Abstract
As a burgeoning non-invasive indicator for reproducible cancer diagnosis, tumor-related biomarkers have a wide range of applications in early cancer screening, efficacy monitoring, and prognosis predicting. Accurate and efficient biomarker determination, therefore, is of great importance to prevent cancer progression at an early stage, thus reducing the disease burden on the entire population, and facilitating advanced therapies for cancer. During the last few years, various DNA structure-based fluorescent probes have established a versatile platform for biological measurements, due to their inherent biocompatibility, excellent capacity to recognize nucleic and non-nucleic acid targets, obvious accessibility to synthesis as well as chemical modification, and the ease of interfacing with signal amplification protocols. After decades of research, DNA fluorescent probe technology for detecting tumor-related mRNAs has gradually grown to maturity, especially the advent of fluorescent nanoprobes has taken the process to a new level. Here, a systematic introduction to recent trends and advances focusing on various nanomaterials-related DNA fluorescent probes and the physicochemical properties of various involved nanomaterials (such as AuNP, GO, MnO2, SiO2, AuNR, etc.) are also presented in detail. Further, the strengths and weaknesses of existing probes were described and their progress in the detection of tumor-related mRNAs was illustrated. Also, the salient challenges were discussed later, with a few potential solutions.
Introduction
Cancer is a complex disease characterized by neoplastic proliferation, atypia, and metastasis, holding high mortality all over the world (; ; ). It is hard to diagnose cancer at an early stage, and there are limited treatment options and no effective drugs for advanced cancer, thus cancer mortality rate remains high. As an important tumor indicator for the early diagnosis of cancer, accurate detection of tumor biomarkers is capable of increasing the diagnosis rate, and then reducing cancer mortalit (). Tumor biomarkers are usually present in the tumor tissue or serum of cancer patients, containing a variety of molecules, such as DNA, mRNA, transcription factors, enzymes, metabolites, and cell surface receptors () (Figure 1). As a tumor biomarker, RNA possesses diagnostic value, prognostic value, and predictive value in the field of oncology, which can not only provide early diagnosis of tumors, treatment risk assessment, and prediction of treatment response, but also can be used as a potential target for drug design, therefore, it is of great significance for the detection of RNA (; ). This review mainly introduces the detection of various mRNA by DNA-based fluorescent probes, such as TKI mRNA, hTR, surviving mRNA, MicroRNA, p21 mRNA, etc, (Table 1).
FIGURE 1
TABLE 1
| RNA type | Disease | Sequence (5′-3′) | Reference |
|---|---|---|---|
| TK1 mRNA | Most cancers | TGATCAAGTATGCCAAAGACACTCGCTACA | |
| p21 mRNA | Most cancers | UCGGCUCCCCAUGUGUCCU | |
| p53 mRNA | Most cancers | GCUUUGAGGUGCGUGUUUGUGC | |
| c-myc mRNA | Most cancers | CCUCAACGUUAGCUUCACCAA | |
| VEGF mRNA | Tumor and vascular proliferative diseases | CAUCACCAUGCAGAUUAUGCG | |
| MicroRNAs | numerous solid tumors cardiovascular and autoimmune diseases | TAGCTTATCAGACTGATGTTGA | |
| hTR | Most cancers | TTTTGTCTAACCCTAACTGAGAAG | |
| surviving mRNA | breast cancer | CAGCCCTTTCTCAA | |
| Cyclin D1 mRNA | breast cancer | ATCTACACCGACAACTC |
The relationship between RNA type and diseases.
Cells contain a variety of biomolecules and a number of complex structures that make up the complexity of the cell (). As the complex intracellular environment may lead to feeble output and erroneous signals, the detection of these biological small molecules remains challenging (). Molecular biology, microarray analysis (), real-time polymerase chain reaction (RT-PCR) () and Northern hybridization () are the most commonly used techniques in vitro assays for mRNA detection, which have wide detection limits and high accuracy, yet existing shortcomings such as complex operation and time-consuming. For example, RT-PCR requires professional training to design primers in order to avoid the production of false positive signals. The ability of DNA-based fluorescent probes to identify nucleic acid, non-nucleic acid targets, easy synthesis, and chemical modification has attracted growing attention (). Molecular beacon is the most common DNA fluorescent probe, which is simple, fast, and sensitive to achieve the detection of biological small molecules in the cell lysate, whereas it is difficult to enter the cell to achieve in situ detection of intracellular biological small molecules. In addition, due to the complex environment in the cell, even if it enters the cell with the help of transfection reagent, DNase I can cut off single-stranded and double-stranded DNA, resulting in the generation of false positive signals (). Therefore, it is crucial to develop a probe that can stably in situ detect target inside cells.
For the purposed of avoiding false positive signals caused by the complex intracellular environment, nanomaterials emerge in the vision. As a result of the protective effect of nanomaterials on nucleic acid sequences, they are capable of maintaining stability in the complex intracellular environment (). In addition, when the DNA probe is connected to the surface of the nanomaterial, it can enter the cell with the help of endocytosis. Compared with the nucleic acid sequence probe alone, it has been greatly improved, not only protecting the probe but also allowing stable entry into the cell without the help of transfection reagents to achieve in situ detection in the cell. Furthermore, with the rapid emergence of nanotechnology, nanostructures have been widely used for reliable and robust signal amplification, improving the sensitivity of biosensors and producing higher precision. Recently, various nanomaterials including AuNP (), GO (), AuNR (), MnO2 (), ZnO (), SiO2 (Zheng et al., 2017), and UCNP () have been used for in situ detection of intracellular mRNA (Table 2). The diversity of nanoprobes is constituted of nanomaterials possessing unique physical and chemical properties, whose application has highly innovated the traditional nucleic acid probe and pushed the study of DNA fluorescent probes to a climax. Apart from nucleic acid nanoprobes for in situ detection of intracellular tumor-related RNA, the electrochemical probes with the help of nanomaterials have also been greatly developed, which greatly improves the sensitivity of probes, making ultra-trace detection of tumor-related RNA a reality (Zhang et al., 2015; ). However, the electrochemical probes are usually used for detection of biological small molecules in vitro, and there are few reports of in situ detection of biological small molecules in cells. It remains a problem that researchers need to overcome. Therefore, this highly sensitive electrochemical probe to the in situ detection of cells still need to be explored, which will be a huge improvement for the detection of traces amount of tumor biomolecules.
