Abstract
Drosophila suzukii (D. suzukii) (Matsumura, 1931; Diptera: Drosophilidae), also known as spotted wing Drosophila, is a worldwide pest of fruits with soft skins such as blueberries and cherries. Originally from Asia, D. suzukii is now present in the Americas and Europe and has become a significant economic pest. Growers largely rely on insecticides for the control of D. suzukii. Genetic strategies offer a species-specific environmentally friendly way for suppression of D. suzukii populations. We previously developed a transgenic strain of D. suzukii that produced only males on a diet that did not contain tetracycline. The strain carried a single copy of the FL19 construct on chromosome 3. Repeated releases of an excess of FL19 males led to suppression of D. suzukii populations in laboratory cage trials. Females died as a consequence of overexpression of the tetracycline transactivator (tTA) and tTA-activated expression of the head involution defective proapoptotic gene. The aim of this study was to generate additional male-only strains that carried two copies of the FL19 transgene through crossing the original line with a piggyBac jumpstarter strain. Males that carried either two chromosome 3 or a singleX-linked transgene were identified through stronger expression of the red fluorescent protein marker gene. The brighter fluorescence of the X-linked lines was likely due to dosage compensation of the red fluorescent protein gene. In total, four X-linked lines and eleven lines with two copies on chromosome 3 were obtained, of which five were further examined. All but one of the strains produced only males on a diet without tetracycline. When crossed with wild type virgin females, all of the five two copy autosomal strains examined produced only males. However, the single copy X-linked lines did not show dominant female lethality. Five of the autosomal lines were further evaluated for productivity (egg to adult) and male competition. Based on these results, the most promising lines have been selected for future population suppression experiments with strains from different geographical locations.
Introduction
First reported in 2008 in California and Europe, Drosophila suzukii (D. suzukii) is now widely found through North America, Europe and some locations in South America (; ; ). Unlike most Drosophila species that are not economic pests, D. suzukii females lay their eggs in ripe fruit before harvest (). The species is commonly known as spotted wing Drosophila since adult males have a dark spot that is clearly seen on each wing (). Growers largely rely on insecticides for control but use is weather-dependent and resistance to the chemicals is anticipated as seen with Spinosad in California (). D. suzukii have a wide range of non-crop host plants, which can serve as a refuge (; ). Thus, reinfestation of crops following insecticide treatment can be relatively rapid (). Additional area-wide control methods are clearly needed.
One promising approach for area-wide control of insects is the release of fertile males carrying dominant female lethal genes (; ), which is also known as fsRIDL (female-specific release of insects carrying a dominant lethal genetic system) (). Wild type virgin females that mate with released fertile fsRIDL males will only produce male offspring. Modeling indicates that repeated releases of an excess of fsRIDL males can lead to suppression of pest populations (; ). The fsRIDL strains can be reared in the laboratory or a mass-rearing facility as a conditional system is used for controlling expression of the female-specific lethal gene. Conditional expression is achieved by using the tetracycline transactivator (tTA), a transcription factor that binds very specifically to a sequence from the Escherichia coli tet operator (tetO) (). The binding of tTA to the tetO is inhibited by adding tetracycline to the diet, thus providing a simple off-switch. In the initial system we developed (), the lethal or effector gene cassette consisted of seven copies of tetO, a core promoter and the coding sequence for the head involution defective (hid) proapoptotic gene. Widespread expression of hid in D. melanogaster led to organismal death (). Female-specificity was achieved by using an enhancer-promoter from a yolk protein gene to drive tTA expression (). Subsequently, fsRIDL strains were simplified to a single component system that consisted of a tTA activated enhancer-promoter driving expression of tTA (; ). In this autoregulatory system, very high levels of tTA gene expression led to organismal death likely due to “transcriptional squelching” or inhibition of ubiquitin-mediated proteolysis (). Only females died on a diet without tetracycline as the tTA coding region was interrupted by the sex-specifically spliced first intron from the Ceratitis capitata transformer (tra) gene (). Similarly, the initial New World screwworm (Cochliomyia hominivorax) fsRIDL strains carried single component tTA overexpression transgenes but with the sex-specific intron from the C. hominivorax tra gene (). The female-specific tTA overexpression systems were functional in D. melanogaster, indicating that the screwworm and C. capitata tra introns were correctly spliced in D. melanogaster (; ). We recently developed the FL19 D. suzukii fsRIDL strain that had a female-specific tTA overexpression gene and a tTA activated hid gene in a single construct ().
The effectiveness of fsRIDL strains for population suppression has been demonstrated in cage trials. In the continuous population experiments, conditions were first established for maintaining a population simply by providing sufficient diet. Subsequently, repeated releases of an excess of fertile fsRIDL males led to eradication of the populations (; ; ). With D. suzukii, repeated releases of FL19 males (approximately 10–13:1 ratio) led to a sharp reduction in egg production in the first month and by 8 weeks the test cages had stopped laying eggs (). Males from a fsRIDL strain of the diamondback moth, Plutella xylostella, have been tested in cages () and in the open field (). For the latter, the fsRIDL males showed excellent dispersal and persistence ().
In the field, fsRIDL males will likely encounter females from populations with much greater genetic diversity than found in lab strains (). To investigate the sensitivity of a female-specific tTA overexpression system to variation in genetic background, we utilized the D. melanogaster Genetic Reference Panel (DGRP) that consists of 205 highly inbred lines each with fully sequenced genomes (). Males from an fsRIDL strain were crossed with virgin females from each DGRP line and the number of male and female offspring counted. The level of female lethality between DGRP lines varied considerably from 11% to 97% with a broad sense heritability of 0.89 (). We concluded that genetic background could have a significant impact on the efficacy of the tTA overexpression system. This was one reason why a second effector, hid, was included in the FL19 construct. The aim of this study was to develop robust D. suzukii fsRIDL strains that either carried two copies of the FL19 transgene or carried the FL19 transgene at a favorable chromosomal location as the tTA expression system is sensitive to position-effects (; ). This was achieved by remobilizing the original FL19 transgene through crossing with a piggyBac jumpstarter strain that expresses piggyBac transposase in the germline (). Here we report on the new D. suzukii fsRIDL strains obtained by using this approach.
Materials and Methods
Fly Rearing, Transposition and Recombination Mapping
D. suzukii were raised on cornmeal-yeast-agar diet at room temperature (approx. 20–22°C) in the open laboratory. The relative humidity in the lab was between 20% and 50% and the lights were on for about 12 h on most days. The original wild-type colony was established from infested fruit collected from a field in North Carolina in 2011 () and the initial FL19 strain was previously made by piggyBac-mediated germline transformation of this wild type strain (). The wild type colony was periodically genetically augmented with flies collected in North Carolina (). The newly refreshed and the original 2011wild type colonies are maintained separately by our lab. To remobilize the FL19 transgene, ten FL19 virgin females were crossed with five males from the H7 piggyBac jumpstarter strain () (Figure 1). From the offspring of the cross, ten virgin females were crossed to five wild type males. The male offspring were screened for bright red fluorescence using a M205FA microscope (Leica Microsystems, Buffalo Grove, IL) with the DsRed filter [ex 545/25, em 595/50 nm]. Individual candidate males were then each crossed with five wild type virgin females. If the FL19 transgene had transposed to the X chromosome, then only the female offspring would show red fluorescence. If both sexes showed bright red fluorescence, this could indicate that the flies carried two autosomal copies of FL19. Homozygous lines for each putative transposition event were established by crossing and selecting for particularly high levels of red fluorescence.
FIGURE 1
For recombination mapping of X-linked FL19 transgenes, six crosses were set for each combination FL19(X) lines. The double heterozygous virgin female offspring were collected and crossed with wild type males. Recombinant male offspring that showed no red fluorescence was identified and counted. A map distance of the two FL19(X) sites were calculated by; map distance (cM) = 100 x (2 x number of non-fluorescent males)/total males.
Assessment of Female-specific Lethality
To assess the level of female lethality in the homozygous strains, three vials were set on the same day with five pairs on a diet that either contained tetracycline (40 μg/ml) or lacked tetracycline. Parents were transferred three times to new cultures every 3 days to create four cultures. To determine if the strains showed dominant female lethality, five transgenic males were crossed with five wild type virgin females. Parents were transferred to new cultures every 3 days to create four cultures. Two replicates were set each on tetracycline and non-tetracycline foods. The number of male and female offspring from each cross were counted daily until 20 days after setting the cross.
