Abstract
Peste des Petits Ruminants Virus (PPRV) is an extremely infective morbillivirus that primarily affects goats and sheep. In underdeveloped countries where livestock are the main economical resource, PPRV causes considerable economic losses. Protective live attenuated vaccines are currently available but they induce antibody responses similar to those produced in PPRV naturally infected animals. Effective vaccines able to distinguish between vaccinated and naturally infected animals are required to PPRV control and eradication programs. Hemagglutinin (H) is a highly immunogenic PPRV envelope glycoprotein displaying both hemagglutinin and neuraminidase activities, playing a crucial role in virus attachment and penetration. In this study, a recombinant Bovine Herpesvirus-4 (BoHV-4)-based vector delivering an optimized PPRV-Hemagglutinin expression cassette, BoHV-4-A-PPRV-H-ΔTK, was assessed in immunocompetent C57BL/6 mice. BoHV-4-A-PPRV-H-ΔTK-immunization elicited both cellular and humoral immune responses with specific T cell, cytotoxic T lymphocyte, and sero-neutralizing antibody against PPRV. These data suggest recombinant BoHV-4-A-PPRV-H-ΔTK as an effective vaccine candidate to protect against PPRV herd infection and potentially applicable for eradication programs.
Introduction
Peste des Petits Ruminants (PPR) is an often fatal, highly contagious, and devastating disease affecting domestic small ruminants and especially goats. PPR is an Office International des Epizooties (OIE)-listed disease (http://www.oie.int/animal-health-in-the-world/oie-listed-diseases-2018/), endemic in several countries such as India, Turkey, Africa, and Southwest and Central Asia. Mouth and tongue lesions, cough, diarrhea, nasal and ocular discharge, and depression are typical clinical PPR disease signs. The PPR disease etiological agent is Peste des Petits Ruminants Virus (PPRV), a single-stranded negative sense enveloped RNA virus belonging to Paramixoviridae family, Morbillivirus genus (1) whose genome contains six genes coding for eight proteins. Among these, Hemagglutinin (H) is a structural glycoprotein with hemagglutinin and neuraminidase activities, involved in host cell targeting and virus attachment. H glycoprotein is an immunodominant antigen which, alone, can stimulate a protective immune-response when delivered by several viral vectors, mainly based on adenovirus (2–4) and poxvirus (5, 6). These antigen immune-properties would allow the generation of a Differentiating Infected from Vaccinated Animals (DIVA) vaccine. Since PPRV H glycoprotein is the only PPRV antigen expressed by the viral vector, the use of an ELISA against a different antigen, such as PPRV nucleo-capsid protein (N), would allow to distinguish naturally infected animals from vaccinated animals. Viral vectors are not only simply delivery systems but they can also work as adjuvants, unspecificaly stimulating the immune system and therefore increasing the specific active/protective immunity. Different classes of viruses have been tested as viral vectors and each presents particular advantages and disadvantages, depending on their biological characteristics and on the host, who needs to be protected toward a specific disease. Hence, it is arduous to predict which viral vector could be the best. A specific viral-vector should be able to confer selective immunization only against a specific pathogen and not toward others. Consequently, it would be of great interest to explore new vector vaccines based on different viruses. Bovine herpesvirus 4 (BoHV-4) is a dsDNA genome virus belonging to Herpesviridae family, Gammaherpesvirus sub-family and Rhadinovirus genus. BoHV-4 natural host is cattle, whereas its best experimental host is the rabbit. However, BoHV-4 has been isolated from domestic and non-domestic bovine species such as African buffalo (Syncerus caffer) (7), American bison (Bison bison), or zebus (Bos indicus) and small ruminants such as sheep and goats (8). Some feline isolates from lions (9) and cats (10) were also reported. Moreover, BoHV-4 isolates were also obtained from the kidney of an apparently healthy monkey (Aotus trivirgatus) (11). BoHV-4 can replicate in vitro in primary cultures and cell lines from a variety of animal species (12–18), whereas in vivo, it can experimentally infect mice (16, 19, 20), rats (21), rabbits (15), sheep (13), swine (22), and goats (18). Moreover, ex vivo non-human primate tissue explants infections have also been observed (paper in preparation). Another BoHV-4 important feature, which makes it an attractive gene delivery vector, is that in contrast to other gamma herpesviruses, BoHV-4 is not oncogenic and its infection is not directly linked to a specific pathology. Since BoHV-4-based vector has been successfully employed to immunize mice (16, 19, 20), sheep (13), and goats (18), in the present work, an exploratory immunization study for PPRV in mice, before applying BoHV-4-based vector in sheep and goats, was performed. A recombinant BoHV-4 expressing the PPRV Hemagglutinin gene (Nigeria 75/1 strain) was generated. BoHV-4-A-PPRV-H-ΔTK immunized mice developed both PPRV neutralizing antibodies and PPRV specific T-cell responses. These data indicate that this BoHV-4-based vector could be an effective PPR vaccine candidate for small ruminants that could distinguish between infected and vaccinated animals.
Materials and Methods
Cells and Viruses
In this study, HEK (Human Embryo Kidney) 293 T (ATCC: CRL-11268), BEK (Bovine Embryo Kidney) from Dr. M.Ferrari, Istituto Zooprofilattico Sperimentale, Brescia, Italy (BS CL-94), and BEK cre, expressing cre recombinase (14), were cultured in Eagle’s Minimal Essential Medium (EMEM, Gibco) containing 10% fetal bovine serum (FBS), 2 mM of L-glutamine (Gibco), 100 IU/ml of penicillin (Gibco), 100 µg/ml of streptomycin (SIGMA), and 0.25 µg/ml of amphotericin B (Gibco) and were incubated at 37°C, 5% CO2 in a humidified incubator. Vero Dog-SLAM (VDS) and RMA-s cell lines (23), kindly provided by Dr. Parida (IAH, Pirbright, UK) and Dr McArdle (The Nottingham Trent University, UK), respectively, were cultured as described in Ref. (24, 25).
Constructs Generation
Synthetic PPRV-H ORF was first amplified from pGEM-T Easy-PPRV-H template by PCR using NheI-PPRV-H sense (5′-ccccgctagcccaccatgtccgcacaaagggaaagg-3′) and Phos-PPRV-H antisense (5′-agactggattacatgttacctc-3′) pair of primers in order to insert NheI restriction site at 5′ terminus and a phosphate group at 3′ terminus. The PPRV-H amplicon generated was then cloned into NheI/SalI blunt cut pIgK-E2BVDV3-gD106 intermediate shuttle vector (Clontech) to generate pIgK-PPRV-H-gD106. The gD106 tagged fragment was excised from the intermediate plasmid cutting with NheI and BamHI blunt restriction enzymes to be subsequently cloned inside the pINT2-EGFP final shuttle vector cut with NheI and SmaI restriction enzymes in order to generate pINT2-PPRV-H-gD106.
Transient Transfection
HEK 293 T cells were seeded into six well plates (3 × 105 cells/well) and incubated at 37°C with 5% CO2. When cells were sub-confluent, the culture medium was removed and the cells were transfected with pIgK-PPRV-H-gD106, pINT2-PPRV-H-gD106, and pEGFP-C1 using Polyethylenimine (PEI) transfection reagent (Polysciences, Inc.). Briefly, 3 µg of DNA were mixed with 7.5 µg PEI (1 mg/ml) (ratio 1:2.5 DNA:PEI) in 200 µl of Dulbecco’s modified essential medium (DMEM) high glucose (Euroclone) without serum. After 15 min at room temperature, 800 µl of medium without serum were added, and the transfection solution was transferred to the cells (monolayer) and left for 6 h at 37°C with 5% CO2, in a humidified incubator. The transfection mixture was then replaced with fresh medium EMEM, with 10% FBS, 100 IU/ml of penicillin, 100 µg/ml of streptomycin, and 0.25 µg/ml of amphotericin B, and incubated for 24 h at 37°C with 5% CO2.
Western Immunoblotting
Protein cell extracts were obtained from a six-well confluent plate of HEK 293 T cells transfected with pIgK-PPRV-H-gD106, pINT2-PPRV-H-gD106, and pEGFP-C1 and from 25-cm2 confluent flasks of BEK cells infected with BoHV-4-A-PPRV-H-ΔTK by adding 100 µl of cell extraction buffer (50 mM Tris–HCl, 150 mM NaCl, and 1% NP-40; pH 8). To analyze cell extracts, a 10% SDS-PAGE gel electrophoresis was used. After protein transfer in PVDF membranes by electroblotting, the membranes were incubated with primary bovine anti gD106 monoclonal antibody (clone 1B8-F11; VRMD, Inc., Pullman, WA, USA) diluted 1:10,000 and then probed with horseradish peroxidase-labeled anti-mouse immunoglobulin (SIGMA), diluted 1:10,000, and bands visualized by enhanced chemiluminescence (ECL KIT; PIERCE).
BAC Recombineering and Selection
Recombineering was performed as previously described (26) with some modifications. For heat-inducible homolog recombination in SW102 Escherichia coli (E. coli), containing the BAC-BoHV-4-A-TK-KanaGalK-TK genome targeted into the TK locus with KanaGalK selector cassette, the PvuI linearized pTK-CMV-PPRV-H-TK expression cassette was used. After recombineering, only those colonies that were kanamycin negative and chloramphenicol positive were kept and grown overnight in 5 ml of LB containing 12.5 mg/ml of chloramphenicol. BAC-DNA was purified and analyzed through HindIII restriction enzyme digestion. DNA was separated by electrophoresis in a 1% agarose gel, stained with ethidium bromide, and visualized through UV light. Original detailed protocols for recombineering can also be found at the recombineering website (https://redrecombineering.ncifcrf.gov/).
Southern Blotting
To further confirm our results, a Southern Blotting with a probe spanning H sequence was performed. DNA from 1% agarose gel was capillary transferred to a positively charged nylon membrane (ROCHE) and cross-linked by UV irradiation by standard procedures (14). The membrane was pre-hybridized in 50 ml of hybridization solution (7% SDS, 0.5 M phosphate, pH 7.2) for 1 h at 65°C in a rotating hybridization oven (Techna Instruments).
H probe labeled with digoxigenin was generated by PCR with NheI-PPRV-H sense (5′- ccccgctagcccaccatgtccgcacaaagggaaagg -3′) and Phos-PPRV-H antisense (5′- agactggattacatgttacctc -3′) primers, as previously described (15). The PCR amplification reaction was carried out in a final volume of 50 µl, containing 10 mmol Tris–hydrochloride pH 8.3, 5% Dimethyl Sulfoxide (DMSO), 0.2 mmol deoxynucleotide triphosphates, 2.5 mM MgSO4, 50 mM KCl, and 0.25 µM of each primer. One hundred nanograms of DNA were amplified over 35 cycles, each cycle consisting of 1 min of denaturation at 94°C, 1 min of primer annealing at 60°C, and 2 mins of chain elongation with 1U of Taq DNA polymerase (Fermentas) in addition to 1 µl of Digoxigenin-11-dUTP, alkali-labile (Roche Life Science) at 72°C.
Cell Culture Electroporation and Recombinant Virus Reconstitution
BEK or BEK cre cells were maintained as a monolayer with complete DMEM growth medium with 10% FBS, 2 mM l-glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin. When cells were sub-confluent (70–90%) they were split to a fresh culture flask (i.e., every 3–5 days) and were incubated at 37°C in a humidified atmosphere of 95% air, 5% CO2. BAC-DNA (5 µg) was electroporated in 600 µl DMEM without serum (Equibio Apparatus, 270 V, 960 mF, 4-mm gap cuvettes) into BEK and BEK cre cells from a confluent 25-cm2 flask. Electroporated cells were returned to the flask, after 24 h the medium was replaced with fresh medium, and cells were split 1:2 when they reached confluence at 2 days post-electroporation. Cells were left to grow until the appearance of cytopathic effect (CPE).
Viruses and Viral Replication
BoHV-4-A-PPRV-H-ΔTK and BoHV-4-A were propagated by infecting confluent monolayers of BEK cells at a multiplicity of infection (MOI) of 0.5 tissue culture infectious doses 50 (TCID50) per cell and maintained in medium with only 2% FBS for 2 h. The medium was then removed and replaced with fresh EMEM containing 10% FBS. When CPE affected the majority of the cell monolayer (~72 h post infection), the virus was prepared by freezing and thawing cells three times and pelleting the virions through a 30% sucrose cushion, as previously described (27). Virus pellets were then resuspended in cold EMEM without FBS. TCID50 were determined on BEK cells by limiting dilution.
Viral Growth Curves
BEK cells were infected with BoHV-4-A and BoHV-4-A-PPRV-H-ΔTK at a M.O.I. of 0.1 TCID50/cell and incubated at 37°C for 4 h. Infected cells were washed with serum-free EMEM and then overlaid with EMEM containing 10% FBS, 2 mM L-glutamine, 100 IU/ml penicillin, 100 mg/ml streptomycin, and 2.5 mg/ml Amphotericin B. The supernatants of infected cultures were harvested after 24, 48, 72, and 96 h, and the amount of infectious virus was determined by limiting dilution on BEK cells. Viral titer differences between each time point are the averages of triplicate measurements ± standard errors of the mean (p > 0.05 for all time points as measured by Student’s t-test).
Animals and Immunizations
Seven- to eight-week old female C57BL/6 mice (Harlan) animals were inoculated and boosted after 21 days intraperitoneally (ip) with PBS (group 1; n = 10), with 106 TCID50/ml of BoHV-4-A (group 2; n = 10) or with 106 TCID50/ml of BoHV-4-A-PPRV-H-ΔTK (group 3; n = 10). Animals were bled at 14, 28, and 36 days post first immunization. Five animals per group were sacrificed at day 7 post-boost to perform T cell response experiments. All animal experiments were performed in a disease-secure isolation facility (BSL3) at the CISA (INIA) in strict accordance with the recommendations of the Code for Methods and Welfare Considerations in Behavioral Research with Animals (Directive 867609EC; RD1201/2005).
Flow Cytometry Intracellular Cytokine Staining Assays
Splenocytes from inoculated mice were prepared as previously described (24). For responses to PPRV, splenocytes were cultured overnight with BEI-inactivated PPRV (Nig’75) (28). To assess responses to PPRV-H murine T cell epitopes H5 (H(551-559) YFYPVRLNF) and H9 (H(427-441) ITSVFGPLIPHLSGM) (29), splenocytes were expanded in vitro for 1 week with 10 µg/ml peptide before measuring IFN-γ responses. For intracellular IFN-γ measurements, cells were cultured at 106 cells per well in the presence of different stimuli (peptide or PPRV) overnight before the addition of 10 µg/ml brefeldin-A (Sigma) for the last 5 h of incubation. Phorbol myristyl acetate (20 ng/ml) and ionomycin (1 µg/ml) (both from sigma) stimulation was used as positive control for IFN-γ production. Vehicle (DMSO)-stimulated (no peptide) or irrelevant peptides (gp33-41 peptide (KAVYNFATC) from lymphocytic choriomeningitis virus) were used as negative control. No differences in background IFN-γ production was detected between these negative control groups. Following stimulation, cells were stained with anti-mouse CD4-FITC and anti-mouse CD8-PerCP antibodies (BDpharmingen). Cells were fixed and permeabilized in PBS containing 4% paraformaldehyde and 0.1% saponin (wt/vol). Cells were then stained with anti-mouse IFN-γ-PE (BD pharmingen) and acquired using a FACSCalibur flow cytometer (Becton Dickinson). Gating strategy is described in Ref. (29). Gating for positive IFN-γ positive events was set using isotype and fluorescence minus one channel controls. Data were analyzed with FlowJo software (TreeStar Inc.).
Flow Cytometry Cytotoxicity Assays
Splenocytes from BoHV-4-A-PPRV-H-ΔTK immunized mice were expanded with H5 peptide for 1 week in vitro. These stimulated splenocytes were used as effector cells. RMA/s target cells were labeled with PKH67 green fluorescent linker as described in Ref. (30) and pulsed with relevant peptide. Vehicle-pulsed (no peptide) RMA/s cells were used as negative control. Effector cells and target cells were incubated for 4 hours at 37°C in 96 U-bottom well plates. Cells were then transferred to FACS tubes, dead cells labeled with propidium iodide (PI) (2 µg/ml), and samples immediately analyzed by flow cytometry. Target cells were gated on bright FL1+ cells. Positive maximum cell death controls (target cells in PBS + 0.2% saponin) and spontaneous cell death controls were used in all experiments. The percentage of specific target cell lysis was calculated following the formula: % specific lysis = 100 × (% PI+ target – % spontaneous death)/(% maximum death − % spontaneous death).
PPRV Neutralization Assays
Serum samples were inactivated for 30 min at 56°C and tested for the presence of neutralizing antibodies as previously described (31). Briefly, Nigeria 75/1 PPRV stock was incubated with serial dilutions of inactivated sheep serum for 1 hour at RT in triplicate. VDS cells at a concentration of 1.5 × 105 cells/ml were added to each well and incubated for 7 days, fixed with 2% formaldehyde and cells visualized by crystal violet staining. Wells without virus served as controls. The plates were monitored for PPRV CPE for 7 days. The VNT titer was defined as the highest dilution of serum that inhibited 50% of the CPE. Sera with VNT titers of 1:10 were considered negative.
Statistical Analysis
Power analysis (32) was used to determine treatment group size to assess T cell responses and PPRV seroneutralization. Statistical analysis was performed using Prism 5.0 software (Graphpad Software Inc., USA). Mann–Whitney test was used to compare IFN-γ production in CD4+ and CD8+ T cells. Levels of significance were *p < 0.05, **p < 0.01, and ***p < 0.001.
Results
BoHV-4-A-PPRV-H-ΔTK Generation
Based on the assumption that PPRV-H antigen could induce a protective immune response, a recombinant BoHV-4, BoHV-4-A-PPRV-H-ΔTK, delivering an optimized CMV-PPRV-HgD106 expression cassette (Figure 1A), was generated by heat inducible homologous recombination in SW102 E. Coli strain containing pBAC-BoHV-4-A-KanaGalK-ΔTK (14) (Figure 1B). The so obtained pBAC-BoHV-4-A-PPRV-H-ΔTK recombinant viral genome authenticity was first assessed by HindIII restriction enzyme analysis and then confirmed by Southern Blotting using a PPRV-H specific probe. Clonal stability was ascertained by growing the positive clone over 20 passages. Recombinant BoHV-4-A-PPRV-H-ΔTK infectious viral particles were then obtained electroporating BEK or BEKcre cells. These last cells allowed the depletion of the BAC/GFP cassette from the recombinant viral genome, as shown by the loss of green plaques (Figure 1C). Furthermore, BoHV-4-A-PPRV-H-ΔTK showed no replication defects comparing with the BoHV-4-A parental strain (Figure 1D) and expressed PPRV-H protein (Figure 1E).
Figure 1
BoHV-4-A-PPRV-H-ΔTK Immunization Induces T Cell Response against PPRV
Splenocytes from C57BL/6 mice were extracted 7 days after booster immunization and IFN-γ production by T cells to inactivated PPRV Nig’75 strain was measured by flow cytometry (Figure 2). CD4+ T cells from BoHV-4-A-PPRV-H-ΔTK immunized mice produced IFN-γ in response to inactivated PPRV stimulation (Figures 2A,B). No specific IFN-γ production to PPRV was detected in CD4+ T cells from PBS- or BoHV-4-A immunized mice. Similarly, CD8+ T cells from BoHV-4-A-PPRV-H-ΔTK immunized mice produced IFN-γ in the presence of PPRV, whereas CD8+ T cells from PBS- or BoHV-4-A-immunized animals did not. These data indicate that BoHV-4-A-PPRV-H-ΔTK immunization can elicit CD4+ and CD8+ T cell responses to PPRV infection.
Figure 2
BoHV-4-A-PPRV-H-ΔTK Immunization Induces Responses to PPRV-H T Cell Epitopes
Several murine T cell epitopes from PPRV-H in the H-2b context were previously defined (29). In the present work, H5 and H9 peptides from PPRV-H protein were used to further characterize the T cell response against PPRV after BoHV-4-A-PPRV-H-ΔTK immunization. Splenocytes from immunized mice were stimulated 1 week in vitro with H5 and H9 peptides and IFN-γ production was assessed by flow cytometry using intracellular staining (Figure 3). H5 peptide induced specific IFN-γ production in CD8+ T cells but not in CD4+ T cells of BoHV-4-A-PPRV-H-ΔTK-immunized mice (Figures 3A,B). No specific H5 peptide-stimulated IFN-γ production was detected in PBS or BoHV-4-A immunized mice splenocytes. H9 peptide induced specific IFN-γ production both in CD4+ and CD8+ T cells of BoHV-4-A-PPRV-H-ΔTK-immunized mice (Figures 3C,D). No H9 peptide-stimulated IFN-γ secretion was detected in PBS or BoHV-4-A groups. BoHV-4-A-PPRV-H-ΔTK immunization therefore elicited both CD4+ and CD8+ T cell responses against PPRV-H epitopes.
Figure 3
BoHV-4-A-PPRV-H-ΔTK Immunization Stimulates Anti-PPRV Cytotoxic T Lymphocytes (CTL)
Splenocytes from BoHV-4-A-PPRV-H-ΔTK-immunized mice were H5 peptide-stimulated for 1 week in vitro and used as effector cells in flow cytometry-based cytotoxicity assays. RMA-s cells were used as target cells in these experiments. Splenocytes from BoHV-4-A-PPRV-H-ΔTK-immunized mice were capable of specifically lysing RMA-s cells pulsed with H5 peptide (Figures 4A,B). These data indicate that BoHV-4-A-PPRV-H-ΔTK immunization can promote CTL responses against PPRV infection.
Figure 4
BoHV-4-A-PPRV-H-ΔTK Immunization Induces a Specific Neutralizing Antibody Response against PPRV-H
To determine the presence of neutralizing antibodies, sera from vaccinated mice obtained at 28 days post first immunization (7 days post booster inoculation) were assayed in a virus neutralization test. All BoHV-4-A-PPRV-H-ΔTK vaccinated animals showed PPRV-specific neutralizing antibodies with neutralization titers between 160 and 320 (Table 1).
Table 1
| Neutralization titera | |||
|---|---|---|---|
| Source of antigenb | Mouse no. | 0 DPIc | 28 DPId |
| PBS | 1 to 10 | <10 | <10 |
| BoHV-4A | 1 to 10 | <10 | <10 |
| BoHV-4-PPRV-H | 1 | <10 | 120 |
| 2 | <10 | 360 | |
| 3 | <10 | 120 | |
| 4 | <10 | 360 | |
| 5 | <10 | 120 | |
| 6 | <10 | 360 | |
| 7 | <10 | 120 | |
| 8 | <10 | 120 | |
| 9 | <10 | 120 | |
| 10 | <10 | 120 | |
In vitro analysis of neutralization of Nigeria 75/1 peste des petits ruminants virus (PPRV) strain infectivity.
aSN titers were determined against Nigeria 75/1 PPRV strain and expressed as the reciprocal of the last dilution of serum that neutralized 50% of the virus-specific cytopathic effect in flat bottom 96 plates.
bIntraperitoneally inoculations of different antigens (see Materials and Methods).
cAnalyzed sera obtained from uninfected mice.
dAnalyzed sera obtained from infected mice 28 days post first immunization (7 days post-boost).
No neutralization activity was detected in pre-immune sera or sera from mice injected with either PBS or BoHV-4-A. These results show that in vivo inoculation of recombinant BoHV-4-A expressing the PPRV-H protein is able to induce the production of PPRV neutralizing antibodies, suggesting that this approach has the potential to confer protective immunity to BoHV-4-A-PPRV-H-ΔTK vaccinated animals.
Discussion
In developing countries, most of the population is engaged in small-scale farming, 80% of these households keep livestock mostly constituted by small ruminants, primarily sheep and goats. Their productivity is constrained by multiple factors, including infectious diseases where PPR represents one of the most important ones. Vaccination can reduce animal mortality, increase milk and meat production, and positively impact on household revenues. As a result, vaccination also contributes to poverty alleviation by increasing household benefits and freeing income for food, healthcare, or child education. Therefore, new effective vaccines that target diseases that hamper farming in developing countries will have great social and economic benefit (33).
For PPRV eradication campaign, a DIVA vaccine would be of great value to facilitate PPRV sero-surveillance programs and speed up strategies for disease control and eradication (34). The most important drawback when a classical live attenuated vaccine is used is the inability to distinguish the immune response stimulated by vaccination from the one induced by a natural infection. A DIVA vaccine would therefore be a smart solution that combines vaccination with sero-surveillance. DIVA vaccine can be applied not only with gene-deleted marker vaccines (35) but also with sub-unit vaccines (36), heterologous vaccines (37), and recombinant vector-based vaccines. With regard to the last case and as an alternative viral vector, a BoHV-4-based vector platform was employed in the present work to deliver and express PPRV-H gene in transduced cells of immunocompetent mice as surrogate animal model. Although no murine model for PPRV induced disease exists, they represent an invaluable model to initially test the immunity induced by new prototype vaccines. The direct use of large animals could represent a major waste of resources, in terms of maintenance and biosafety containment structures, especially in the event of experiment failure. Data provided by immunized mice not only can be obtained quickly and cheaply but also they could represent a predictive and orientative tool of the vaccine immunogenicity in the natural host, e.g., goats and sheep in the specific case of PPRV (4, 25). PPRV-H protein possesses both hemagglutinin and neuraminidase activities and has a hydrophobic domain at the N-terminus (amino acid position 35–38), which remains within the mature protein acting as a signal peptide that anchors the protein into the membrane (38). The presence of N-terminal 34 amino acids located inside the membrane characterizes PPRV-H as a type II glycoprotein (38). Since PPRV-H protein has been shown to be a good candidate antigen (3, 4), a recombinant BoHV-4 delivering an optimized PPRV-H expression cassette was constructed in order to test the immunogenicity of this BoHV-4-based vector and exploit it as a DIVA vaccine platform for PPR vaccination. BoHV-4 has no clear direct disease association; however, its pathogenic potential cannot be absolutely excluded. This is an important consideration since it is to be used as a gene delivery vector. In fact, BoHV-4 has been often associated with postpartum metritis in cattle along with specific endometotropic (39, 40). The secretion of prostaglandin E2 (PGE2) and then stimulation of viral replication by PGE2, TNF-α, and lipopolysaccharide (LPS) were suggested as a pathogenic model for BoHV-4 and bacterial co-infection in endometritic cows (41–43). Therefore, a putative non-pathogenic biotype of BoHV-4 (BoHV-4-A) isolated from the milk cell fraction of a healthy cow whose genome was cloned as a bacterial artificial chromosome (pBAC-BoHV-4-A) (14) was employed. Importantly, BoHV-4-A-based vector behaves like a replicating incompetent viral vector in both wild-type and immunocompromised mice, showing complete absence of pathogenicity (16, 17, 19, 27, 44, 45). PPRV-H ORF was customized under the transcriptional control of the CMV promoter and integrated into BoHV-4-A genome TK locus. The derived replication-deficient recombinant vector could transduce mammalian cells and expressed PPRV-H protein. This construct could therefore potentially elicit immunity to the transgene. Genetic stability of viral vectors remains a very important issue, since recombinant viral vectors constitute “genetically modified organisms” (GMO). In our case, the BoHV-4-A-PPRV-H-ΔTK construct was stable through several passages. Relevant planning will however be needed before this recombinant vector can legally be licensed for employment in the field.
Protective natural immunity to morbilliviruses requires both humoral and cellular components of the adaptive immune system. Humoral immunity can protect against the prototype morbillivirus measles virus re-infection, whereas cellular immunity controls virus clearance and dissemination (46, 47). In the present work, mice immunized with BoHV-4-A-PPRV-H-ΔTK produced CD4+ and CD8+ T cell responses against PPRV-H epitopes and promoted CTL responses against PPRV. This recombinant vector vaccine can therefore potentially stimulate the T cell immunity essential for virus clearance. It will be interesting in future work to determine whether similarly to recombinant adenovirus vaccines (29), BoHV-4-A-PPRV-H-ΔTK immunization can trigger memory T cell responses in PPRV natural hosts.
However, the most striking results were related to the production of virus neutralizing antibodies (VNAs) against PPRV. It was previously shown that a neutralization titer higher than 10 correlates with a long-lasting humoral response and could be considered as a successful vaccination and protection indicator in the field (48, 49). In this pilot study, the lowest VNA titer obtained for all vaccinated mice was never below 120. It could thus be speculated that vaccinated BoHV-4-A-PPRV-H-ΔTK animals could be protected from virulent PPRV challenge when this protocol will be/is applied in the natural host. This is further supported by the fact that BoHV-4 has been successfully used in sheep and goats (13, 18). BoHV-4-based vector delivering H alone also induced neutralization titers higher than those obtained with other viral vectors delivering both H and F antigens, which is in line with the concept that H glycoprotein of Paramyxovirus is a stronger inducer of VNA than the F glycoprotein (50, 51). Despite the notion that antibody immune response against PPRV is the main factor for an efficient protection, cellular immune response can be also important for virus clearance. In some cases, protection has been obtained even with undetectable level of VNA titers (52, 53). The high VNA titer levels and the induction of cellular immunity after BoHV-4-A-PPRV-H-ΔTK immunization indicate that this recombinant vector vaccine has the potential to protect from virulent viral challenge. The induction of humoral and cellular immunity after BoHV-4-A-PPRV-H-ΔTK inoculation indicates that this vaccine can trigger PPRV immunity in the natural host both in an experimental setting and in the field.
In conclusion, in the present paper, it was demonstrated that BoHV-4-A-PPRV-H-ΔTK is able to induce a strong specific immune response against PPRV. These findings are paving the way for BoHV-4-A-PPRV-H-ΔTK use as a safe, large, potent, non-integrative, replicating competent viral vector for PPR vaccination and eradication.
Availability of Data and Material
Available upon request.
Statements
Ethics statement
Experiments were performed in a disease-secure isolation facility (BSL3) at the Centro de Investigación en Sanidad Animal (CISA), in strict accordance with the recommendations of the Code for Methods and Welfare Considerations in Behavioral Research with Animals (Directive 86/609EC; RD1201/2005). Experiments were approved by the Committee on the Ethics of Animal Experiments (CEEA) of the Spanish Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA) and the “Comisión de ética estatal de bienestar animal.”
Author contributions
GD conceived the experiments. VF, JR, AV, GT, NS, FM, VM, CP, and GD performed the experiments. GD, LL, SC, JR, VM, and SO analyzed the data. GD wrote the paper.
Funding
This work was supported by Italian Ministry of University and Scientific Research (Italian National Grant MIUR, PRIN 2010-2011). This work was funded by grants AGL2015-64290R and ADENONET-Redes de Excelencia (BIO2015-68990-REDT) from the Spanish Ministerio de Economía Competitividad and grant S2013/ABI-2906-PLATESA from the Comunidad de Madrid.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Abbreviations
BoHV-4, bovine herpesvirus 4; BAC, bacterial artificial chromosome; BEK, bovine embryo kidney; HEK293T, human embryo kidney 293 T; VDS, vero dog-SLAM; FBS, fetal bovine serum; EMEM, eagle’s minimal essential medium; DMEM, dulbecco’s modified essential medium; DMSO, dimethyl sulfoxide; MOI, multiplicity of infection; TCID50, tissue culture infectious doses 50; EDTA, ethylenedinitrilo-tetraacetic; PEI, polyethylenimine; CPE, cytopathic effect; MFI, mean fluorescence intensity; PPR, peste des petits ruminants; PPRV, peste des petits ruminants virus; PPRV-H, peste des petits ruminants virus hemagglutinin; H, hemagglutinin; DIVA, differentiating infected from vaccinated animals; OIE, office international des epizooties.
References
1
BaronMDDialloALancelotRLibeauG. Peste des petits ruminants virus. Adv Virus Res (2016) 95:1–42.10.1016/bs.aivir.2016.02.001
2
QinJHuangHRuanYHouXYangSWangCet alA novel recombinant peste des petits ruminants-canine adenovirus vaccine elicits long-lasting neutralizing antibody response against PPR in goats. PLoS One (2012) 7:e37170.10.1371/journal.pone.0037170
3
HerbertRBaronJBattenCBaronMTaylorG. Recombinant adenovirus expressing the haemagglutinin of Peste des petits ruminants virus (PPRV) protects goats against challenge with pathogenic virus; a DIVA vaccine for PPR. Vet Res (2014) 45:24.10.1186/1297-9716-45-24
4
RojasJMMorenoHValcarcelFPenaLSevillaNMartinV. Vaccination with recombinant adenoviruses expressing the peste des petits ruminants virus F or H proteins overcomes viral immunosuppression and induces protective immunity against PPRV challenge in sheep. PLoS One (2014) 9:e101226.10.1371/journal.pone.0101226
5
HosamaniMSinghSKMondalBSenABhanuprakashVBandyopadhyaySKet alA bivalent vaccine against goat pox and Peste des Petits ruminants induces protective immune response in goats. Vaccine (2006) 24:6058–64.10.1016/j.vaccine.2006.05.021
6
ChenWHuSQuLHuQZhangQZhiHet alA goat poxvirus-vectored peste-des-petits-ruminants vaccine induces long-lasting neutralization antibody to high levels in goats and sheep. Vaccine (2010) 28:4742–50.10.1016/j.vaccine.2010.04.102
7
DewalsBThirionMMarkine-GoriaynoffNGilletLDe FaysKMinnerFet alEvolution of bovine herpesvirus 4: recombination and transmission between African buffalo and cattle. J Gen Virol (2006) 87:1509–19.10.1099/vir.0.81757-0
8
Moreno-LopezJGoltzMRehbinderCValsalaKVLudwigH. A bovine herpesvirus (BHV-4) as passenger virus in ethmoidal tumours in Indian cattle. Zentralbl Veterinarmed B (1989) 36:481–6.
9
EgyedLKlugeJPBarthaA. Histological studies of bovine herpesvirus type 4 infection in non-ruminant species. Vet Microbiol (1997) 57:283–9.10.1016/S0378-1135(97)00105-3
10
FabricantCGKingJMGaskinJMGillespieJH. Isolation of a virus from a female cat with urolithiasis. J Am Vet Med Assoc (1971) 158:200–1.
11
BublotMDubuissonJVan BressemMFDanyiSPastoretPPThiryE. Antigenic and genomic identity between simian herpesvirus aotus type 2 and bovine herpesvirus type 4. J Gen Virol (1991) 72(Pt 3):715–9.10.1099/0022-1317-72-3-715
12
DonofrioGCaviraniSSimoneTVan SantenVL. Potential of bovine herpesvirus 4 as a gene delivery vector. J Virol Methods (2002) 101:49–61.10.1016/S0166-0934(01)00419-0
13
DonofrioGSartoriCRavanettiLCaviraniSGilletLVanderplasschenAet alEstablishment of a bovine herpesvirus 4 based vector expressing a secreted form of the bovine viral diarrhoea virus structural glycoprotein E2 for immunization purposes. BMC Biotechnol (2007) 7:68.10.1186/1472-6750-7-68
14
DonofrioGSartoriCFranceschiVCapocefaloACaviraniSTaddeiSet alDouble immunization strategy with a BoHV-4-vectorialized secreted chimeric peptide BVDV-E2/BoHV-1-gD. Vaccine (2008) 26:6031–42.10.1016/j.vaccine.2008.09.023
15
DonofrioGFranceschiVCapocefaloATaddeiSSartoriCBonominiSet alCellular targeting of engineered heterologous antigens is a determinant factor for bovine herpesvirus 4-based vaccine vector development. Clin Vaccine Immunol (2009) 16:1675–86.10.1128/CVI.00224-09
16
FranceschiVCapocefaloACalvo-PinillaERedaelliMMucignat-CarettaCMertensPet alImmunization of knock-out alpha/beta interferon receptor mice against lethal bluetongue infection with a BoHV-4-based vector expressing BTV-8 VP2 antigen. Vaccine (2011) 29:3074–82.10.1016/j.vaccine.2011.01.075
17
RedaelliMFranceschiVCapocefaloAD’avellaDDenaroLCaviraniSet alHerpes simplex virus type 1 thymidine kinase-armed bovine herpesvirus type 4-based vector displays enhanced oncolytic properties in immunocompetent orthotopic syngenic mouse and rat glioma models. Neuro Oncol (2012) 14:288–301.10.1093/neuonc/nor219
18
DonofrioGFranceschiVLoveroACapocefaloACameroMLosurdoMet alClinical protection of goats against CpHV-1 induced genital disease with a BoHV-4-based vector expressing CpHV-1 gD. PLoS One (2013) 8:e52758.10.1371/journal.pone.0052758
19
FranceschiVParkerSJaccaSCrumpRWDoroninKHembradorEet alBoHV-4-based vector single heterologous antigen delivery protects STAT1(-/-) mice from monkeypoxvirus lethal challenge. PLoS Negl Trop Dis (2015) 9:e0003850.10.1371/journal.pntd.0003850
20
JaccaSRolihVQuaglinoEFranceschiVTebaldiGBolliEet alBovine herpesvirus 4-based vector delivering a hybrid rat/human HER-2 oncoantigen efficiently protects mice from autochthonous Her-2+ mammary cancer. Oncoimmunology (2016) 5:e1082705.10.1080/2162402X.2015.1082705
21
DonofrioGMartignaniEPoliELangeCMartiniFMCaviraniSet alBovine herpesvirus 4 based vector interaction with liver cells in vitro and in vivo. J Virol Methods (2006) 136:126–36.10.1016/j.jviromet.2006.04.008
22
DonofrioGTaddeiSFranceschiVCapocefaloACaviraniSMartinelliNet alSwine adipose stromal cells loaded with recombinant bovine herpesvirus 4 virions expressing a foreign antigen induce potent humoral immune responses in pigs. Vaccine (2011) 29:867–72.10.1016/j.vaccine.2010.11.048
23
SekiFOnoNYamaguchiRYanagiY. Efficient isolation of wild strains of canine distemper virus in Vero cells expressing canine SLAM (CD150) and their adaptability to marmoset B95a cells. J Virol (2003) 77:9943–50.10.1128/JVI.77.18.9943-9950.2003
24
RojasJMRodriguez-CalvoTPenaLSevillaN. T cell responses to bluetongue virus are directed against multiple and identical CD4+ and CD8+ T cell epitopes from the VP7 core protein in mouse and sheep. Vaccine (2011) 29:6848–57.10.1016/j.vaccine.2011.07.061
25
RojasJMMorenoHGarciaARamirezJCSevillaNMartinV. Two replication-defective adenoviral vaccine vectors for the induction of immune responses to PPRV. Vaccine (2014) 32:393–400.10.1016/j.vaccine.2013.11.033
26
WarmingSCostantinoNCourtDLJenkinsNACopelandNG. Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res (2005) 33:e36.10.1093/nar/gni035
27
DonofrioGCavaggioniABondiMCaviraniSFlamminiCFMucignat-CarettaC. Outcome of bovine herpesvirus 4 infection following direct viral injection in the lateral ventricle of the mouse brain. Microbes Infect (2006) 8:898–904.10.1016/j.micinf.2005.10.016
28
RojasJMPenaLMartinVSevillaN. Ovine and murine T cell epitopes from the non-structural protein 1 (NS1) of bluetongue virus serotype 8 (BTV-8) are shared among viral serotypes. Vet Res (2014) 45:30.10.1186/1297-9716-45-30
29
RojasJMAviaMPascualESevillaNMartinV. Vaccination with recombinant adenovirus expressing peste des petits ruminants virus-F or -H proteins elicits T cell responses to epitopes that arises during PPRV infection. Vet Res (2017) 48:79.10.1186/s13567-017-0482-x
30
RojasJMSpadaRSanz-OrtegaLMorillasLMejiasRMulens-AriasVet alPI3K p85 beta regulatory subunit deficiency does not affect NK cell differentiation and increases NKG2D-mediated activation. J Leukoc Biol (2016) 100:1285–96.10.1189/jlb.1A1215-541RR
31
BarrettTBelshamGJSubbaraoSMEvansSA. Immunization with a vaccinia recombinant expressing the F protein protects rabbits from challenge with a lethal dose of rinderpest virus. Virology (1989) 170:11–8.10.1016/0042-6822(89)90346-2
32
CharanJKanthariaND. How to calculate sample size in animal studies?J Pharmacol Pharmacother (2013) 4:303–6.10.4103/0976-500X.119726
33
MarshTLYoderJDebochTMcelwainTFPalmerGH. Livestock vaccinations translate into increased human capital and school attendance by girls. Sci Adv (2016) 2:e1601410.10.1126/sciadv.1601410
34
DialloAMinetCLe GoffCBerheGAlbinaELibeauGet alThe threat of peste des petits ruminants: progress in vaccine development for disease control. Vaccine (2007) 25:5591–7.10.1016/j.vaccine.2007.02.013
35
AhrensUKadenVDrexlerCVisserN. Efficacy of the classical swine fever (CSF) marker vaccine porcilis pesti in pregnant sows. Vet Microbiol (2000) 77:83–97.10.1016/S0378-1135(00)00265-0
36
De SmitAJBoumaADe KluijverEPTerpstraCMoormannRJ. Duration of the protection of an E2 subunit marker vaccine against classical swine fever after a single vaccination. Vet Microbiol (2001) 78:307–17.10.1016/S0378-1135(00)00306-0
37
CapuaITerreginoCCattoliGMutinelliFRodriguezJF. Development of a DIVA (differentiating infected from vaccinated animals) strategy using a vaccine containing a heterologous neuraminidase for the control of avian influenza. Avian Pathol (2003) 32:47–55.10.1080/0307945021000070714
38
LangedijkJPDausFJVan OirschotJT. Sequence and structure alignment of Paramyxoviridae attachment proteins and discovery of enzymatic activity for a morbillivirus hemagglutinin. J Virol (1997) 71:6155–67.
39
FrazierKSBaldwinCAPenceMWestJBernardJLiggettAet alSeroprevalence and comparison of isolates of endometriotropic bovine herpesvirus-4. J Vet Diagn Invest (2002) 14:457–62.10.1177/104063870201400602
40
MongeAElviraLGonzalezJVAstizSWellenbergGJ. Bovine herpesvirus 4-associated postpartum metritis in a Spanish dairy herd. Res Vet Sci (2006) 80:120–5.10.1016/j.rvsc.2005.04.001
41
DonofrioGRavanettiLCaviraniSHerathSCapocefaloASheldonIM. Bacterial infection of endometrial stromal cells influences bovine herpesvirus 4 immediate early gene activation: a new insight into bacterial and viral interaction for uterine disease. Reproduction (2008) 136:361–6.10.1530/REP-08-0171
42
DonofrioGCapocefaloAFranceschiVPriceSCaviraniSSheldonIM. The chemokine IL8 is up-regulated in bovine endometrial stromal cells by the BoHV-4 IE2 gene product, ORF50/Rta: a step ahead toward a mechanism for BoHV-4 induced endometritis. Biol Reprod (2010) 83:919–28.10.1095/biolreprod.110.086074
43
JaccaSFranceschiVColagiorgiASheldonMDonofrioG. Bovine endometrial stromal cells support tumor necrosis factor alpha-induced bovine herpesvirus type 4 enhanced replication. Biol Reprod (2013) 88:135.10.1095/biolreprod.112.106740
44
FranceschiVStellariFFMangiaCJaccaSLavrentiadouSCaviraniSet alIn vivo image analysis of BoHV-4-based vector in mice. PLoS One (2014) 9:e95779.10.1371/journal.pone.0095779
45
PuppoACesiGMarroccoEPiccoloPJaccaSShayakhmetovDMet alRetinal transduction profiles by high-capacity viral vectors. Gene Ther (2014) 21:855–65.10.1038/gt.2014.57
46
MongkolsapayaJJayeACallanMFMagnusenAFMcmichaelAJWhittleHC. Antigen-specific expansion of cytotoxic T lymphocytes in acute measles virus infection. J Virol (1999) 73:67–71.
47
De VriesRDYukselSOsterhausADDe SwartRL. Specific CD8(+) T-lymphocytes control dissemination of measles virus. Eur J Immunol (2010) 40:388–95.10.1002/eji.200939949
48
LundBTTiwariAGalbraithSBaronMDMorrisonWIBarrettT. Vaccination of cattle with attenuated rinderpest virus stimulates CD4(+) T cell responses with broad viral antigen specificity. J Gen Virol (2000) 81:2137–46.10.1099/0022-1317-81-9-2137
49
GansHAYasukawaLLSungPSullivanBDehovitzRAudetSet alMeasles humoral and cell-mediated immunity in children aged 5-10 years after primary measles immunization administered at 6 or 9 months of age. J Infect Dis (2013) 207:574–82.10.1093/infdis/jis719
50
DialloAMinetCBerheGLe GoffCBlackDNFlemingMet alGoat immune response to capripox vaccine expressing the hemagglutinin protein of peste des petits ruminants. Ann N Y Acad Sci (2002) 969:88–91.10.1111/j.1749-6632.2002.tb04356.x
51
BerheGMinetCLe GoffCBarrettTNgangnouAGrilletCet alDevelopment of a dual recombinant vaccine to protect small ruminants against peste-des-petits-ruminants virus and capripoxvirus infections. J Virol (2003) 77:1571–7.10.1128/JVI.77.2.1571-1577.2003
52
JonesLGiavedoniLSalikiJTBrownCMebusCYilmaT. Protection of goats against peste des petits ruminants with a vaccinia virus double recombinant expressing the F and H genes of rinderpest virus. Vaccine (1993) 11:961–4.10.1016/0264-410X(93)90386-C
53
SaravananPSenABalamuruganVRajakKKBhanuprakashVPalaniswamiKSet alComparative efficacy of peste des petits ruminants (PPR) vaccines. Biologicals (2010) 38:479–85.10.1016/j.biologicals.2010.02.003
Summary
Keywords
BoHV-4, PPRV, DIVA vaccines, H antigen, viral vaccines
Citation
Macchi F, Rojas JM, Verna AE, Sevilla N, Franceschi V, Tebaldi G, Cavirani S, Martín V and Donofrio G (2018) Bovine Herpesvirus-4-Based Vector Delivering Peste des Petits Ruminants Virus Hemagglutinin ORF Induces both Neutralizing Antibodies and Cytotoxic T Cell Responses. Front. Immunol. 9:421. doi: 10.3389/fimmu.2018.00421
Received
11 January 2018
Accepted
15 February 2018
Published
05 March 2018
Volume
9 - 2018
Edited by
Fabrizio Ceciliani, Università degli Studi di Milano, Italy
Reviewed by
Simon Paul Graham, Pirbright Institute (BBSRC), United Kingdom; Martin Faldyna, Veterinary Research Institute (VRI), Czechia
Updates
Copyright
© 2018 Macchi, Rojas, Verna, Sevilla, Franceschi, Tebaldi, Cavirani, Martín and Donofrio.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Gaetano Donofrio, gaetano.donofrio@unipr.it
Specialty section: This article was submitted to Comparative Immunology, a section of the journal Frontiers in Immunology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.