TABLE 2
| Materials | Detection limit | Mechanism | Stability in cell | Cell in situ detection | Sample | Excitation/Emission |
|---|---|---|---|---|---|---|
| Molecular Beacon (Ratajczak et al. (2018) | 26 nM | ![]() | Poor | yes | survivin mRNA | 520 nm/548 nm |
| Electrochemiluminescence (Zhang et al. (2015)) | 0.83 fM | ![]() | / | / | miRNA-21 | / |
| AuNPs modified nucleic acid sequence () | not reported | ![]() | Excellent | yes | TK1 mRNA | 488 nm/520 and 580 nm |
| GO modified nucleic acid sequence () | 0.26 nM | ![]() | Excellent | yes | C-myc mRNA | 550, 488, and 648 nm/570, 520, and 670 nm |
| 1.04 nM | TK1 mRNA | |||||
| 1.15 nM | Actin mRNA | |||||
| rGO modified nucleic acid sequence () | 0.46 nM | ![]() | Excellent | yes | p21 mRNA | 488 and 633 nm/520 and 660 nm |
| 0.71 nM | p53 mRNA | |||||
| MnO2 modified nucleic acid sequence () | 1 nM | ![]() | Excellent | yes | TK1 mRNA | 488 nm/520 and 580 nm |
| AuNR modified nucleic acid sequence () | 0.011 amol/ngRNA | ![]() | Excellent | yes | miRNA-21 | / |
| SiO2 modified nucleic acid sequence () | 1.3 nM | ![]() | Excellent | yes | survivin mRNA | 545 nm/580 nm |
| ZnO modified nucleic acid sequence () | 1 fM | ![]() | Excellent | yes | survivin mRNA | 488 nm/526 nm |
| UCNP modified nucleic acid sequence () | 1.1 nM | ![]() | Excellent | yes | TK1 mRNA | 540 nm/655 nm |
| QD modified nucleic acid sequence () | 5.5 nM | ![]() | Excellent | yes | survivin mRNA | 405 nm/670 and 720 nm |
Different types of DNA-based fluorescent probes.
Due to unique physical and chemical properties, some nanomaterials can realize the integration of detection and treatment. For example, AuNP possesses excellent thermal conductivity that laser irradiation leads to the rise of temperature and then heats tumor cells to death, which is utilized for photothermal therapy (Zhang et al., 2019). SiO2 is used in chemotherapy because of its unique pores with good drug loading efficiency and drug protection ability (). It has been reported that using the drug loading characteristics of G and C bases to carry drugs, drug molecules can be inserted into the G and C base pairs and quench the fluorescence of the drug (). When the nanoprobe enters the cell, the hydrogen bond between G and C is opened to realize the release of drugs and the integration of in situ detection and chemotherapy. This review provides a systematic introduction to the development of DNA fluorescent probes and the principles of nanoprobe design.
DNA-based fluorescent probes
Molecular beacons
Molecular Beacon (MB) is a new type of DNA fluorescent probe developed by Tyagi and Kramer in 1996 (Figure 10A) (), which is a hairpin structure formed by DNA, composed of stem and loop. Usually, the loop portion of the MB is the complementary sequence of the detection target for specific recognition, and the stem of the DNA mainly plays a fixed role to ensure the stability of the MB. In the absence of the target, the MB is present in a hairpin conformation, at which point the fluorophore and the quenching group are close to each other, and the fluorescence of the fluorophore is quenched due to the action of fluorescence resonance energy transfer (FRET). When the MB binds to the target, the loop portion of the MB and target form a more stable double chain than the stem, which leads to the structural recombination of the MB hairpin. At this time, the loop is opened, whereas the stem quenching group and the fluorophore are separated, then the fluorescence is restored (). MB was first exploited for the detection of small biological molecules of RNA in vitro, and then it was used in cells to realize the in situ detection of biological small molecules gradually. It is difficult for MB alone to enter the cell, resulting from absorbance on the cell surface. Consequently, through microinjection or transfection reagent, the researchers can make MB enter the cells smoothly to realize the localization and quantitative detection of small biological molecules in the cells. Gewirtz et al. used microinjection technology to inject MB into cells to realize in situ analysis of intracellular biological small molecules (). The difficult operation of microinjection technology requires professional operation, limiting its universal practicality. Li’s group used Lipofectamine® 2000 to transfect MB into cells for detection in situ (). With transfection reagent accessible to acquire, Li’s method greatly reduces the complexity of the operation and improves universal practicality compared with microinjection. Although MB provides a powerful tool for detection and cell imaging, non-specific separation of fluorophores and quenchers often leads to false positive signals due to the degradation of DNase I (). To overcome the generation of these false positive signals, the researchers improved MB to ensure its stable presence inside cells. Seo et al. developed a novel MB that uses spherical graphite nanoparticles as fluorescent quenchers, and the presence of spherical graphite nanoparticles enhances the biological stability of the MB and the ability to transfect cells, enabling real-time detection and quantification of surviving mRNA in MCF-7 cell (). To improve the efficiency of probe entry into the cell and the stability of the intracellular environment, Shen’s group optimized CLDN18.2 MB by applying phosphorothioate and 2′-O-methyl methods to achieve in situ intracellular detection of CLDN18.2 RNA (Figure 2) (). These improvements greatly enhanced the ability of MB to enter cells and the stability of the intracellular environment, making molecular beacons a reality for accurate in situ detection of tumor-associated intracellular RNA.
FIGURE 2
Other than conventional MB, dual-color MB has also attracted more and more attention. It is universally acknowledged that the proportion recognition of the human eye to two mixed colors is much higher than the recognition of a single color. A single color can only be distinguished by the brightness of the color, while the ratiometric color of two mixed colors can be recognized directly by the color difference (
Electrochemiluminescence
The development of nanomaterial-based nucleic acid detection systems has taken fluorescent probes to a new level. In certain cases, it may have favorable characteristics which make it attractive for a wide range of applications. At present, the detection of biological small molecules faces many challenges, such as low content and more interference, thus an electrochemical-based detection method was established. Electrochemiluminescence (ECL) has garnered rising interest in the detection of DNA and miRNA due to the unique properties of minimal background signal, easy optical setup, and high sensitivity. (
FIGURE 3

Working mechanism of electrochemiluminescent graphene quantum dots sensing platform for the detection of miRNA-21 (Zhang et al., 2015). Copyright 2015 American Chemical Society.
AuNP-based nanoprobes
Gold nanoparticles (AuNP) was synthesized by Michael Faraday more than 150 years ago, possessing a long history in the field of chemical research (
Mrikin’s group proposed nanoFlare in 2007 (Figure 4A) (
FIGURE 4

(A) NanoFlare and (B) StickFlare (Zhao et al., 2021) for tumor-related RNA detection. Copyright 2021 The Royal Society of Chemistry.
Aside from stickyFlares and nanoFlare, a number of AuNP-based molecular beacon probes have also been designed. Qiao et al. developed an AuNP-based dual-color molecular beacon probe that simultaneously performs in situ detection of surviving mRNA and cyclin D1 mRNA in breast cancer cells (Figure 10D) (
FIGURE 5

(A) Working mechanism of TK1 mRNA detection based on FRET nanoFlare. (B)In situ ratiometric imaging of TK1 mRNA in HepG2 cell, L02 cell and MCF-7 cell by FRET nanoFlare (
GO-based nanoprobes
The question of the existence of graphene has puzzled researchers for many years (
FIGURE 6

(A) Working mechanism of GO-based nanoprobe detection. (B) The GO-based nanoprobe simultaneously imaging detection of three mRNAs in cells. (
MnO2-based nanoprobes
In recent years, the increasing importance has been attached to MnO2 nanosheet for the detection of small biological molecules because of their unique physical and chemical properties: (Zhai et al., 2014; Zhao et al., 2014). 1) MnO2 nanosheet is a nanomaterial with a flake structure, which has a wide absorption peak between 300 and 600 nm and has a strong quenching effect on the fluorescence of this range. 2) MnO2 nanosheet can adsorb single stranded DNA by synergistic physical adsorption. 3) MnO2 nanosheet has good biocompatibility and is used as a vector to carry DNA through the cell membrane into the cell. 4) MnO2 nanosheet can be reduced to Mn2+ by intracellular glutathione (GSH) (
FIGURE 7

(A) Schematic diagram of the construction of MnO2@PEI-IAA nanodevice. (B) MnO2@PEI-IAA is used for cascaded signal-amplified FL imaging of miRNA-21 and MR imaging-guided therapeutics for GSH activation (
SiO2-based nanoprobes
The size of silicon dioxide (SiO2) is generally in the range of 50–200 nm. Due to its high drug loading and inert structure, it allows the encapsulated drugs to remain high stability in cells, which has captured much more attention (
FIGURE 8

Working mechanism of Ru-SiO2@ polydopamine nanoplatform for MicroRNA detection in cells (
AuNR-based nanoprobes
Gold nanorods (AuNR) is a kind of gold nanomaterials ranging in size from a few nanometers to hundreds of nanometers, which possesses excellent properties such as surface plasma resonance and thermogenesis performance, consequently, it is widely used in biosensors and photothermal treatment of tumors (
FIGURE 9

(A) Schematic illustrations of “OFF-enhanced ON” fluorescent switch system for specific detection of miR-21 in cancer cells. (B) Schematic illustrations of probe assembly and detection (
Other nanoprobes
In addition to several nanoprobes mentioned above, many nanomaterials have been successfully utilized for the detection of tumor-related RNA. Li et al. developed a ZnO@polydopamine-nucleic acid nanosystem for the detection of surviving mRNA (Figure 10I) (
FIGURE 10

DNA fluorescent probe for tumor-related imaging in living cells. (A) Molecular beacon (
Challenges and future outlook
Over the past few decades, more and more researchers in the field of biomolecular diagnostics have used nanomaterials to detect tumor biomarkers. Compared to traditional technologies, nanoprobes can meet the needs such as practicality, high sensitivity, and high selective test. Nevertheless, it still faces numerous challenges, such as the design of the probe, stability, sensitivity, specificity, cell cytotoxicity, fluorescence selection, cell permeability, application in vivo, etc. The above problems will be discussed below and a few potential solutions will be proposed.
Probe design and its stability
DNA-based fluorescent probes form a common platform for biometrics due to the identification of nucleic acid and non-nucleic acid targets, ease of synthesis and chemical modification, ease of interfacing with signal amplification protocols, and inherent biocompatibility (
Sensitivity and specificity of the probe
During the design of probe, the key consideration is its specificity to the target, and poor specificity of probe will cause false positive results. After the design completed, it is of necessity to select analytes similar to the target for the control experiment to assure the fine specificity. For example, when the target is mRNA, sequences with a single mismatch, two mismatches, or three mismatches with the target are often used as controls to evaluate the specificity of the probe. In addition to the good specificity of the probe, the sensitivity plays another essential role. With poor sensitivity, it is hard to report the trace amount of the target, which puts constraints on the scope of application of the probe. Therefore, some detection methods of signal amplification have been studied, such as rolling circle amplification (RCA) (Zhang et al., 2014), strand displacement amplification (SDA (
Cytotoxicity and choice of probe fluorescence
The cytotoxicity of the probe is a prerequisite for whether the probe can be used for cell in situ detection. The toxicity of the probe should be guaranteed to be very weak, because it may cause irreversible damage to the cells if it is used in situ detection. Even if the toxicity of the probe is very weak, the metabolic problems of the probe should be considered. If all or part of the probe cannot be metabolically discharged from the cells, long-term accumulation may cause further damage to the cells. As a result, while designing, micro nanomaterials are optional carriers, because of easier metabolism and excretion. The potential solution to this problem is to use a probe, that is, less toxic and metabolizable or to use a probe with a lower concentration for a shorter period. When selecting fluorescent dyes, the influence of the intracellular environment on fluorescence should be pondered. For example, some fluorescein may be difficult to exist stably in the low pH environment of lysosome or interact with other molecules in cells to affect the detection results. Therefore, when choosing fluorescein, fluorescein with high fluorescence efficiency and good stability may be more suitable for complex environments in some cells.
Intake of probes
As a natural barrier, the cell membrane can prevent foreign bodies from entering cells and forms a self-protection system. Single nucleic acid probe, such as MB, is inherently difficult to enter the cell. With being brought into the cell through microinjection (
Application of probe in vivo
The application of nanoprobes in vivo takes more factors into account than in the application of cells. First of all, after entering the bloodstream through intravenous nanoprobes, it is necessary to successfully avoid the immune system, so as not to be cleared by the immune system before reaching the designated site. Second, the nanoprobe is also required to remain stable during circulation, because the complex environment in the blood may bring about degradation of the probe. Finally, the nanoprobes can accumulate at the target site, resulting in the obvious signal (
FIGURE 11

Application of fluorescent nano probe in the detection of tumor related mRNA in vivo(A-i) Mechanistic diagram of fluorescence (FL) imaging and PA imaging in vivo. (A-ii) Whole-body FL images of MCF-7 tumor-bearing mice injected with AuNR-PEI/FIRE or AuNR-PEI/ran-FIRE. (A-iii) PA image of tumor-bearing mice after injection with AuNR-PEI (
Conclusion
Early diagnosis is the successful detection of tumors before the tumor spreads and becomes incurable, which has attracted a large number of researchers for many years. This review mainly introduces some methods for the detection of tumor-related RNA in recent years, listing several representative examples of DNA-based fluorescent probes and illustrating their advantages and challenges in the detection of tumor-related RNA. The current cancer diagnosis technology, particularly the detection technology of tumor-related RNA, still requires further research and innovation. In the past decade, the research and development of new probes have been the focus of attention, and the detection technology of tumor-related RNA in living cells is relatively mature. Each probe has its unique advantages and disadvantages. In the next research, it is hoped that researchers will pay more attention to the application of probes in practical clinical application rather than just in situ detection in cells.
Statements
Author contributions
All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.
Funding
This work was supported by National Natural Science Foundation of China (No. 21703255), Anhui Province Science Fund for Outstanding Young Scholars (2208085Y27), Scientific Research Foundation for the Returned Overseas Chinese Scholars, Anhui Province-Key Projects (2021LCX003), Excellent Young Talents Fund Program of Higher Education Institutions of Anhui Province (gxyqZD2021102), Research Fund of Anhui Institute of Translational Medicine (2021zhyx-C17), Research Fund for the Doctoral Program of Anhui Medical University (XJ201808), Natural Science Foundation of Anhui Province (1708085MB35), and Research Fund for Scientific Research Level Improvement Plan of Anhui Medical University (2020xkjT001).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
Alvarez-BreckenridgeC.KaurB.ChioccaE. A. (2009). Pharmacologic and chemical adjuvants in tumor virotherapy. Chem. Rev.109 (7), 3125–3140. 10.1021/cr900048k
2
BaiS.XuB.GuoY.QiuJ.YuW.XieG. (2018). High-discrimination factor nanosensor based on tetrahedral DNA nanostructures and gold nanoparticles for detection of miRNA-21 in live cells. Theranostics8 (9), 2424–2434. 10.7150/thno.23852
3
BaoG.RheeW. J.TsourkasA. (2009). Fluorescent probes for live-cell RNA detection. Annu. Rev. Biomed. Eng.11, 25–47. 10.1146/annurev-bioeng-061008-124920
4
BrileyW. E.BondyM. H.RanderiaP. S.DupperT. J.MirkinC. A. (2015). Quantification and real-time tracking of RNA in live cells using sticky-flares. Proc. Natl. Acad. Sci. U. S. A.112 (31), 9591–9595. 10.1073/pnas.1510581112
5
BrownD.ConwayD. I.McMahonA. D.DundasR.LeylandA. H. (2021). Cancer mortality 1981-2016 and contribution of specific cancers to current socioeconomic inequalities in all cancer mortality: A population-based study. Cancer Epidemiol.74, 102010. 10.1016/j.canep.2021.102010
6
ChenA. K.BehlkeM. A.TsourkasA. (2007). Avoiding false-positive signals with nuclease-vulnerable molecular beacons in single living cells. Nucleic Acids Res.35 (16), e105. 10.1093/nar/gkm593
7
ChenA.MaS.ZhuoY.ChaiY.YuanR. (2016). In situ electrochemical generation of electrochemiluminescent silver naonoclusters on target-cycling synchronized rolling circle amplification platform for MicroRNA detection. Anal. Chem.88 (6), 3203–3210. 10.1021/acs.analchem.5b04578
8
ChenH. H.HoY. P.JiangX.MaoH. Q.WangT. H.LeongK. W. (2009). Simultaneous non-invasive analysis of DNA condensation and stability by two-step QD-FRET. Nano Today4 (2), 125–134. 10.1016/j.nantod.2009.02.008
9
ChithraniB. D.GhazaniA. A.ChanW. C. (2006). Determining the size and shape dependence of gold nanoparticle uptake into mammalian cells. Nano Lett.6 (4), 662–668. 10.1021/nl052396o
10
ChoiC. H.HaoL.NarayanS. P.AuyeungE.MirkinC. A. (2013). Mechanism for the endocytosis of spherical nucleic acid nanoparticle conjugates. Proc. Natl. Acad. Sci. U. S. A.110 (19), 7625–7630. 10.1073/pnas.1305804110
11
ClarkT. A.SugnetC. W.AresM.Jr. (2002). Genomewide analysis of mRNA processing in yeast using splicing-specific microarrays. Science296 (5569), 907–910. 10.1126/science.1069415
12
DalbyB.CatesS.HarrisA.OhkiE. C.TilkinsM. L.PriceP. J.et al (2004). Advanced transfection with lipofectamine 2000 reagent: Primary neurons, siRNA, and high-throughput applications. Methods33 (2), 95–103. 10.1016/j.ymeth.2003.11.023
13
DangW.LiuH.FanJ.ZhaoC.LongY.TongC.et al (2019). Monitoring VEGF mRNA and imaging in living cells in vitro using rGO-based dual fluorescent signal amplification platform. Talanta205, 120092. 10.1016/j.talanta.2019.06.092
14
DanielM. C.AstrucD. (2004). Gold nanoparticles: Assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis, and nanotechnology. Chem. Rev.104 (1), 293–346. 10.1021/cr030698+
15
DanielaC.MarcanoD. V. K.BerlinJ. M.SunZ.AlexanderS.AlemanyL. B.et al (2010). Improved synthesis of graphene oxide. ACS Nano4, 4806–4814. 10.1021/nn1006368
16
DengX.LiuX.WuS.ZangS.LinX.ZhaoY.et al (2021). Ratiometric fluorescence imaging of intracellular microRNA with NIR-assisted signal amplification by a Ru-SiO2@Polydopamine nanoplatform. ACS Appl. Mat. Interfaces13 (38), 45214–45223. 10.1021/acsami.1c11324
17
DingQ.ZhanQ.ZhouX.ZhangT.XingD. (2016). Theranostic upconversion nanobeacons for tumor mRNA ratiometric fluorescence detection and imaging-monitored drug delivery. Small12 (43), 5944–5953. 10.1002/smll.201601724
18
DubertretB.CalameM.LibchaberA. J. (2001). Single-mismatch detection using gold-quenched fluorescent oligonucleotides. Nat. Biotechnol.19 (4), 365–370. 10.1038/86762
19
DuffyM. J. (1996). Proteases as prognostic markers in cancer. Clin. Cancer Res.2 (4), 613–618.
20
DulkeithE.RinglerM.KlarT. A.FeldmannJ.Muñoz JavierA.ParakW. J. (2005). Gold nanoparticles quench fluorescence by phase induced radiative rate suppression. Nano Lett.5 (4), 585–589. 10.1021/nl0480969
21
EbrahimiS. B.SamantaD.MirkinC. A. (2020). DNA-based nanostructures for live-cell analysis. J. Am. Chem. Soc.142 (26), 11343–11356. 10.1021/jacs.0c04978
22
EnustunB. V, T. J.TurkevichJ. (1963). Coagulation of colloidal gold. J. Am. Chem. Soc.85 (21), 3317–3328. 10.1021/ja00904a001
23
FanJ.TongC.DangW.QinY.LiuX.LiuB.et al (2019). An rGONS-based biosensor for simultaneous imaging of p53 and p21 mRNA in living cells. Talanta204, 20–28. 10.1016/j.talanta.2019.05.087
24
FanL.ChongX.ZhaoM.JiaF.WangZ.ZhouY.et al (2021). Ultrasensitive gastric cancer circulating tumor cellular CLDN18.2 RNA detection based on a molecular beacon. Anal. Chem.93 (2), 665–670. 10.1021/acs.analchem.0c04055
25
FrensG. (1973). Controlled nucleation for the regulation of the particle size in monodisperse gold suspensions. Nat. Phys. Sci.241 (105), 20–22. 10.1038/physci241020a0
26
GaoM.YuF.LvC.ChooJ.ChenL. (2017). Fluorescent chemical probes for accurate tumor diagnosis and targeting therapy. Chem. Soc. Rev.46 (8), 2237–2271. 10.1039/c6cs00908e
27
GiljohannD. A.SeferosD. S.PatelP. C.MillstoneJ. E.RosiN. L.MirkinC. A. (2007). Oligonucleotide loading determines cellular uptake of DNA-modified gold nanoparticles. Nano Lett.7 (12), 3818–3821. 10.1021/nl072471q
28
GongD.HuiX.GuoZ.ZhengX. (2019). The synthesis of PEI core@silica shell nanoparticles and its application for sensitive electrochemical detecting mi-RNA. Talanta198, 534–541. 10.1016/j.talanta.2019.02.013
29
GraybillR. M.BaileyR. C. (2016). Emerging biosensing approaches for microRNA Analysis. Anal. Chem.88 (1), 431–450. 10.1021/acs.analchem.5b04679
30
HayatA. M. (1989). Colloidal gold : Principles, methods, and applications, 2. New York: Academic Press, 613–618.4
31
HeD.HeX.WangK.YangX.YangX.LiX.et al (2014). Nanometer-sized manganese oxide-quenched fluorescent oligonucleotides: An effective sensing platform for probing biomolecular interactions. Chem. Commun.50 (75), 11049–11052. 10.1039/c4cc04573d
32
HeD.HeX.YangX.LiH. W. (2017). A smart ZnO@Polydopamine-nucleic acid nanosystem for ultrasensitive live cell mRNA imaging by the target-triggered intracellular self-assembly of active DNAzyme nanostructures. Chem. Sci.8 (4), 2832–2840. 10.1039/c6sc04633a
33
HeW.HuangC. Z.LiY. F.XieJ. P.YangR. G.ZhouP. F.et al (2008). One-step label-free optical genosensing system for sequence-specific DNA related to the human immunodeficiency virus based on the measurements of light scattering signals of gold nanorods. Anal. Chem.80 (22), 8424–8430. 10.1021/ac801005d
34
Heleg-ShabtaiV.AizenR.SharonE.SohnY. S.TrifonovA.EnkinN.et al (2016). Gossypol-capped mitoxantrone-loaded mesoporous SiO2 NPs for the cooperative controlled release of two anti-cancer drugs. ACS Appl. Mat. Interfaces8 (23), 14414–14422. 10.1021/acsami.6b03865
35
HillM. A.MeiningerG. A. (2012). Arteriolar vascular smooth muscle cells: Mechanotransducers in a complex environment. Int. J. Biochem. Cell Biol.44 (9), 1505–1510. 10.1016/j.biocel.2012.05.021
36
HuC.YangY.LinY.WangL.MaR.ZhangY.et al (2021). GO-based antibacterial composites: Application and design strategies. Adv. Drug Deliv. Rev.178, 113967. 10.1016/j.addr.2021.113967
37
HuL.XuG. (2010). Applications and trends in electrochemiluminescence. Chem. Soc. Rev.39 (8), 3275–3304. 10.1039/b923679c
38
HuangJ.GaoX.JiaJ.KimJ. K.LiZ. (2014). Graphene oxide-based amplified fluorescent biosensor for Hg2+ detection through hybridization chain reactions. Anal. Chem.86 (6), 3209–3215. 10.1021/ac500192r
39
HuangR.LiaoY.ZhouX.XingD. (2015). Toehold-mediated nonenzymatic amplification circuit on graphene oxide fluorescence switching platform for sensitive and homogeneous microRNA detection. Anal. Chim. Acta X.888, 162–172. 10.1016/j.aca.2015.07.041
40
HummersW. S.OffemanR. E. (1958). Preparation of graphitic oxide. J. Am. Chem. Soc.80, 1339. 10.1021/ja01539a017
41
JiangC.LiuB.HanM.-Y.ZhangZ. (2018a). Fluorescent nanomaterials for color-multiplexing test papers toward qualitative/quantitative assays. Small Methods2 (7), 1700379. 10.1002/smtd.201700379
42
JiangH.LiF. R.LiW.LuX.LingK. (2018b). Multiplexed determination of intracellular messenger RNA by using a graphene oxide nanoprobe modified with target-recognizing fluorescent oligonucleotides. Microchim. Acta185 (12), 552. 10.1007/s00604-018-3090-1
43
KarbownikM.BrzezianskaE.LewinskiA. (2005). Increased expression of mRNA specific for thymidine kinase, deoxycytidine kinase or thymidine phosphorylase in human papillary thyroid carcinoma. Cancer Lett.225 (2), 267–273. 10.1016/j.canlet.2004.10.044
44
KennedyL. C.BickfordL. R.LewinskiN. A.CoughlinA. J.HuY.DayE. S.et al (2011). A new era for cancer treatment: Gold-nanoparticle-mediated thermal therapies. Small7 (2), 169–183. 10.1002/smll.201000134
45