Assessment of Strain Productivity
Cut vials, which were regular fly vials cut at the middle to create 7.2 cm-long tubes and 2.3 cm-deep cups, were used for easy handling of eggs. A tube and a cup were taped together to create a vial for productivity tests. The cup contained about 10 ml of culture medium. Flies that were raised under non-crowded conditions were collected from several vials 3 to 14 days after eclosion and then allowed to lay eggs in the cut vials for about 20 h. The cut vials were then separated, eggs were picked with a needle and transferred to a new vial with about 10 ml of medium. Typically, 50 eggs were transferred to each vial. After 2 days unhatched eggs were counted. Emerging adults were sexed and counted up to 3 weeks after the egg-picking. At the end of emergence of adult flies, the number of pupal cases was counted. The egg survival ratio is the number of hatched eggs divided by the total number of eggs. The larval survival ratio is the number of pupae divided by the number of hatched eggs. The pupal survival ratio is the number of adults divided by the number of pupae. The egg to adult survival ratio is the number of adults divided by the total number of eggs. This ratio was multiplied by two for the transgenic lines on diet without tetracycline.
Male Mating Competitiveness
Ten transgenic males from strains reared without tetracycline in the diet and 10 wild type males were introduced into an 8 oz bottle with diet and left undisrupted for 1 hour. Ten wild type virgin females were added to the bottle which was kept undisrupted at room temperature (∼22°C) for approximately 24 h. All flies were four to 6 days old. Females were transferred individually to fresh vials with diet. The offspring of each female were counted, sexed and examined for fluorescence status (presence/absence) to determine whether the female had mated with an FL19(3 + 3) or wild type male. The presence of both fluorescent and non-fluorescent offspring would indicate remating during the 24 h period when males were with females. Four to eight bottles were set for each line. Mate success ratio of each line was calculated by; success ratio = (number of females with fluorescent sons only + a half number of females with both fluorescent and non-fluorescent sons)/number of fertile females.
Molecular Analysis
The genomic location of the transgenes was determined using inverse PCR with primers for the piggyBac left and right ends as previously described ( and see Supplementary Table S1). If inverse PCR was only successful for one end, confirmation of the transgene location was obtained by PCR using one primer for the piggyBac end and one primer based on the flanking genome sequence of the insertion site.
Statistical Analysis
For the female lethality tests (Table 4), contingency analysis (fit Y by X) was performed using JMP Pro 15 (SAS Institute). The egg to adult ratio (Table 5) was analyzed in SAS (Version 9.4, Cary, NC) on a diet with tetracycline, with the total number of adults divided by the number of eggs as the response variable in PROC LOGISTIC, and both line, tetracycline (+/-), and their interaction as predictor variables. All effects were statistically significant (p < 0.0001). For diet without tetracycline, the number of male eggs was estimated as the floor of the number of eggs divided by two. Least-squares means were obtained for each treatment combination, and the specific differences of interest were calculated. The log-odds ratio of the two treatments (each line compared to each wild type for both tetracycline + and tetracycline -) were obtained. To control for multiple tests, a Bonferroni correction was used where the adjusted p-value to determine statistical significance was set at 0.05/30 = 0.0016 for a diet with tetracycline and 0.05/15 = 0.0033 for a diet without tetracycline (only males produced from transgenic lines). The male competitiveness data (Table 6) were also analyzed in SAS, Version 9.4 (Cary, NC). The mating competitiveness index (MCI) was recalculated as the ceiling of the number mated with transgenic plus half the number that remated divided by the total number mated. This allowed the count to remain an integer. A z-test for one proportion was run for each line comparing the MCI to the null hypothesized proportion of 0.5.
Results
Transposition of the FL19 Transgene to New Chromosomal Locations
The original FL19 male-only strain was made by piggyBac transposase-mediated germline transformation (). The transgene was located on chromosome 3 between the DsShal and DsCG9231 genes. The piggyBac H7 jumpstarter strain efficiently mediates remobilization of piggyBac transgenes (). To remobilize the FL19 transgene, FL19 virgin females were crossed with H7 males and virgin female offspring collected (Figure 1). As X-linked transgenes are generally dosage compensated in male Drosophila melanogaster (; ), we reasoned that G3 males carrying a single X-linked FL19 transgene would show an increased expression of the red fluorescent protein marker gene (Figure 1). Males that carried FL19 at the original location and at a second autosomal location would also show brighter red fluorescence. Such transpositions tend to be predominately local (), so the expectation was that males would carry FL19 at the original location and at a closely linked site on chromosome 3. X-linked transposition events were identified through crossing putative males with wild type virgin females (Figure 1). From approximately 25,000 G3 males, we derived four X-linked lines and eleven lines with two copies of FL19 on chromosome 3 (Table 1). Of the third chromosome lines, one was homozygous lethal and two lines were homozygous sterile (Table 1). Of the remaining eight homozygous viable lines, five (8, 36, 40, 70 and 75) that were vigorous on diet with tetracycline were selected for further study.
TABLE 1
| Chromosome | Line | Homozygous condition |
|---|---|---|
| X | 7 | viable |
| X | 46 | viable |
| X | 77 | viable |
| X | 79 | viable |
| 3 | F8 | sterile |
| 3 | 6 | sterile |
| 3 | 8 | viable |
| 3 | 17 | viable |
| 3 | 18 | dead |
| 3 | 36 | viable |
| 3 | 40 | viable |
| 3 | 70 | viable |
| 3 | 75 | viable |
| 3 | 78 | viable |
| 3 | 83 | viable |
X-linked and third chromosome FL19 lines.
The chromosomal locations of the X-linked and most of the chromosome 3 lines were determined by inverse PCR and blast searches of the assembled D. suzukii genomes (; ) (Table 2). Some locations could not be determined as the transgene appeared to be located within a repetitive sequence. PCR analysis confirmed that all the chromosome 3 lines carried two copies of FL19, with one copy at the original location near the DsCG9231 gene (Figure 2). The other copies of FL19 were found to have inserted no more than 68 kb from the original location (Table 5; Figure 2). In line 36, the additional FL19 transgene is less than 3 kb from the original and is also within the intergenic region between the DsCG9231 and DsSha1 genes (Figure 2). In line 70, the additional FL19 transgene is also in an intergenic region, between the Dswnd and DsRnf146 genes (Table 2; Figure 2). In the other lines, 8 and 75, the transgene is located within genes. In line 8, the transgene is within an intron of the DsRnf146 gene. In the line 75 the transgene is within an exon of the DsCG14100 gene and would likely disrupt gene function.
TABLE 2
| Line | Chromosome | Insertion site sequence (TTAA in bold) | Nearest gene | Relationship to original FL19 location |
|---|---|---|---|---|
| 7 | X | TCGATATCAGGTGGTGCACTTTAAGGAGTTGGAGCATAGCATAT | DsCG8661 (contig 7a) | NA |
| 46 | X | GCTCCGCCGTCGTTTGTATTTTAA TTTAGCCTCTTCAAATTGCT | DsCG32655 (>20 kb) (contig 11) | NA |
| 77 | X | CGCCAAAACGCAAGAAACCTTTAAAAGAGTAATCCAGATAATGG | DsCp110 (contig 15) | NA |
| 79 | X | ND (repetitive) | ND | NA |
| 8 | 3 | TAAATAATTTCGAAACCACTTTAAAAAGAACTTTGTAGTTTAGT | DsRnf146 (intron) | 67.8 kb 3′ |
| 36 | 3 | TTGTAAATTAAAATAAAGGCTTAACTAAAAAAAGTACCAAGAAC | DsCG9231 | 2.6 kb 5′ |
| 40 | 3 | ND | ND | ND |
| 70 | 3 | GAGGATCATGTTGATGCCCATTAAACCGGCCAAGCTCAGAAGCA | Dswnd and DsRnf146 | 60.8 kb 3′ |
| 75 | 3 | CGTGTTTACCGGTTCGTGCTTAAACTTGAATTCCCGAAGAGAT | DsCG14100 (coding) | 7.5 kb 3′ |
FL19 insertion sites in transposition lines.
Contigs of the genome assembly.
FIGURE 2
In the X-linked lines, three of the four FL19 transgenes appear to be found at widely separated locations as their flanking sequences each align to a different contig of the genome assembly (
TABLE 3
| Cross | Number fluorescent F1 males | Number wild type F1 males | Map distance (cM) |
|---|---|---|---|
| 79♀ x 46♂ | 114 | 33 | 45 |
| 46♀ x 7♂ | 99 | 18 | 31 |
| 79♀ x 7♂ | 151 | 9 | 11 |
| 77♀ x 79♂ | 136 | 0 | 0 |
| 7♀ x 77♂ | 114 | 5 | 8 |
Recombination mapping of X-linked FL19 transgenes.
Tetracycline-Repressible Female Lethality
All the lines can be readily maintained on diet supplemented with tetracycline. When raised on diet that lacked tetracycline all lines produced 99–100% males except for the X-linked line 46, which gave 73.5% males (Table 1). In a future field release, flies would be raised on diet without tetracycline and the released fertile males would mate with wild type females. Ideally, all the female offspring would die. Therefore, we next collected males from the lines raised on diet without tetracycline and crossed to wild type virgin females. For the chromosome 3 lines that carry two copies of the FL19 transgene, all lines showed dominant female lethality (Table 4). However, none of the X-linked single copy lines showed dominant female lethality. Two lines, 7 and 77, produced significantly more male than female offspring (Pearson’s Chi-squared test, p < 0.0001). On a diet with tetracycline, approximately an equal number of males and females were produced from the crosses of transgenic males with wild type females.
TABLE 4
| Strain (chromo-some) | Tetra-cycline | Homozygous Number Malesa | Homozygous Number Females | Homoyzgous %Male | Hemizygous Number Males | Hemizygous Number Females | Hemizygous % Males |
|---|---|---|---|---|---|---|---|
| 7 (X) | − | 239 | 0c | 100 | 239 | 81c | 74.7 |
| + | 253 | 221 | 53.3 | 294 | 286 | 50.7 | |
| 46 (X) | − | 119 | 43c | 73.5 | 186 | 229d | 44.8 |
| + | 188 | 234 | 44.5 | 192 | 206 | 48.2 | |
| 77 (X) | − | 268 | 0c | 100 | 236 | 52c | 82 |
| + | 283 | 243 | 53.8 | 264 | 275 | 49 | |
| 79 (X) | − | 261 | 1c | 99.6 | 226 | 274d | 54.8 |
| + | 188 | 242 | 43.7 | 274 | 289 | 48.7 | |
| 7 (X) + FL19 | − | 66 | 0c | 100 | 115 | 0c | 100 |
| + | 54 | 42 | 56.2 | 146 | 166 | 46.8 | |
| 8 (3) | − | 60 | 0c | 100 | 179 | 0c | 100 |
| + | 46 | 55 | 45.5 | 263 | 258 | 50.5 | |
| 36 (3) | − | 64 | 0c | 100 | 245 | 0c | 100 |
| + | 61 | 32 | 65.6 | 198 | 248 | 44 | |
| 40 (3) | − | 34 | 0b | 100 | 51 | 0c | 100 |
| + | 74 | 34 | 68.5 | 139 | 161 | 46.3 | |
| 70 (3) | − | 40 | 0b | 100 | 190 | 0c | 100 |
| + | 89 | 29 | 75.4 | 258 | 225 | 53.4 | |
| 75 (3) | − | 20 | 0b | 100 | 176 | 0c | 100 |
| + | 49 | 21 | 70 | 257 | 290 | 53.8 |
Tetracycline-repressible female-specific lethality of FL19 transposition lines.
Total count of offspring from three independent vials of flies except for the homozygous chromosome 3 and X + FL19 lines where the data is from the productivity experiment shown in Table 1.
The number of females obtained was significantly lower than expected (Pearson’s Chi-squared test, p < 0.001).
The number of females obtained was significantly lower than expected (Pearson’s Chi-squared test, p < 0.0001).
The number of females obtained was not significantly lower than expected.
General Fitness and Male Sexual Competitiveness of Transgenic Sexing Strains
One of the fitness measurements that is important in a mass rearing facility is the percentage of eggs that produce adults (
TABLE 5
| Strain (chromosome) | Tetra-cycline | Number eggsa | Number unhatched eggs | Number pupae | Numbermales | Number females | Number total adults | Egg survival ratio Mean (SD) | Larval survival ratio Mean (SD) | Pupal survival ratio Mean (SD) | Egg to adult ratiob Mean (SD) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Wild type | − | 150 | 10 | 133 | 65 | 59 | 124 | 0.93 (0.046) | 0.95 (0.111) | 0.93 (0.033) | 0.83 (0.11) |
| + | 183 | 15 | 165 | 67 | 89 | 156 | 0.92 (0.023) | 0.97 (0.1) | 0.95 (0.051) | 0.85 (0.103) | |
| Wild type (est. 2011) | − | 230 | 30 | 157 | 69 | 70 | 139 | 0.87 (0.064) | 0.79 (0.1) | 0.89 (0.076) | 0.62** (0.121) |
| + | 200 | 20 | 117 | 43 | 62 | 105 | 0.84 (0.054) | 0.70 (0.082) | 0.90 0.11) | 0.53** (0.079) | |
| 7 (X) + FL19 (3) | − | 200 | 16 | 70 | 66 | 0 | 66 | 0.92 (0.016) | 0.38 (0.074) | 0.94 (0.011) | 0.66NS (0.12) |
| + | 200 | 14 | 112 | 54 | 42 | 96 | 0.93 (0.035) | 0.6 (0.178) | 0.87 (0.091) | 0.48NS (0.099) | |
| FL19 (3) | − | 600 | 63 | 186 | 157 | 0 | 157 | 0.89 (0.041) | 0.35 (0.1) | 0.86 (0.11) | 0.52NS (0.145) |
| + | 600 | 70 | 350 | 161 | 150 | 311 | 0.88 (0.05) | 0.66 (0.106) | 0.89 (0.073) | 0.52NS (0.08) | |
| 8 (3) | − | 282 | 18 | 83 | 60 | 0 | 60 | 0.94 (0.049) | 0.32 (0.13) | 0.66 (0.3) | 0.44NS (0.32) |
| + | 200 | 16 | 112 | 46 | 55 | 101 | 0.92 (0.051) | 0.61 (0.13) | 0.9 (0.06) | 0.51NS (0.117) | |
| 36 (3) | − | 281 | 70 | 64 | 54 | 0 | 54 | 0.75 (0.071) | 0.3 (0.13) | 0.87 (0.14) | 0.37NS (0.135) |
| + | 146 | 36 | 61 | 27 | 32 | 59 | 0.75 (0.05) | 0.55 (0.06) | 0.97 (0.03) | 0.40NS (0.053) | |
| 40 (3) | − | 142 | 50 | 34 | 22 | 0 | 22 | 0.65 (0.08) | 0.37 (0.09) | 0.60 (0.42) | 0.3NS (0.27) |
| + | 166 | 53 | 74 | 36 | 34 | 70 | 0.68 (0.023) | 0.66 (0.113) | 0.96 (0.057) | 0.42NS (0.051) | |
| 70 (3) | − | 200 | 48 | 40 | 23 | 0 | 23 | 0.76 (0.059) | 0.26 (0.088) | 0.53 (0.33) | 0.23* (0.21) |
| + | 236 | 69 | 89 | 56 | 29 | 85 | 0.71 (0.069) | 0.53 (0.083) | 0.96 (0.057) | 0.36* (0.071) | |
| 75 (3) | − | 217 | 90 | 20 | 10 | 0 | 10 | 0.59 (0.102) | 0.17 (0.117) | 0.43 (0.159) | 0.1* (0.092) |
| + | 200 | 79 | 48 | 25 | 21 | 46 | 0.6 (0.066) | 0.4 (0.047) | 0.94 (0.04) | 0.23* (0.038) |
Productivity of FL19 transposition lines.
Total count of offspring from at least three replicates.
On diet without tetracycline this is the number of males divided by the number of eggs times two. On diet with tetracycline this is the total number of adults divided by the number of eggs. NS, indicates not significantly different compared to wild type (est. 2011). * indicates significantly reduced adult production compared to wild type (est. 2011) (p < 0.0016 for + tetracycline and p < 0.0033 on no tetracycline, see methods for details). ** indicates significantly reduced adult production compared to wild type (newly established).
The sexual competitiveness of the males from the lines was assessed by presenting virgin wild type females with equal numbers of transgenic and wild type males as done previously with the C. hominivorax male-only strains (
TABLE 6
| Line (chromosome) | Number replicates | Number mated with transgenic | Number mated with wild type | Number mated with both males (remating) | Total mated | MCIa (SE) | p-value |
|---|---|---|---|---|---|---|---|
| FL19 (3) | 7 | 16 | 48 | 3 | 67 | 0.27 (0.06) | 0.0002 |
| 7 (X) + FL19 (3) | 4 | 14 | 23 | 1 | 38 | 0.39 (0.08) | 0.1944 |
| 8 (3) | 6 | 16 | 40 | 0 | 56 | 0.29 (0.07) | 0.0013 |
| 36 (3) | 5 | 25 | 18 | 1 | 44 | 0.59 (0.08) | 0.2278 |
| 40 (3) | 8 | 15 | 46 | 9 | 70 | 0.29 (0.06) | 0.0003 |
| 70 (3) | 7 | 14 | 46 | 3 | 63 | 0.25 (0.06) | <0.0001 |
| 75 (3) | 4 | 7 | 26 | 1 | 34 | 0.24 (0.09) | 0.0020 |
Male sexual competitiveness.
Mating competitiveness index or MCI, is the number mated with transgenic plus half the number that remated divided by the total number mated.
Discussion
In this study, the FL19 transgene reported recently (
The frequency of remobilization seen in this study was much lower than reported previously with the H7 piggyBac jumpstarter strain (
One aim of this study was to produce strains with two copies of the FL19 transgene that could be tested against strains with different genetic backgrounds. For example, by crossing transgenic males with virgin female wild type flies from Western and Eastern US populations which are genetically quite distinct (
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Author contributions
AY design research, performed the crosses, collected and analyzed the data. AmY carried out the molecular analyses of the strains and analyzed the data. MS designed research, analyzed data, performed some of the statistical analyses, wrote the first draft and obtained funding for this project. All authors read, edited and approved the final manuscript.
Funding
This research was supported by funding from the National Institute of Food and Agriculture, U.S. Department of Agriculture Specialty Crops Research Initiative under agreement No. 2015-51181-24252 and a cooperative agreement with USDA-APHIS (award # AP17PPQS&T00C165).
Acknowledgments
We thank Emily Griffith for statistical analyses, Hannah Burrack for Drosophila suzukii collected in North Carolina and our colleagues in the Scott lab for helpful discussions.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fbioe.2022.829620/full#supplementary-material
References
1
AlpheyL. (2014). Genetic Control of Mosquitoes. Annu. Rev. Entomol.59, 205–224. 10.1146/annurev-ento-011613-162002
2
AntT.KoukidouM.RempoulakisP.GongH.-F.EconomopoulosA.VontasJ.et al (2012). Control of the Olive Fruit Fly Using Genetics-Enhanced Sterile Insect Technique. BMC Biol.10, 51. 10.1186/1741-7007-10-51
3
AsplenM. K.AnforaG.BiondiA.ChoiD.-S.ChuD.DaaneK. M.et al (2015). Invasion Biology of Spotted wing Drosophila (Drosophila Suzukii): a Global Perspective and Future Priorities. J. Pest Sci.88 (3), 469–494. 10.1007/s10340-015-0681-z
4
BurrackH. J.FernandezG. E.SpiveyT.KrausD. A. (2013). Variation in Selection and Utilization of Host Crops in the Field and Laboratory byDrosophila suzukiiMatsumara (Diptera: Drosophilidae), an Invasive Frugivore. Pest Manag. Sci.69 (10), 1173–1180. 10.1002/ps.3489
5
ChiuJ. C.JiangX.ZhaoL.HammC. A.CridlandJ. M.SaelaoP.et al (2013). Genome of Drosophila Suzukii, the Spotted wing drosophila. G3 (Bethesda)3 (12), 2257–2271. 10.1534/g3.113.008185
6
ChuF. C.KlobasaW.GrubbsN.LorenzenM. D. (2018). Development and Use of a piggyBac ‐based Jumpstarter System in Drosophila Suzukii. Arch. Insect Biochem. Physiol.97 (3), 1–14. 10.1002/arch.21439
7
CiniA.AnforaG.Escudero-ColomarL. A.GrassiA.SantosuossoU.SeljakG.et al (2014). Tracking the Invasion of the Alien Fruit Pest Drosophila Suzukii in Europe. J. Pest Sci.87 (4), 559–566. 10.1007/s10340-014-0617-z
8
ConchaC.PalavesamA.GuerreroF. D.SagelA.LiF.OsborneJ. A.et al (2016). A Transgenic Male-Only Strain of the New World Screwworm for an Improved Control Program Using the Sterile Insect Technique. BMC Biol.14, 72. 10.1186/s12915-016-0296-8
9
ConchaC.YanY.ArpA.QuilarqueE.SagelA.de LeónA. P.et al (2020). An Early Female Lethal System of the New World Screwworm, Cochliomyia Hominivorax, for Biotechnology-Enhanced SIT. BMC Genet.21 (Suppl. 2), 143. 10.1186/s12863-020-00948-x
10
DanielsS. B.ChovnickA. (1993). P Element Transposition in Drosophila melanogaster: an Analysis of Sister-Chromatid Pairs and the Formation of Intragenic Secondary Insertions during Meiosis. Genetics133 (3), 623–636. 10.1093/genetics/133.3.623
11
