Skip to main content

CORRECTION article

Front. Immunol., 02 December 2019
Sec. Comparative Immunology
Volume 10 - 2019 | https://doi.org/10.3389/fimmu.2019.02720

Corrigendum: RNAseq Profiling of Leukocyte Populations in Zebrafish Larvae Reveals a cxcl11 Chemokine Gene as a Marker of Macrophage Polarization During Mycobacterial Infection

This article is a correction to:

  1. RNAseq Profiling of Leukocyte Populations in Zebrafish Larvae Reveals a cxcl11 Chemokine Gene as a Marker of Macrophage Polarization During Mycobacterial Infection

    1. Read original article
\nJulien RougeotJulien Rougeot1Vincenzo TorracaVincenzo Torraca1Ania ZakrzewskaAnia Zakrzewska1Zakia KanwalZakia Kanwal1Hans J. JansenHans J. Jansen2Frida SommerFrida Sommer1Herman P. SpainkHerman P. Spaink1Annemarie H. Meijer Annemarie H. Meijer1*
  • 1Institute of Biology Leiden, Leiden University, Leiden, Netherlands
  • 2ZF-screens B. V., Leiden, Netherlands

A Corrigendum on
RNAseq Profiling of Leukocyte Populations in Zebrafish Larvae Reveals a cxcl11 Chemokine Gene as a Marker of Macrophage Polarization During Mycobacterial Infection

by Rougeot, J., Torraca, V., Zakrzewska, A., Kanwal, Z., Jansen, H. J., Sommer, F., et al. (2019). Front. Immunol. 10:832. doi: 10.3389/fimmu.2019.00832

In the original article, there was an omission. The “Data Availability Statement” section was absent in the edited manuscript.

The Data Availability Statement has now been added to the published article:

“The sequencing data for infected samples have been submitted to the NCBI Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE68920. The sequencing data for uninfected samples were made previously available under accession number GSE78954. The sequencing data for human macrophages are available under the accession number GSE36952.”

In the “Materials and Methods” section, “RNA Isolation, Illumina Sequencing, and Real time PCRs” subsection, the sequences of the primers ccr5(ccr12b.2)Fw and ccr5Rv were erroneous. The correct sequences are ccr5(ccr12b.2)Fw: GGCTTCCAACATCATCTTCACCCTCAC; ccr5Rv: CTATCATCCGAGTGCGCATGATGG.

The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.

Keywords: innate immunity, zebrafish, RNAseq, macrophage, mycobacteria, neutrophil, lymphoid progenitor cells

Citation: Rougeot J, Torraca V, Zakrzewska A, Kanwal Z, Jansen HJ, Sommer F, Spaink HP and Meijer AH (2019) Corrigendum: RNAseq Profiling of Leukocyte Populations in Zebrafish Larvae Reveals a cxcl11 Chemokine Gene as a Marker of Macrophage Polarization During Mycobacterial Infection. Front. Immunol. 10:2720. doi: 10.3389/fimmu.2019.02720

Received: 03 October 2019; Accepted: 06 November 2019;
Published: 02 December 2019.

Edited and reviewed by: Tiehui Wang, University of Aberdeen, United Kingdom

Copyright © 2019 Rougeot, Torraca, Zakrzewska, Kanwal, Jansen, Sommer, Spaink and Meijer. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Annemarie H. Meijer, a.h.meijer@biology.leidenuniv.nl

Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.