KimJ.CoteL. J.KimF.HuangJ. (2010). Visualizing graphene based sheets by fluorescence quenching microscopy. J. Am. Chem. Soc.132 (1), 260–267. 10.1021/ja906730d
46
LiF.HuangY.YangQ.ZhongZ.LiD.WangL.et al (2010). A graphene-enhanced molecular beacon for homogeneous DNA detection. Nanoscale2 (6), 1021–1026. 10.1039/b9nr00401g
47
LiJ.ZhuB.ZhuZ.ZhangY.YaoX.TuS.et al (2015). Simple and rapid functionalization of gold nanorods with oligonucleotides using an mPEG-SH/Tween 20-Assisted approach. Langmuir31 (28), 7869–7876. 10.1021/acs.langmuir.5b01680
48
LiM.ZhouX.DingW.GuoS.WuN. (2013). Fluorescent aptamer-functionalized graphene oxide biosensor for label-free detection of mercury(II). Biosens. Bioelectron. X.41, 889–893. 10.1016/j.bios.2012.09.060
49
LiN.ChangC.PanW.TangB. (2012a). A Multicolor nanoprobe for detection and imaging of tumor-related mRNAs in living cells. Angew. Chem. Int. Ed.51 (30), 7426–7430. 10.1002/anie.201203767
50
LiN.WongP. K. (2010). Transfection of molecular beacons in microchannels for single-cell gene-expression analysis. Bioanalysis2 (10), 1689–1699. 10.4155/bio.10.116
51
LiZ.BarnesJ. C.BosoyA.StoddartJ. F.ZinkJ. I. (2012b). Mesoporous silica nanoparticles in biomedical applications. Chem. Soc. Rev.41 (7), 2590–2605. 10.1039/c1cs15246g
52
LiangW.ZhuoY.XiongC.ZhengY.ChaiY.YuanR. (2017). A sensitive immunosensor via in situ enzymatically generating efficient quencher for electrochemiluminescence of iridium complexes doped SiO2 nanoparticles. Biosens. Bioelectron. X.94, 568–574. 10.1016/j.bios.2017.03.056
53
LinP.ZhangL.ChenD.XuJ.BaiY.ZhaoS. (2021). A DNA-functionalized biomass nanoprobe for the targeted photodynamic therapy of tumor and ratiometric fluorescence imaging-based visual cancer cell identification/antitumor drug screening. Analyst146 (3), 835–841. 10.1039/d0an02006k
54
LiuN.ZouZ.LiuJ.ZhuC.ZhengJ.YangR. (2019). A fluorescent nanoprobe based on azoreductase-responsive metal-organic frameworks for imaging VEGF mRNA under hypoxic conditions. Analyst144 (21), 6254–6261. 10.1039/c9an01671f
55
MaW.FuP.SunM.XuL.KuangH.XuC. (2017). Dual quantification of microRNAs and telomerase in living Cells. J. Am. Chem. Soc.139 (34), 11752–11759. 10.1021/jacs.7b03617
56
MaY.WangZ.ZhangM.HanZ.ChenD.ZhuQ.et al (2016). A telomerase-specific doxorubicin-releasing molecular beacon for cancer theranostics. Angew. Chem. Int. Ed.55 (10), 3304–3308. 10.1002/anie.201509182
57
MartíA. A.LiX.JockuschS.StevensN.LiZ.RaveendraB.et al (2007). Design and characterization of two-dye and three-dye binary fluorescent probes for mRNA detection. Tetrahedron63 (17), 3591–3600. 10.1016/j.tet.2006.08.109
58
MayeuxR. (2004). Biomarkers: Potential uses and limitations. NeuroRx1 (2), 182–188. 10.1602/neurorx.1.2.182
59
MehtaS.ShellingA.MuthukaruppanA.LashamA.BlenkironC.LakingG.et al (2010). Predictive and prognostic molecular markers for cancer medicine. Ther. Adv. Med. Oncol.2 (2), 125–148. 10.1177/1758834009360519
60
NingD.HeC.LiuZ.LiuC.WuQ.ZhaoT.et al (2017). A dual-colored ratiometric-fluorescent oligonucleotide probe for the detection of human telomerase RNA in cell extracts. Analyst142 (10), 1697–1702. 10.1039/c7an00150a
61
NovoselovK. S.GeimA. K.MorozovS. V.JiangD.ZhangY.DubonosS. V.et al (2004). Electric field effect in atomically thin carbon films. Science306 (5696), 666–669. 10.1126/science.1102896
62
OuM.HuangJ.YangX.HeX.QuanK.YangY.et al (2018). Live-cell microRNA imaging through MnO2 nanosheet-mediated DD-A hybridization chain reaction. Chembiochem19 (2), 147–152. 10.1002/cbic.201700573
63
OuM.HuangJ.YangX.QuanK.YangY.XieN.et al (2017). MnO2 nanosheet mediated "DD-A" FRET binary probes for sensitive detection of intracellular mRNA. Chem. Sci.8 (1), 668–673. 10.1039/c6sc03162e
64
PallG. S.Codony-ServatC.ByrneJ.RitchieL.HamiltonA. (2007). Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res.35 (8), e60. 10.1093/nar/gkm112
65
PanS.ZhangH.WangC.YaoS. C.YaoS. Q. (2016). Target identification of natural products and bioactive compounds using affinity-based probes. Nat. Prod. Rep.33 (5), 612–620. 10.1039/c5np00101c
66
PanW.ZhangT.YangH.DiaoW.LiN.TangB. (2013). Multiplexed detection and imaging of intracellular mRNAs using a four-color nanoprobe. Anal. Chem.85 (21), 10581–10588. 10.1021/ac402700s
67
ParkS.AnJ.JungI.PinerR. D.AnS. J.LiX.et al (2009). Colloidal suspensions of highly reduced graphene oxide in a wide variety of organic solvents. Nano Lett.9 (4), 1593–1597. 10.1021/nl803798y
68
PatelP. C.GiljohannD. A.DanielW. L.ZhengD.PrigodichA. E.MirkinC. A. (2010). Scavenger receptors mediate cellular uptake of polyvalent oligonucleotide-functionalized gold nanoparticles. Bioconjug. Chem.21 (12), 2250–2256. 10.1021/bc1002423
69
PiaoY.LiuF.SeoT. S. (2012). A novel molecular beacon bearing a graphite nanoparticle as a nanoquencher for in situ mRNA detection in cancer cells. ACS Appl. Mat. Interfaces4 (12), 6785–6789. 10.1021/am301976r
70
QianL.WinfreeE.BruckJ. (2011). Neural network computation with DNA strand displacement cascades. Nature475 (7356), 368–372. 10.1038/nature10262
71
QianL.WinfreeE. (2011). Scaling up digital circuit computation with DNA strand displacement cascades. Science332 (6034), 1196–1201. 10.1126/science.1200520
72
QiaoG.GaoY.LiN.YuZ.ZhuoL.TangB. (2011). Simultaneous detection of intracellular tumor mRNA with bi-color imaging based on a gold nanoparticle/molecular beacon. Chem. Eur. J.17 (40), 11210–11215. 10.1002/chem.201100658
73
QuL. L.LiuY. Y.LiuM. K.YangG. H.LiD. W.LiH. T. (2016). Highly reproducible Ag NPs/CNT-intercalated GO membranes for enrichment and SERS detection of antibiotics. ACS Appl. Mat. Interfaces8 (41), 28180–28186. 10.1021/acsami.6b08790
74
RatajczakK.KrazinskiB. E.KowalczykA. E.DworakowskaB.JakielaS.StobieckaM.et al (2018). Hairpin-Hairpin molecular beacon interactions for detection of survivin mRNA in malignant SW480 cells. ACS Appl. Mat. Interfaces10 (20), 17028–17039. 10.1021/acsami.8b02342
75
RogersW. B.ManoharanV. N. (2015). Programming colloidal phase transitions with DNA strand displacement. Science347 (6222), 639–642. 10.1126/science.1259762
76
RosiN. L.GiljohannD. A.ThaxtonC. S.Lytton-JeanA. K.HanM. S.MirkinC. A. (2006). Oligonucleotide-modified gold nanoparticles for intracellular gene regulation. Science312 (5776), 1027–1030. 10.1126/science.1125559
77
RoyR.HohngS.HaT. (2008). A practical guide to single-molecule FRET. Nat. Methods5 (6), 507–516. 10.1038/nmeth.1208
78
SantangeloP. J.NixB.TsourkasA.BaoG. (2004). Dual FRET molecular beacons for mRNA detection in living cells. Nucleic Acids Res.32 (6), e57. 10.1093/nar/gnh062
79
SeferosD. S.GiljohannD. A.HillH. D.PrigodichA. E.MirkinC. A. (2007). Nano-flares: Probes for transfection and mRNA detection in living cells. J. Am. Chem. Soc.129 (50), 15477–15479. 10.1021/ja0776529
80
SeferosD. S.PrigodichA. E.GiljohannD. A.PatelP. C.MirkinC. A. (2009). Polyvalent DNA nanoparticle conjugates stabilize nucleic acids. Nano Lett.9 (1), 308–311. 10.1021/nl802958f
81
ShiZ.ZhangX.ChengR.LiB.JinY. (2016). Sensitive detection of intracellular RNA of human telomerase by using graphene oxide as a carrier to deliver the assembly element of hybridization chain reaction. Analyst141 (9), 2727–2732. 10.1039/c6an00233a
82
SokolD. L.ZhangX.LuP.GewirtzA. M. (1998). Real time detection of DNA.RNA hybridization in living cells. Proc. Natl. Acad. Sci. U. S. A.95 (20), 11538–11543. 10.1073/pnas.95.20.11538
83
SunH.HongM.YangQ.LiC.ZhangG.YueQ.et al (2019). Visualizing the down-regulation of hTERT mRNA expression using gold-nanoflare probes and verifying the correlation with cancer cell apoptosis. Analyst144 (9), 2994–3004. 10.1039/c9an00204a
84
SunJ.PiF.JiJ.LeiH.GaoZ.ZhangY.et al (2018). Ultrasensitive "FRET-SEF" probe for sensing and imaging microRNAs in living cells based on gold nanoconjugates. Anal. Chem.90 (5), 3099–3108. 10.1021/acs.analchem.7b04051
85
TakadaS. (2019). Gō model revisited. Biophys. Physicobiol.16, 248–255. 10.2142/biophysico.16.0_248
86
TanW.WangK.DrakeT. J. (2004). Molecular beacons. Curr. Opin. Chem. Biol.8 (5), 547–553. 10.1016/j.cbpa.2004.08.010
87
TsourkasA.BehlkeM. A.XuY.BaoG. (2003). Spectroscopic features of dual fluorescence/luminescence resonance energy-transfer molecular beacons. Anal. Chem.75 (15), 3697–3703. 10.1021/ac034295l
88
TyagiS.KramerF. R. (1996). Molecular beacons: Probes that fluoresce upon hybridization. Nat. Biotechnol.14 (3), 303–308. 10.1038/nbt0396-303
89
WallaceP. (1947). The band theory of graphite. Phys. Rev.71, 622–634. 10.1103/physrev.71.622
90
WuH.AlexanderS. C.JinS.DevarajN. K. (2016). A bioorthogonal near-infrared fluorogenic probe for mRNA detection. J. Am. Chem. Soc.138 (36), 11429–11432. 10.1021/jacs.6b01625
91
WuL.QuX. (2015). Cancer biomarker detection: Recent achievements and challenges. Chem. Soc. Rev.44 (10), 2963–2997. 10.1039/c4cs00370e
92
WuQ.LiuZ.SuL.HanG.LiuR.ZhaoJ.et al (2018). Sticky-flares for in situ monitoring of human telomerase RNA in living cells. Nanoscale10 (19), 9386–9392. 10.1039/c8nr01260a
93
WuZ.LiuG. Q.YangX. L.JiangJ. H. (2015). Electrostatic nucleic acid nanoassembly enables hybridization chain reaction in living cells for ultrasensitive mRNA imaging. J. Am. Chem. Soc.137 (21), 6829–6836. 10.1021/jacs.5b01778
94
XuW.ZhaoA.ZuoF.HussainH. M. J. (2019). Retracted: A graphene oxide-based hairpin probe coupling duplex-specific nuclease signal amplification for detection and imaging of mRNA in living cells. Talanta195, 732–738. 10.1016/j.talanta.2018.11.078
95
YanL.ZhouJ.ZhengY.GamsonA. S.RoembkeB. T.NakayamaS.et al (2014). Isothermal amplified detection of DNA and RNA. Mol. Biosyst.10 (5), 970–1003. 10.1039/c3mb70304e
96
YanN.LinL.XuC.TianH.ChenX. (2019). A GSH-gated DNA nanodevice for tumor-specific signal amplification of microRNA and MR imaging-guided theranostics. Small15 (41), e1903016. 10.1002/smll.201903016
97
YanN.WangX.LinL.SongT.SunP.TianH.et al (2018). Gold nanorods electrostatically binding nucleic acid probe for in vivo microRNA amplified detection and photoacoustic imaging-guided photothermal therapy. Adv. Funct. Mat.28 (22), 1800490. 10.1002/adfm.201800490
