpadhyayA. (2018). Review of toxicological assessment of d-limonene, a food and cosmetics additive.Food Chem. Toxicol.120668–680. 10.1016/j.fct.2018.07.052

  • 26

    Rivas-MarinE.StettnerS.GottshallE. Y.Santana-MolinaC.HellingM.BasileF.et al (2019). Essentiality of sterol synthesis genes in the planctomycete bacterium Gemmata obscuriglobus.Nat. Commun.10:2916. 10.1038/s41467-019-10983-7

  • 27

    RuanR.ChenY.LiH.WangM. (2019). Functional diversification of sterol regulatory element binding proteins following gene duplication in a fungal species.Fungal Genet. Biol.131:103239. 10.1016/j.fgb.2019.103239

  • 28

    StrobelG.YangX.SearsJ.KramerR.SidhuR. S.HessW. M. (1996). Taxol from Pestalotiopsis microspora, an endophytic fungus of Taxus wallachiana.Microbiology142(Pt 2), 435–440. 10.1099/13500872-142-2-5

  • 29

    WangC.ParkJ. E.ChoiE. S.KimS. W. (2016). Farnesol production in Escherichia coli through the construction of a farnesol biosynthesis pathway - application of PgpB and YbjG phosphatases.Biotechnol. J.111291–1297. 10.1002/biot.201600250

  • 30

    WangD.AkhberdiO.HaoX.YuX.ChenL.LiuY.et al (2017). Amino acid sensor kinase Gcn2 is required for conidiation, secondary metabolism, and cell wall integrity in the Taxol-producer Pestalotiopsis microspora.Front. Microbiol.8:1879. 10.3389/fmicb.2017.01879

  • 31

    WuW.DavisR. W.Tran-GyamfiM. B.KuoA.LaButtiK.MihaltchevaS.et al (2017). Characterization of four endophytic fungi as potential consolidated bioprocessing hosts for conversion of lignocellulose into advanced biofuels.Appl. Microbiol. Biotechnol.1012603–2618. 10.1007/s00253-017-8091-1

  • 32

    YuX.WangY.PanJ.WeiD.ZhuX. (2015). High frequency of homologous gene disruption by single-stranded DNA in the taxol-producing fungus Pestalotiopsis microspora.Ann. Microbiol.652151–2160. 10.1007/s13213-015-1055-8

  • 33

    ZhangQ.ChenL.YuX.LiuH.AkhberdiO.PanJ.et al (2016). A β-type histone acetyltransferase Hat1 regulates secondary metabolism, conidiation, and cell wall integrity in the taxol-producing fungus Pestalotiopsis microspora.J. Basic. Microbiol.561380–1391. 10.1002/jobm.201600131

Summary

Keywords

Pestalotiopsis microspora, diterpene synthase, MVA genes, sterol biosynthesis, polyketide

Citation

Liu Y, Duan A, Chen L, Wang D, Xie Q, Xiang B, Lin Y, Hao X and Zhu X (2020) A Fungal Diterpene Synthase Is Responsible for Sterol Biosynthesis for Growth. Front. Microbiol. 11:1426. doi: 10.3389/fmicb.2020.01426

Received

23 February 2020

Accepted

02 June 2020

Published

10 July 2020

Volume

11 - 2020

Edited by

Anindya Chanda, University of South Carolina, United States

Reviewed by

Christoph Müller, Ludwig Maximilian University of Munich, Germany; Ashutosh Singh, University of Lucknow, India

Updates

Copyright

*Correspondence: Xudong Zhu,

This article was submitted to Fungi and Their Interactions, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics