Abstract
A major problem for St John’s wort (Hypericum perforatum) is St John’s wilt, which can lead to reduced crop yields and even complete crop losses. In the past, the pathogen was referred to as Colletotrichum gloeosporioides or occasionally as Colletotrichum cf. gloeosporioides based on morphology. Although a strain from this host had been re-identified as C. cigarro in taxonomic studies, there is uncertainty about the identity of the St John’s wilt pathogen, which is generally still addressed as C. gloeosporioides in applied science. In a multi-locus [internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), and glutamine synthetase (GS)] analysis of the C. gloeosporioides species complex, all isolates obtained from newly collected symptomatic H. perforatum stems and seeds from Germany and Switzerland were identified as C. cigarro. Although they belonged to the same haplotype, the morphology of the isolates was very variable. Pathogenicity tests demonstrated that only C. cigarro strains from H. perforatum cause symptoms on H. perforatum, whereas other Colletotrichum species tested only caused latent infection of H. perforatum.
1 Introduction
St John’s wort (Hypericum perforatum L.) is an important medicinal plant with a wide range of applications ranging from nervousness, restlessness, anxiety, to depression, as well as external treatment of injuries or burns (Bomme, 1997). Recently, new application areas are being investigated including treatment of cancer and Alzheimer’s disease (Choudhary et al., 2022; Yuan et al., 2023; Suryawanshi et al., 2024). The demand for St John’s wort drugs is met by imports from various countries, partly by wild collections (Fachagentur Nachwachsende Rohstoffe e.V, 2014). Today, St John’s wort cultivation is estimated at approximately 150 ha in Germany. H. perforatum is attacked by various fungal pathogens causing powdery mildew (Erysiphe hyperici), leaf blight (Diploceras hypericinum), wilt (Colletotrichum cf. gloeosporioides and Verticillium spp.), and leaf spot (Alternaria alternata and Stemphylium botryosum) diseases (Putnam, 2000; Fritzsche and Hoppe, 2007).
In 1937, a fungal pathogen was isolated from severe stem infection of H. perforatum collected in the Botanical Garden Berlin-Dahlem, Germany, and initially identified as Gloeosporium orbiculare Berk. et. Mart. Based on the subsequently formed sexual morph, the fungus was described as Glomerella cingulata var. migrans Wollenw (Wollenweber and Hochapfel, 1949). In the 1990s, the cultivation of H. perforatum in Germany suffered from considerable yield losses and even total losses due to St John’s wilt (Plescher, 1997; Gärber, 1999), and first occurrences of this disease were also reported from other European countries (Schwarczinger and Vajna, 1998; Debrunner et al., 2000; Filoda, 2004). The pathogen was morphologically identified by Gärber (1999) and referred to as C. cf. gloeosporioides Penz. (anamorph, teleomorph: G. cingulata var. migrans). The St John’s wilt pathogen initially causes anthracnose at the stem base, resulting in drooping shoot tips and later in wilting of the plant (Hildebrand and Jensen, 1991; Schwarczinger and Vajna, 1998; Gärber, 1999; Debrunner et al., 2000; Filoda, 2004). Shepherd (1995) showed that the pathogen is host-specific. The pathogen spreads from plant to plant by conidia in a short period of time (Gärber and Schenk, 2002a). Infection of buds, flowers, and seeds has been demonstrated, but the pathogen is primarily regarded as seed-borne (Gärber and Schenk, 2002b). Since H. perforatum is cultivated in the field for 2–3 years, the pathogen can overwinter in the plant population, which happens by means of ascospores (Gärber and Schenk, 2002a, 2002b). St John’s wilt still poses a major problem for the commercial cultivation of H. perforatum (Wahl et al., 2018).
In 2012, Weir et al. (2012) performed a comprehensive phylogenetic study of the Colletotrichum gloeosporioides species complex on the basis of up to eight nuclear gene regions and accepted 22 species, one of them with two subspecies. In their phylogeny, C. kahawae that had been described by Waller et al. (1993) for strains causing coffee berry disease (CBD) clustered with strains from several hosts other than coffee. Therefore, C. kahawae J.M. Waller & Bridge was reduced to subspecies level, C. kahawae subsp. kahawae J.M. Waller & Bridge, while C. kahawae subsp. cigarro B.S. Weir & P.R. Johnst. (as “ciggaro”) was established for strains from other hosts. These strains also included the ex-type strain of G. cingulata var. migrans (CBS 237.49) from H. perforatum in Germany; this variety was therefore synonymized with the latter subspecies. Of the loci used in the study of Weir et al. (2012), only the presence/absence of a 22-bp-long deletion in the GS gene could distinguish between the two subspecies. Moreover, the CBD strains are not able to utilize citrate or tartrate, whereas strains of C. kahawae subsp. cigarro are able to use one or both of these carbon sources (Waller et al., 1993). Cabral et al. (2020) recently resurrected C. kahawae and raised C. kahawae subsp. cigarro to species rank, as C. cigarro (B.S. Weir & P.R. Johnst.) A. Cabral & P. Talhinhas, which also includes the ex-type strain of G. cingulata var. migrans. Until now, it has not been investigated if the Colletotrichum strains causing St John’s wilt in commercial fields in Europe since the 1990s represent the same species as strain CBS 237.49 isolated almost 90 years ago from stem infection of H. perforatum in the Botanical Garden Berlin-Dahlem that originally had been described as G. cingulata var. migrans. As no studies have previously been conducted on the St John’s wilt pathogen based on modern systematics of the genus Colletotrichum, the identity of the pathogen needs to be clarified. Therefore, the aim of this study is to determine (1) if this disease is caused by one or more Colletotrichum species; (2) which species occur(s), if the (main) pathogen is C. cigarro; and (3) if there is a molecular or morphological variability within strains of the pathogen(s). This will be investigated based on multi-locus sequence and morphological data of isolates from St. John’s wilt from commercial and experimental fields, as well as roadside flora in Germany and Switzerland and several culture collections. A pathogenicity test will be carried out to confirm the pathogenicity of the species to H. perforatum.
2 Materials and methods
2.1 Sample collection and fungal isolation
Symptomatic plants of H. perforatum were collected at different locations in Germany and Switzerland from commercial fields (two sites in Groß Schierstedt, Germany; two sites in Uttwil, Switzerland), experimental fields (Braunschweig and Quedlinburg, Germany), and roadside flora (two sites in Braunschweig) in 2021 and 2022. In addition, nine seed lots provided by commercial distributors were included in this study.
After macroscopic and microscopic (Axio Imager.A1 equipped with an AxioCam MRc5 camera, Zeiss, Germany) inspection, plant materials were washed with tap water to remove the soil particles. Seeds and approximately 3-cm-long stem segments were surface sterilized with sodium hypochlorite solution (1% active chlorine) containing 0.1% Tween® 20 (Carl Roth, Germany) for 2 min. After two washing steps in sterile water, the plant materials were dried on sterile filter paper and pressed on potato dextrose agar (PDA, Becton Dickinson, New Jersey, USA) to check surface sterilization. Afterwards, stem segments were cut into 0.5-cm pieces and halved lengthwise. Stem pieces and seeds were transferred to PDA containing antibiotics [100 mg/L penicillin G sodium salt (PEN–NA, Merck, Germany), 10 mg/L chlortetracycline hydrochloride (C4881, Merck, Germany), and 50 mg/L streptomycin sulfate salt (S6501, Merck, Germany)]. Cultures were incubated under natural daylight at 20°C and inspected daily for mycelial growth. After 3–5 days, mycelia producing Colletotrichum-like spores were observed. Outgrowing hyphae of these colonies were transferred to new PDA plates. Single conidial isolates were prepared from the sporulating cultures by streaking a few spores on new PDA plates with an inoculation loop. Plates were incubated at 20°C in the dark and examined for germinating conidia under an inverted microscope (Primovert, Zeiss, Germany). Single germinating conidia were cut out, transferred to new PDA plates, and incubated as described before (Götz et al., 2024).
For storage in the institute’s culture collection, the strains were grown on PDA supplemented with 5% (v/v) glycerol (Carl Roth, Germany) for 2 weeks at 20°C in the dark. Mycelial plugs were cut from the border of the growing colonies, transferred to Nalgene® cryotubes (Thermo Scientific, Germany) containing potato dextrose broth (PDB, Becton Dickinson, New Jersey, USA) amended with 15% (v/v) glycerol, and frozen at -70°C in a Nalgene® Mr. Frosty® freezing container (Thermo Scientific, Germany). Selected strains (JKI-GF-Z1952, JKI-GP-23-019, and JKI-GP-23-020) were deposited at the Leibniz Institute – German Collection of Microorganisms and Cell Cultures GmbH, Germany (DSMZ).
To include further Colletotrichum strains from H. perforatum in this study, several culture collections worldwide [DSMZ, Mycotheque de l’Universite catholique de Louvain, Belgium (BCCM/MUCL), the Westerdijk Fungal Biodiversity Institute, The Netherlands (CBS), the CABI Genetic Resource Collection, United Kingdom (CABI), the American Type Culture Collection, Virginia, USA (ATCC), the International Collection of Microorganisms from Plants, New Zealand (ICMP), and the Institute of Epidemiology and Pathogen Diagnostics of the JKI, Germany (JKI-EP)] were searched. Three additional strains were found, JKI-EP-70790, JKI-EP-71555, and CBS 237.49. Additionally, three strains of C. gloeosporioides were included.
2.2 DNA extraction, PCR amplification, and sequencing
Fungal DNA was extracted from mycelium grown on PDA at 20°C in the dark using the DNeasy Plant Mini Kit (Qiagen, Germany) with the following modifications: Approximately 80 mg of mycelium was homogenized with two steel beads (5 mm diameter) and 400 µL of AP1 buffer (Qiagen, Germany) in 2-mL tubes using a bead mill (MM400, Retsch, Germany) at a frequency of 27 Hz for 5 min. After addition of 4 µL of RNase, the samples were incubated at 60°C ± 2°C and 1,000 rpm for 60 min (Thermomixer comfort, Eppendorf, Germany). The subsequent steps were carried out following the manufacturer’s protocol.
Four DNA loci were amplified: The 5.8S nuclear ribosomal gene with the two flanking internal transcribed spacers (ITS), a 200-bp intron of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and partial sequences of the actin (ACT) and glutamine synthetase (GS) genes. The primer sets used are listed in Table 1. The PCR mix contained 10 µL of 5 × HOT FIREPol® Blend Master Mix with 7.5 mM MgCl2 (Solis Biodyne, Estonia), 5 µL (ITS, GAPDH) or 2 µL (ACT, GS) of each primer (10 µM), and 10 µL (ITS, GAPDH) or 4 µL (ACT, GS) of genomic DNA and was filled up to a total volume of 50 µL with sterile water. The PCR conditions were 13 min at 95°C, followed by 35 cycles of 30 s at 95°C, 30 s at annealing temperature (ITS: 53°C, GAPDH: 60°C, ACT: 58°C, GS: 54°C), 45 s (GAPDH, ACT, and GS) or 60 s (ITS) at 72°C, and then 7 min (GAPDH and ACT) or 10 min (ITS and GS) at 72°C. The PCR products were purified using the DNA Clean & Concentrator Kit (Zymo Research Europe GmbH, Germany) and sequenced in forward and reverse direction using the same primers as used for amplification (Microsynth Seqlab GmbH, Germany). Consensus sequences were generated and manually edited when necessary using CLC Main Workbench 23.0.1 (Qiagen, Germany) following the EPPO recommendations for sequence analysis (OEPP/EPPO, 2021). All consensus sequences generated in this study were deposited in NCBI GenBank (https://www.ncbi.nlm.nih.gov/genbank/). The accession numbers are listed in Supplementary Table 1.
Table 1
| Locus | Primer | Sequence (5′−3′) | Reference |
|---|---|---|---|
| ITS | ITS1 | TCCGTAGGTGAACCTGCGG | White et al., 1990 |
| ITS4 | TCCTCCGCTTATTGATATGC | White et al., 1990 | |
| GAPDH | GDF | GCCGTCAACGACCCCTTCATTGA | Guerber et al., 2003 |
| GDR | GGGTGGAGTCGTACTTGAGCATGT | Guerber et al., 2003 | |
| ACT | ACT-512F | ATGTGCAAGGCCGGTTTCGC | Carbone and Kohn, 1999 |
| ACT-783R | TACGAGTCCTTCTGGCCCAT | Carbone and Kohn, 1999 | |
| GS | GSF1 | ATGGCCGAGTACATCTGG | Guerber et al., 2003 |
| GSR1 | GAACCGTCGAAGTTCCAG | Guerber et al., 2003 |
Primer combinations used in this study for PCR amplification and sequencing.
2.3 Phylogenetic analysis
BLASTn searches on NCBI GenBank were performed with the newly generated ITS consensus sequences for preliminary identification and selection of reference strains. In addition to the sequences of the reference strains, sequences of further Colletotrichum isolates and isolates from Hypericum spp. were included (Nirenberg et al., 2002; Staňková et al., 2014; Samaga and Rai, 2016; Ding et al., 2023; https://www.ncbi.nlm.nih.gov/genbank/; Supplementary Table 1). The phylogenetic analysis included 39 (ITS, GAPDH, and ACT) and 31 (GS, multi-locus) related species. The sequences of each locus were aligned separately using the online version of MAFFT v. 7.526 (https://mafft.cbrc.jp/alignment/server/; last visited 17 October 2024) adopting the iterative refinement method L-INS-i for the sequences of ITS, G-INS-i for those of GAPDH and GS, and E-INS-i for those of ACT (Katoh and Standley, 2013; Katoh et al., 2019). The other settings were default. Selection of the best-fit models and the phylogenetic analyses of the single-locus as well as the concatenated alignments were performed in MEGA X (Kumar et al., 2018). The default settings were used to find the best-fit model in the model selection tool, except for a partial deletion of gaps that was set to a cutoff of 95% and five threads. The phylogenetic trees were inferred by maximum likelihood (ML) with 1,000 bootstrap replications, the best-fit model, and a partial deletion of gaps with 95% coverage cutoff and other settings as default. Colletotrichum fioriniae (CBS 128517) was used as outgroup. The alignments and respective phylogenetic trees were deposited in Figshare (doi: 10.6084/m9.figshare.27315027).
2.4 Morphological characterization
To compare the growth of the Colletotrichum strains, mycelia from actively growing cultures on PDA were cut with a cork borer (0.7 cm diameter) and placed in the center of a new PDA plate (n = 3). The cultures were incubated at 20°C in the dark. After establishment of fungal growth on the new medium, the colony borders were marked on the four axes of a cross drawn on the bottom of the petri dish. After 7 days, the colony borders were marked again, the distances between each of the two marks were measured, and the mean value of the measurements was calculated for each strain.
The morphological characteristics of the Colletotrichum strains were examined using a standard light microscope (Axio Imager.A1 equipped with an AxioCam MRc5 camera). Measurements were made and images were taken with the calibrated ZEN Blue Edition software release 3.0 (Zeiss, Germany). The conidial length and width (n = 30) of 7-day-old cultures on PDA were analyzed following Frank (1990) with modifications: the five values indicate the minimum value, lower limit, arithmetic mean, upper limit, and maximum value, respectively; lower and upper limits indicate the range of 90% of all values.
2.5 Pathogenicity tests
Pathogenicity tests were conducted with 6-week-old seedlings and 3-week-old rooted head cuttings of H. perforatum (HO336, Jelitto Staudensamen GmbH, Germany) in a climate-controlled greenhouse. Seeds were sown in clay substrate (Klasmann-Deilmann, Germany) and grown at 18°C with a photoperiod of at least 14 h daylight. When daylight was insufficient, supplemental light was provided by sodium vapor lamps. Three weeks after sowing, seedlings were transplanted to multi-pot trays (77 pots per tray) filled with the same substrate and grown under the same conditions for another 3 weeks. Head cuttings from 4- to 5-month-old mother plants were cut and transferred directly to multi-pot trays filled with the same substrate and cultured at the same conditions as the seedlings. Three weeks after transfer, the head cuttings had rooted. For inoculum preparation, Colletotrichum strains from H. perforatum (JKI-GF-Z1952, JKI-GP-23-019, JKI-GP-23-020, and CBS 237.49) and other hosts (CBS 119204, DSM 62136, and DSM 62146) were incubated on PDA at 20°C in the dark for 2 weeks. Spore suspensions were prepared by applying 10 mL of sterile water to each Petri dish and sweeping off the spores with a sterile Drigalski spatula. The suspension was filtered through three layers of cheese cloth to remove mycelium and adjusted to a final concentration of 1 × 106 spores mL−1 using a Neubauer improved counting chamber (Assistent, Karl Hecht GmbH & Co KG, Germany). Twenty head cuttings and seedlings, respectively, were inoculated with spore suspensions of each fungal strain by spraying them dripping wet. The same number of head cuttings and seedlings sprayed with sterile water served as non-inoculated control plants. All plants were incubated separately in small indoor greenhouses Maximus 3.0 (Meyer, Germany) at 20°C at a relative humidity of >80% and a photoperiod of 14 h in order to avoid cross-infection. To check germination, the spore suspensions of each strain were also sprayed onto PDA, incubated at 20°C in the dark, and checked after 1 to 2 days using an inverted microscope (Primovert, Zeiss, Germany). Inoculated plantlets were inspected regularly for the beginning of symptom development. After 7 and 14 days, the severity of symptoms was evaluated. Plant material from each treatment was taken randomly 7 days after inoculation and used for re-isolation of the previously inoculated fungus as described above. The experiment was repeated twice.
3 Results
3.1 Field symptoms and fungal isolates
On naturally infected plants, symptoms first appeared as small brown necrotic spots that developed at the stem base and spread over the entire stem base over time. In addition, drooping shoot tips, wilting symptoms, and even completely wilted plants were observed (Figure 1). Spores were not found on symptomatic tissue in the field. Infected seed did not differ morphologically from pathogen-free seed. Colletotrichum spp. was always isolated from symptomatic stem bases. However, it was only isolated from seeds of two seed lots. A total of 33 isolates of Colletotrichum spp. were recovered. From each location and seed lot, one representative isolate was selected and single conidial isolates were prepared for further molecular and morphological analysis (Table 2).
Figure 1
Table 2
| Species | Strain number | Host | Year of isolation | Location |
|---|---|---|---|---|
| C. cigarroa | JKI-GF-Z1952, (DSM 116563) | Hypericum perforatum | 1999 | Germany, Kleinmachnow, roadside flora |
| C. cigarroa | JKI-GP-23-030 | Hypericum perforatum | 2021 | Switzerland, Uttwil, commercial field |
| C. cigarroa | JKI-GP-23-019, (DSM 117132) | Hypericum perforatum | 2021 | Switzerland, Uttwil, commercial field |
| C. cigarroa | JKI-GP-23-031 | Hypericum perforatum | 2021 | Germany, Groß Schierstedt, commercial field |
| C. cigarroa | JKI-GP-23-020 (DSM 116564) | Hypericum perforatum | 2021 | Germany, Groß Schierstedt, commercial field |
| C. cigarroa | JKI-GP-24-010 | Hypericum perforatum | 2022 | Germany, Braunschweig, experimental field |
| C. cigarroa | JKI-GP-24-011 | Hypericum perforatum | 2022 | Germany, Quedlinburg, experimental field |
| C. cigarroa | JKI-GP-24-012 | Hypericum perforatum | 2022 | Germany, Braunschweig, roadside flora |
| C. cigarroa | JKI-GP-24-013 | Hypericum perforatum | 2022 | Germany, Braunschweig, roadside flora |
| C. cigarroa | JKI-GP-24-014 | Hypericum perforatum | 2022 | Germany, seed lot |
| C. cigarrob | JKI-EP-70790 | Hypericum perforatum | 1998 | Germany, Bernburg |
| C. cigarrob | JKI-EP-71555 | Hypericum perforatum | 2000 | Germany, Quedlinburg |
| C. cigarroc | CBS 237.49 | Hypericum perforatum | 1937 | Germany, Berlin |
| C. gloeosporioides sensu strictod | DSM 62136 | Citrus sp. L. | Unknown | Italy |
| C. gloeosporioides s. str.d | DSM 62146 | Citrus sinensis Pers. | Unknown | Greece |
| C. gloeosporioides s. str.c | CBS 119204 | Pueraria lobata Willd. | 2010 | USA |
Colletotrichum strains used in this study.
Isolated in this study or formerly by staff of the Institute for Plant Protection in Horticulture and Urban Green, JKI, Germany.
Obtained from the strain collection of the Institute for Epidemiology and Pathogen Diagnostics, JKI, Germany.
Obtained from Westerdijk Fungal Biodiversity Institute, The Netherlands.
Obtained from the Leibniz Institute DSMZ − German Collection of Microorganisms and Cell Cultures GmbH, Germany.
3.2 Phylogenetic analysis
Initial BLASTn searches with newly generated ITS sequences of strains isolated from H. perforatum on NCBI GenBank resulted in matches with species of the C. gloeosporioides complex. Therefore, the newly generated DNA sequences of 12 Colletotrichum strains from H. perforatum and those of three C. gloeosporioides strains from other hosts were analyzed together with 32 reference strains that comprised all species of the C. gloeosporioides complex in Weir et al. (2012) as well as recently described species belonging to the Kahawae clade of this complex that had been selected based on BLASTn searches in NCBI GenBank (https://www.ncbi.nlm.nih.gov/genbank/Supplementary Table 1). Additionally, 10 previously published Colletotrichum sequences of strains isolated from Hypericum species in Canada, China, Czech Republic, India, and Germany that were not available to us were retrieved from GenBank and included in the ITS, one of them also in the GAPDH single-locus analyses (Nirenberg et al., 2002; Ellsworth et al., 2013; Staňková et al., 2014; Samaga and Rai, 2016; Ding et al., 2023).
The alignments of the individual DNA regions were trimmed and then comprised 552 bp for ITS, 248 bp for GAPDH, 247 bp for ACT, and 975 bp for GS. The gene boundaries in the multi-locus alignment of the C. gloeosporioides species complex were as follows: ITS: 1–552, GAPDH: 555–802, ACT: 805–1,051, and GS: 1,054–2,028. The best models suggested by the model selection tool in MEGA X for the single-locus alignments were K2+G for ITS and ACT, K2 for GAPDH, T92+I for GS, and TN93+G for the multi-locus alignment (Kimura, 1980; Tamura, 1992; Tamura and Nei, 1993). A total of 428 positions were used in the ML single-locus analysis for ITS, 216 positions for GAPDH, 225 positions for ACT, 718 positions for GS, and 1,667 positions in the multi-locus analysis.
In the multi-locus phylogeny (Figure 2), the strains from H. perforatum formed one uniform clade, but with a low bootstrap support (63%) due to the identical sequences of the H. perforatum strains and their small differences to C. cigarro strains from other hosts. This clade resides within a clade with the ex-type strain of C. cigarro (61%), which is sister to a clade containing all C. kahawae strains including its ex-type (88%). Colletotrichum cigarro ICMP 18534 was intermediate between the two sister clades within a larger clade with 98% bootstrap support, while C. cigarro ICMP 12952 and the ex-type strain of C. jiangxiense were outside this large clade, but grouping with it (72%). The systematic relationships between C. jiangxiense, C. wuxiense, and certain C. cigarro strains, especially ICMP 12952 and ICMP 18534, are not clear and need to be investigated in more detail elsewhere. Three strains from other hosts included in this study grouped with the ex-type of C. gloeosporioides with strong bootstrap support (99%).
Figure 2
It was not possible to assign the strains from H. perforatum to either C. kahawae or C. cigarro based on their ITS, GAPDH, or ACT sequences (Supplementary Figures 1-3). In the ITS and GAPDH phylogenies, the sequences of these strains clustered with those of several species of the C. gloeosporioides complex, including C. cigarro and C. kahawae. In the ACT phylogeny, the isolates from H. perforatum formed a clade with C. helleniense (CBS 142418) with low support (58%) within a large clade formed by all C. cigarro, C. kahawae, and other Colletotrichum isolates (63%). In the GS tree, all C. kahawae strains including its ex-type formed a subclade (88%), while all isolates from H. perforatum formed another subclade with the ex-type strain of C. cigarro and further C. cigarro isolates (64%); all of them forming a well-supported (99%) big clade with two further C. cigarro isolates and the ex-type strains of C. camelliae and C. wuxiense (Supplementary Figure 4).
3.3 Morphological characterization
Colony colors of C. cigarro isolates were variable, ranging from pale gray to pale brown, partly with yellow to orange clusters of conidia. Correspondingly, the reverse sides of the cultures were pale gray to pale brown. The average growth rate of the individual isolates ranged from 1.3 to 2.4 cm in 1 week (Table 3). Conidia were cylindrical (Figure 3) and variable in length (mean, 12.7–16.3 µm) and width (mean, 5.4–5.8 µm) (Table 3). Margin and aerial mycelium of the C. gloeosporioides isolates from other hosts were similar to those of the C. cigarro isolates. Colony colors were considerably variable as well, with conidiomata ranging from dark olive green (JKI-EP-62136) to orange (JKI-EP-62146, CBS 119204) depending on the conidia production.
Table 3
| Species | Strain | Mycelia growth (cm) | Conidia (n = 30) | |
|---|---|---|---|---|
| Length (µm) | Width (µm) | |||
| C. cigarro | JKI-GF-Z1952 | 1.3 ± 0.0 | (12.7−)12.9−14.4−15.9(−16.4) | (5.0−)5.1−5.8−6.4(−6.9) |
| C. cigarro | JKI-GP-23-030 | 2.4 ± 0.2 | (11.6−)12.3−14.4−16.0(−16.5) | (4.8−)4.9−5.4−6.0(−6.6) |
| C. cigarro | JKI-GP-23-019 | 1.9 ± 0.2 | (12.1−)12.6−14.1−15.8(−17.0) | (4.6−)5.2−5.8−6.4(−6.8) |
| C. cigarro | JKI-GP-23-031 | 1.8 ± 0.2 | (10.0−)10.9−13.2−14.7(−15.3) | (4.9−)5.1−5.5−6.0(−6.1) |
| C. cigarro | JKI-GP-23-020 | 1.4 ± 0.1 | (10.3−)11.0−12.7−13.9(−14.4) | (5.0−)5.1−5.7−6.4(−6.9) |
| C. cigarro | CBS 237.49 | 1.6 ± 0.0 | (14.0−)14.5−16.3−17.8(−19.3) | (4.8−)5.2−5.7−6.2(−6.2) |
| C. gloeosporioides s. str. | DSM 62136 | 2.4 ± 0.0 | (11.8−)13.2−14.6−16.0(−18.5) | (4.6−)5.4−6.1−6.7(−7.0) |
| C. gloeosporioides s. str. | DSM 62146 | 2.5 ± 0.0 | (12.6−)12.6−13.7−14.8(−15.4) | (4.9−)5.3−5.9−6.5(−6.7) |
| C. gloeosporioides s. str. | CBS 119204 | 2.8 ± 0.1 | (13.0−)13.5−15.0−16.1(−17.1) | (5.3−)5.4−6.2−6.7(−7.1) |
Mycelial growth and conidial dimensions of Colletotrichum cigarro and C. gloeosporioides on PDA after 7 days at 20°C in the dark.
The five values of conidia length and width indicate the minimum value, lower limit, arithmetic mean, upper limit, and maximum value, respectively; lower and upper limits indicate the range of 90% of all values.
Figure 3
3.4 Pathogenicity test
The first symptoms were observed on leaves and stems 4 days after inoculation with all C. cigarro strains from H. perforatum. The number and size of necrosis increased with time. Only minor differences were found in susceptibility between head cuttings and seedlings. First symptoms appeared 1–2 days earlier in seedlings than in head cuttings. Seven days after inoculation, differences between seedlings and head cuttings and between C. cigarro strains had diminished (Figure 4), and 14 days after inoculation, almost all plants inoculated with C. cigarro strains were completely wilted. From all symptomatic tissues collected randomly 7 days after inoculation, C. cigarro was re-isolated. In contrast to the plants inoculated with C. cigarro, no symptoms were visible on any of the young plants inoculated with C. gloeosporioides s. str. (Figure 4). However, this species was re-isolated from all randomly collected symptomless tissues 7 days after inoculation. No symptoms developed on the non-inoculated control plants, and no fungi were re-isolated from them. The repetition showed the same results.
Figure 4
4 Discussion
The major constrain in the cultivation of H. perforatum is St John’s wort wilt, which can cause severe to total crop losses (Gärber, 1999; Wahl et al., 2018). Despite the significant importance of H. perforatum, the causal organism of this disease had until now only been identified using morphological characters and was referred to as C. cf. gloeosporioides (Gärber, 1999) or C. gloeosporioides (Debrunner et al., 2000; Filoda, 2004; Michel et al., 2014). In this study, Colletotrichum spp. were isolated from symptomatic H. perforatum plants and seeds and from different locations and classified based on a comprehensive phylogenetic analysis. Initial BLASTn searches with ITS sequences of these strains on NCBI GenBank resulted in matches with strains of the C. gloeosporioides complex. This confirmed that the pathogen belongs to this species complex. Based on multi-locus phylogenetic analyses of ITS, GAPDH, ACT, and GS sequences, all Colletotrichum strains isolated from H. perforatum were clearly assigned to C. cigarro. This means that the St John’s wilt pathogen is not C. gloeosporioides as assumed in previous studies but belongs to the same species as the ex-type strain of G. cingulata var. migrans, CBS 237.49, which had previously been reassigned as C. cigarro (Weir et al., 2012; Cabral et al., 2020). The conidial size and growth rate were in agreement with those reported for C. cigarro by Weir et al. (2012) and for G. cingulata var. migrans by Wollenweber and Hochapfel (1949). However, they are also in agreement with many other species of the C. gloeosporioides and other species complexes (Weir et al., 2012; Damm et al., 2019). By comparing the individual isolates included in this study, a morphological variability was observed both within C. cigarro isolates from H. perforatum and within the C. gloeosporioides s. str. isolates included in this study. On the basis of conidial shape and size and colony characteristics, it would not have been possible to assign the isolates to either of these species. Rose and Damm (2024) showed that morphological data were not sufficient to identify Colletotrichum species from strawberries belonging to the C. acutatum and C. dematium complexes. The data from this study confirm that identification of Colletotrichum species based on morphological characteristics alone is not possible. For an unambiguous species assignment, DNA sequence data are necessary. Despite the variable morphology, the sequences of the four loci of all eight C. cigarro isolates from H. perforatum examined morphologically were identical, regardless of country, location, and year of collection, including those of the nearly 90-year-old isolate CBS 237.49. The pathogen apparently had not changed over time and can probably be considered as a clonal lineage. The ApMat sequences of selected C. cigarro strains generated in this study support this hypothesis as they are identical (data not shown). Clonal spread has also been observed in C. nymphaeae from strawberries in Germany and other countries that are in connection with global trade (Rose and Damm, 2024). However, until now, there are only data available of strains from Germany and Switzerland, two countries within Central Europe. Sequence data of strains from other regions would enhance our knowledge about the disease.
In this study, no further Colletotrichum species were detected on H. perforatum. In the USDA Fungal Databases (https://fungi.ars.usda.gov; last visited 23 October 2024), there was also no further species listed that had been identified based on sequence data. The identification of the St John’s wort pathogen from Hungary as C. gloeosporioides was based on morphology (Schwarczinger and Vajna, 1998) and is therefore not reliable. Moreover, an unidentified Colletotrichum species had been reported from stem anthracnose of H. graveolens, H. michellianum, H. perforatum, and H. punctatum in the USA (Grand, 1985). Both reports could refer to C. cigarro, which cannot be confirmed due to the lack of sequence data. In contrast, DNA sequences of further Colletotrichum isolates from Hypericum were detected in the NCBI database (Nirenberg et al., 2002; Ellsworth et al., 2013; Staňková et al., 2014; Samaga and Rai, 2016; Ding et al., 2023). These sequences were included in the analyses of the present study. Only the C. “gloeosporioides” isolate BBA 70048 (from Hypericum sp., without location) clustered in the ITS phylogeny with the C. cigarro isolates from H. perforatum sequenced in this study, however, also with other species that have identical ITS sequences. The ITS sequences of further Colletotrichum isolates from Hypericum found in GenBank that were previously identified as C. kahawae, C. gloeosporioides, C. acutatum and C. graminicola were isolated from symptom less Hypericum spp. plants in different countries (Ellsworth et al., 2013; Staňková et al., 2014; Samaga and Rai, 2016; Ding et al., 2023); they either clustered in the ITS phylogeny with other species of the C. gloeosporioides complex or belong to species of other species complexes. As these sequences were from the ITS region, it was not possible to identify the isolates to species level with certainty; sequence data of loci with a higher resolution are necessary to identify them. Since these fungi were isolated as endophytes, it is not very likely that they cause St John’s wilt and even less likely that they pose a major threat to Hypericum cultivation.
To confirm that C. cigarro causes St John’s wilt of H. perforatum, pathogenicity tests were carried out with selected strains of C. cigarro from H. perforatum and for comparison with isolates of C. gloeosporioides s. str. from other hosts on seedlings and head cuttings of St John’s wort. All strains of C. cigarro caused severe anthracnose with subsequent wilt symptoms on H. perforatum plantlets. It is particularly noteworthy that the symptoms of the strains isolated in this study corresponded to those of the strain CBS 237.49, isolated in 1937 (Wollenweber and Hochapfel, 1949). Interestingly, plantlets inoculated with C. gloeosporioides s. str. showed no symptoms but were latently infected. The same was observed after inoculation of H. perforatum with strains of C. nymphaeae and C. destructivum (data not shown) belonging to the C. acutatum and C. destuctivum complexes, respectively, and are common on other hosts in Europe (Damm et al., 2012, 2014; Rose and Damm, 2024). This indicates that other species of the genus can infect H. perforatum but do not cause symptoms and could explain the isolations of, e.g., representatives of the C. acutatum and C. graminicola species complex from H. perforatum in the Czech Republic (Staňková et al., 2014). If host plants of these species complexes are nearby, latent H. perforatum infection may be possible.
Based on this study, St John’s wilt of H. perforatum in Europe is caused only by C. cigarro. However, different Colletotrichum species might be latently present in H. perforatum in Europe and other regions of the world, and further Hypericum species might also be affected by other Colletotrichum species. To address these points and answer the question of whether C. cigarro isolates from other host plants could also cause symptoms on H. perforatum, further studies are needed.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Author contributions
L-SK: Writing – original draft, Writing – review & editing, Conceptualization, Data curation, Formal analysis, Investigation, Methodology. UD: Writing – review & editing. MG: Writing – original draft, Writing – review & editing, Conceptualization, Data curation, Supervision.
Funding
The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This study was carried out in the project Junior Research Group Medicinal Plants (NWG-Arzneipflanzen) and was supported by the Agency of Renewable Resources (FNR) of the Federal Ministry of Food and Agriculture (BMEL) (project code 22002818).
Acknowledgments
The authors thank Wolfgang Maier (Institute for Epidemiology and Pathogen Diagnostics, JKI, Germany) and Andrey Yurkov (Leibniz Institute DSMZ − German Collection of Microorganisms and Cell Cultures GmbH, Germany) for providing Colletotrichum strains; Janett Riebesehl (Institute for Plant Protection in Horticulture and Urban Green, JKI, Germany) for support with taxonomy and editing the manuscript; Frank Marthe (Institute for Breeding Research on Horticultural Crops, JKI, Germany) for project organization; Anne Leiendorf, Kerstin Rogge, Marion Karolczak-Klekamp, Petra Mitschke, and Sascha Bauszus for excellent technical assistance; and Elke Jeworutzki and Ute Höfer for growing and maintaining the experimental plants.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/ffunb.2024.1534080/full#supplementary-material
References
1
BommeU. (1997). Produktionstechnologie von Johanniskraut (Hypericum perforatum L.). Z. für Arznei- und Gewürzpflanzen2, 127–134.
2
CabralA.AzinheiraH. G.TalhinhasP.BatistaD.RamosA. P.SilvaM.et al. (2020). Pathological, morphological, cytogenomic, biochemical and molecular data support the distinction between Colletotrichum cigarro comb. et stat. nov. and Colletotrichum kahawae. Plants (Basel)9, 1–22. doi: 10.3390/plants9040502
3
CarboneI.KohnL. M. (1999). A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia91, 553. doi: 10.2307/3761358
4
ChoudharyN.CollignonT. E.TewariD.BishayeeA. (2022). Hypericin and its anticancer effects: From mechanism of action to potential therapeutic application. Phytomedicine105, 154356. doi: 10.1016/j.phymed.2022.154356
5
DammU.CannonP. F.WoudenbergJ. H. C.CrousP. W. (2012). The Colletotrichum acutatum species complex. Stud. Mycol73, 37–113. doi: 10.3114/sim0010
6
DammU.O’ConnellR. J.GroenewaldJ. Z.CrousP. W. (2014). The Colletotrichum destructivum species complex - hemibiotrophic pathogens of forage and field crops. Stud. Mycol79, 49–84. doi: 10.1016/j.simyco.2014.09.003
7
DammU.SatoT.AlizadehA.GroenewaldJ. Z.CrousP. W. (2019). The Colletotrichum dracaenophilum, C. magnum and C. orchidearum species complexes. Stud. Mycol92, 1–46. doi: 10.1016/j.simyco.2018.04.001
8
DebrunnerN.RauberA.-L.SchwarzA.MichelV. V. (2000). First report of St. John’s-wort anthracnose caused by Colletotrichum gloeosporioides in Switzerland. Plant Dis.84, 203. doi: 10.1094/PDIS.2000.84.2.203C
9
DingJ.ShenH.YaoL.GaoX.ZhangM.WangZ.et al. (2023). First report of anthracnose caused by Colletotrichum kahawae on Hypericum chinensis in China. Plant Dis. 108, 795. doi: 10.1094/PDIS-08-23-1496-PDN
10
EllsworthK. T.ClarkT. N.GrayC. A.JohnsonJ. A. (2013). Isolation and bioassay screening of medicinal plant endophytes from eastern Canada. Can. J. Microbiol.59, 761–765. doi: 10.1139/cjm-2013-0639
11
Fachagentur Nachwachsende Rohstoffe e.V (2014). Marktanalyse Nachwachsende Rohstoffe. (Germany: Gülzow-Prüzen).
12
FilodaG. (2004). Colletotrichum gloeosporioides - a new pathogen of St. John’s wort (Hypericum perforatum) in Poland. Phytopathol. Pol.34, 71–79.
13
FrankH. M. (1990). Zur einheitlichen Präsentation der Ergebnisse von Sporenmessungen. Boletus14, 36–42.
14
FritzscheR.HoppeB. (Eds.) (2007). Krankheiten und Schädigungen an Arznei- und Gewürzpflanzen. (Bernburg: Verein für Arznei- und Gewürzpflanzen SALUPLANTA).
15
GärberU. (1999). Erste Ergebnisse von Untersuchungen zur Johanniskrautwelke. Z. für Arznei- und Gewürzpflanzen4, 181–186.
16
GärberU.SchenkR. (2002a). Colletotrichum cf. gloeosporioides an Johanniskraut (Hypericum perforatum L.) 1 Teil Untersuchungen zur Biologie und Epidemiologie. Nachrichtenbl. Deut. Pflanzenschutzd.1, 13–19.
17
GärberU.SchenkR. (2002b). Colletotrichum cf. gloeosporioides an Johanniskraut (Hypericum perforatum L.) 2 Teil Untersuchungen zu den Übertragungswegen des Erregers. Nachrichtenbl. Deut. Pflanzenschutzd.3, 63–68.
18
GötzM.SommerfeldK.GärberU.BraunU.AshrafiS. (2024). Rhexocercosporidium matricariae sp. nov. - a new pathogen on the medicinal plant Matricaria recutita. Plant Disease108, 2645–2652. doi: 10.1094/PDIS-01-24-0085-SR
19
GrandL. F. (1985). North carolina plant disease index North Carolina agricultural research service. Tech. Bull.240, 1–157.
20
GuerberJ. C.LiuB.CorrellJ. C.JohnstonP. R. (2003). Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia95, 872–895. doi: 10.1080/15572536.2004.11833047
21
HildebrandP. D.JensenK. (1991). Potential for the biological control of St. John’s-wort (Hypericum perforatum) with an endemic strain of Colletotrichum gloeosporioides. Can. J. Plant Pathol.13, 60–70. doi: 10.1080/07060669109500966
22
KatohK.RozewickiJ.YamadaK. D. (2019). MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform.20, 1160–1166. doi: 10.1093/bib/bbx108
23
KatohK.StandleyD. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol.30, 772–780. doi: 10.1093/molbev/mst010
24
KimuraM. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol.16, 111–120. doi: 10.1007/BF01731581
25
KumarS.StecherG.LiM.KnyazC.TamuraK. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol.35, 1547–1549. doi: 10.1093/molbev/msy096
26
MichelV. V.DebrunnerN.SimonnetX. (2014). A rapid greenhouse screening method to identify St. John’s wort (Hypericum perforatum) accessions resistant to Colletotrichum gloeosporioides. horts49, 31–34. doi: 10.21273/HORTSCI.49.1.31
27
NirenbergH. I.FeilerU.HagedornG. (2002). Description of Colletotrichum lupini comb. nov. in modern terms. Mycologia94, 307–320. doi: 10.1080/15572536.2003.11833238
28
OEPP/EPPO (2021). PM 7/129 (2) DNA barcoding as an identification tool for a number of regulated pests. EPPO Bull.51, 100–143. doi: 10.1111/epp.12724
29
PlescherA. (1997). Effizienter und umweltgerechter Anbau von Johanniskraut (Hypericum perforatum L.). Drogenreport10, 22–26.
30
PutnamM. L. (2000). First report of leaf blight and stem dieback of St. John’s-wort caused by Diploceras hypericinum in Oregon. Plant Dis.84, 1250. doi: 10.1094/PDIS.2000.84.11.1250B
31
RoseC.DammU. (2024). Diversity of Colletotrichum species on strawberry (Fragaria × ananassa) in Germany. Phytopathol. Mediterr.63, 155–178. doi: 10.36253/phyto-15094
32
SamagaP. V.RaiV. R. (2016). Diversity and bioactive potential of endophytic fungi from Nothapodytes foetida, Hypericum mysorense and Hypericum japonicum collected from Western Ghats of India. Ann. Microbiol.66, 229–244. doi: 10.1007/s13213-015-1099-9
33
SchwarczingerI.VajnaL. (1998). First report of St. John’s-wort anthracnose caused by Colletotrichum gloeosporioides in Hungary. Plant Dis.82, 711. doi: 10.1094/PDIS.1998.82.6.711B
34
ShepherdR. C. H. (1995). A Canadian isolate of Colletotrichum gloeosporoides as a potential biological control agent for St. John’s wort (Hypericum perforatum) in Australia. Plant Prot. Q.10, 148–151.
35
StaňkováB.VíchováJ.PokornýR. (2014). Virulence of Colletotrichum acutatum isolates to several host plants. Acta Univ. Agric. Silvic. Mendelianae Brun.59, 161–170. doi: 10.11118/actaun201159030161
36
SuryawanshiM. V.GujarathiP. P.MullaT.BagbanI. (2024). Hypericum perforatum: a comprehensive review on pharmacognosy, preclinical studies, putative molecular mechanism, and clinical studies in neurodegenerative diseases. Naunyn Schmiedebergs Arch. Pharmacol.397, 3803–3818. doi: 10.1007/s00210-023-02915-6
37
TamuraK. (1992). Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Mol. Biol. Evol.9, 678–687.
38
TamuraK.NeiM. (1993). Estimation of the number of nucleotide substitutions in the control region of mitrochondrial DNA in humans and chimpanzees. Mol. Biol. Evol.10, 512–526. doi: 10.1093/oxfordjournals.molbev.a040023
39
WahlS.van HammeA.PlescherA.Feldevert-HövelerM. (2018). Anfälligkeit von Johanniskraut (Hypericum perforatum) gegenüber dem Welkeerreger Colletotrichum gloeosporioides - Gesamtauswertung mehrerer Resistenzprüfungen-. Quedlinburg, Germany. 83–85. doi: 10.5073/jka.2018.460.023
40
WallerJ. M.BridgeP. D.BlackR.HakizaG. (1993). Characterization of the coffee berry disease pathogen, Colletotrichum kahawae sp. nov. Mycol Res.97, 989–994. doi: 10.1016/S0953-7562(09)80867-8
41
WeirB. S.JohnstonP. R.DammU. (2012). The Colletotrichum gloeosporioides species complex. Stud. Mycol73, 115–180. doi: 10.3114/sim0011
42
WhiteT. J.BrunsT.LeeS.TaylorJ. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics (San Diego, CA, USA: Academic Press), 315–322.
43
WollenweberH. W.HochapfelH. (1949). Beiträge zur Kenntnis parasitärer und saprophytischer Pilze. VI. Vermicularia, Colletotrichum, Gloeosporium, Glomerella und ihre Beziehung zur Fruchtfäule. Z. für Parasitenkunde14, 181–268. doi: 10.1007/BF00259688
44
YuanX.YanF.GaoL.-H.MaQ.-H.WangJ. (2023). Hypericin as a potential drug for treating Alzheimer’s disease and type 2 diabetes with a view to drug repositioning. CNS Neurosci. Ther.29, 3307–3321. doi: 10.1111/cns.14260
Summary
Keywords
anthracnose, Colletotrichum cigarro, Colletotrichum gloeosporioides, Colletotrichum kahawae, Hypericum perforatum, Glomerella cingulata var. migrans, St John’s wilt pathogen, St John’s wort
Citation
Kreth L-S, Damm U and Götz M (2025) A new name for an old problem—Colletotrichum cigarro is the cause of St John’s wilt of Hypericum perforatum. Front. Fungal Biol. 5:1534080. doi: 10.3389/ffunb.2024.1534080
Received
25 November 2024
Accepted
24 December 2024
Published
23 January 2025
Volume
5 - 2024
Edited by
Jens Staal, Ghent University, Belgium
Reviewed by
Riccardo Baroncelli, University of Bologna, Italy
Gunjan Sharma, Gujarat Biotechnology University, India
Updates
Copyright
© 2025 Kreth, Damm and Götz.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Lana-Sophie Kreth, lana-sophie.kreth@julius-kuehn.de; Monika Götz, monika.goetz@julius-kuehn.de
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.