98
YangJ.WangK.XuH.YanW.JinQ.CuiD. (2019). Detection platforms for point-of-care testing based on colorimetric, luminescent and magnetic assays: A review. Talanta202, 96–110. 10.1016/j.talanta.2019.04.054
99
YangY.HuangJ.YangX.QuanK.WangH.YingL.et al (2015a). FRET nanoflares for intracellular mRNA detection: Avoiding false positive signals and minimizing effects of system fluctuations. J. Am. Chem. Soc.137 (26), 8340–8343. 10.1021/jacs.5b04007
100
YangY.HuangJ.YangX.QuanK.WangH.YingL.et al (2015b). FRET nanoflares for intracellular mRNA detection: Avoiding false positive signals and minimizing effects of system fluctuations. J. Am. Chem. Soc.137 (26), 8340–8343. 10.1021/jacs.5b04007
101
YuS.ZhouY.SunY.WuS.XuT.ChangY. C.et al (2021). Endogenous mRNA triggered DNA-Au nanomachine for in situ imaging and targeted multimodal synergistic cancer therapy. Angew. Chem. Int. Ed.60 (11), 5948–5958. 10.1002/anie.202012801
102
YuanP.MaoX.ChongK. C.FuJ.PanS.WuS.et al (2017). Simultaneous imaging of endogenous survivin mRNA and On-demand Drug release in live cells by using a mesoporous silica nanoquencher. Small13 (27), 1700569. 10.1002/smll.201700569
103
ZhaiW.WangC.YuP.WangY.MaoL. (2014). Single-layer MnO2 nanosheets suppressed fluorescence of 7-hydroxycoumarin: Mechanistic study and application for sensitive sensing of ascorbic acid in vivo. Anal. Chem.86 (24), 12206–12213. 10.1021/ac503215z
104
ZhangD.WuT.QinX.QiaoQ.ShangL.SongQ.et al (2019). Intracellularly generated immunological gold nanoparticles for combinatorial photothermal therapy and immunotherapy against tumor. Nano Lett.19 (9), 6635–6646. 10.1021/acs.nanolett.9b02903
105
ZhangL. R.ZhuG.ZhangC. Y. (2014). Homogeneous and label-free detection of microRNAs using bifunctional strand displacement amplification-mediated hyperbranched rolling circle amplification. Anal. Chem.86 (13), 6703–6709. 10.1021/ac501645x
106
ZhangP.ZhuoY.ChangY.YuanR.ChaiY. (2015). Electrochemiluminescent graphene quantum dots as a sensing platform: a dual amplification for microRNA assay. Anal. Chem.87 (20), 10385–10391. 10.1021/acs.analchem.5b02495
107
ZhaoJ.LuoJ.LiuD.HeY.LiQ.ChenS.et al (2020). A coreactant-free electrochemiluminescence (ECL) biosensor based on in situ generating quencher for the ultrasensitive detection of microRNA. Sensors Actuators B Chem.316, 128139. 10.1016/j.snb.2020.128139
108
ZhaoT.DongF.HuX.XuY.WeiW.-m.LiuR.et al (2021). Dynamic tracking of p21 mRNA in living cells by sticky-flares for the visual evaluation of the tumor treatment effect. Nanoscale14, 1733–1741. 10.1039/d1nr05418j
109
ZhaoX.ZhangL.GaoW.YuX.GuW.FuW.et al (2020). Spatiotemporally controllable MicroRNA imaging in living cells via a near-infrared light-activated nanoprobe. ACS Appl. Mat. Interfaces12 (32), 35958–35966. 10.1021/acsami.0c10962
110
ZhaoZ.FanH.ZhouG.BaiH.LiangH.WangR.et al (2014). Activatable fluorescence/MRI bimodal platform for tumor cell imaging via MnO2 nanosheet-aptamer nanoprobe. J. Am. Chem. Soc.136 (32), 11220–11223. 10.1021/ja5029364
111
ZhengD.SeferosD. S.GiljohannD. A.PatelP. C.MirkinC. A. (2009). Aptamer nano-flares for molecular detection in living cells. Nano Lett.9 (9), 3258–3261. 10.1021/nl901517b
112
ZhengH.ZhanX. Q.BianQ. N.ZhangX. J. (2013). Advances in modifying fluorescein and rhodamine fluorophores as fluorescent chemosensors. Chem. Commun.49 (5), 429–447. 10.1039/c2cc35997a
113
ZhengY. N.LiangW. B.XiongC. Y.ZhuoY.ChaiY. Q.YuanR. (2017). Universal ratiometric photoelectrochemical bioassay with target-nucleotide transduction-amplification and electron-transfer tunneling distance regulation strategies for ultrasensitive determination of microRNA in cells. Anal. Chem.89 (17), 9445–9451. 10.1021/acs.analchem.7b02270
Summary
Keywords
nanosensors, tumor-related biomarkers, RNA detection, cancer diagnosis, DNA-enabled fluorescent probe
Citation
Dong F, Yan W, Dong W, Shang X, Xu Y, Liu W, Wu Y, Wei W and Zhao T (2022) DNA-enabled fluorescent-based nanosensors monitoring tumor-related RNA toward advanced cancer diagnosis: A review. Front. Bioeng. Biotechnol. 10:1059845. doi: 10.3389/fbioe.2022.1059845
Received
02 October 2022
Accepted
18 November 2022
Published
01 December 2022
Volume
10 - 2022
Edited by
Ahmed Barhoum, Dublin City University, Ireland
Reviewed by
Jian Chen, Hunan Institute of Engineering, China
Qingqing Miao, Soochow University, China
Guangcun Chen, Chinese Academy of Sciences (CAS), China
Updates

Check for updates
Copyright
© 2022 Dong, Yan, Dong, Shang, Xu, Liu, Wu, Wei and Zhao.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yunkai Wu, wu-y-k@163.com; Wenmei Wei, cherrywwm@ustc.edu; Tingting Zhao, ttzhao@ahmu.edu.cn
This article was submitted to Biosensors and Biomolecular Electronics, a section of the journal Frontiers in Bioengineering and Biotechnology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.