DavisR. J.BelikoffE. J.SchollE. H.LiF.ScottM. J. (2018). No Blokes Is Essential for Male Viability and X Chromosome Gene Expression in the Australian Sheep Blowfly. Curr. Biol.28 (12), 1987–1992. 10.1016/j.cub.2018.05.005
12
ElsensohnJ. E.AlyM. F. K.SchalC.BurrackH. J. (2021). Social Signals Mediate Oviposition Site Selection in Drosophila Suzukii. Sci. Rep.11 (1), 3796. 10.1038/s41598-021-83354-2
13
EvansB. R.KotsakioziP.Costa-da-SilvaA. L.IoshinoR. S.GarzieraL.PedrosaM. C.et al (2019). Transgenic Aedes aegypti Mosquitoes Transfer Genes into a Natural Population. Sci. Rep.9 (1), 13047. 10.1038/s41598-019-49660-6
14
FitzsimonsH. L.HenryR. A.ScottM. J. (1999). Development of an Insulated Reporter System to Search for Cis-Acting DNA Sequences Required for Dosage Compensation in Drosophila. Genetica105 (3), 215–226. 10.1023/a:1003801402153
15
FuG.CondonK. C.EptonM. J.GongP.JinL.CondonG. C.et al (2007). Female-specific Insect Lethality Engineered Using Alternative Splicing. Nat. Biotechnol.25 (3), 353–357. 10.1038/nbt1283
16
GossenM.BujardH. (1992). Tight Control of Gene Expression in Mammalian Cells by Tetracycline-Responsive Promoters. Proc. Natl. Acad. Sci.89 (12), 5547–5551. 10.1073/pnas.89.12.5547
17
GressB. E.ZalomF. G. (2019). Identification and Risk Assessment of Spinosad Resistance in a California Population of Drosophila Suzukii. Pest Manag. Sci.75 (5), 1270–1276. 10.1002/ps.5240
18
GretherM. E.AbramsJ. M.AgapiteJ.WhiteK.StellerH. (1995). The Head Involution Defective Gene of Drosophila melanogaster Functions in Programmed Cell Death. Genes Dev.9 (14), 1694–1708. 10.1101/gad.9.14.1694
19
Harvey-SamuelT.MorrisonN. I.WalkerA. S.MarubbiT.YaoJ.CollinsH. L.et al (2015). Pest Control and Resistance Management through Release of Insects Carrying a Male-Selecting Transgene. BMC Biol.13, 49. 10.1186/s12915-015-0161-1
20
HauserM. (2011). A Historic Account of the Invasion of Drosophila Suzukii (Matsumura) (Diptera: Drosophilidae) in the continental United States, with Remarks on Their Identification. Pest Manag. Sci.67 (11), 1352–1357. 10.1002/ps.2265
21
HeinrichJ. C.ScottM. J. (2000). A Repressible Female-specific Lethal Genetic System for Making Transgenic Insect Strains Suitable for a Sterile-Release Program. Proc. Natl. Acad. Sci.97 (15), 8229–8232. 10.1073/pnas.140142697
22
HornC.WimmerE. A. (2003). A Transgene-Based, Embryo-specific Lethality System for Insect Pest Management. Nat. Biotechnol.21 (1), 64–70. 10.1038/nbt769
23
KandulN. P.BelikoffE. J.LiuJ.BuchmanA.LiF.YamamotoA.et al (2021). Genetically Encoded CRISPR Components Yield Efficient Gene Editing in the Invasive Pest Drosophila Suzukii. CRISPR J.4 (5), 739–751. 10.1089/crispr.2021.0032
24
KenisM.ToninaL.EschenR.van der SluisB.SancassaniM.MoriN.et al (2016). Non-crop Plants Used as Hosts by Drosophila Suzukii in Europe. J. Pest Sci.89 (3), 735–748. 10.1007/s10340-016-0755-6
25
KnudsenK. E.ReidW. R.BarbourT. M.BowesL. M.DuncanJ.PhilpottE.et al (2020). Genetic Variation and Potential for Resistance Development to the tTA Overexpression Lethal System in Insects. G3 (Bethesda)10 (4), 1271–1281. 10.1534/g3.120.400990
26
LeeJ. C.DrevesA. J.CaveA. M.KawaiS.IsaacsR.MillerJ. C.et al (2015). Infestation of Wild and Ornamental Noncrop Fruits by Drosophila Suzukii (Diptera: Drosophilidae). Ann. Entomol. Soc. America108 (2), 117–129. 10.1093/aesa/sau014
27
LeftwichP. T.KoukidouM.RempoulakisP.GongH.-F.ZacharopoulouA.FuG.et al (2014). Genetic Elimination of Field-Cage Populations of Mediterranean Fruit Flies. Proc. R. Soc. B.281 (1792), 20141372. 10.1098/rspb.2014.1372
28
LewaldK. M.AbrieuxA.WilsonD. A.LeeY.ConnerW. R.AndreazzaF.et al (2021). Population Genomics of Drosophila Suzukii Reveal Longitudinal Population Structure and Signals of Migrations in and Out of the continental United States. G3 (Bethesda)11, jkab343. 10.1093/g3journal/jkab343
29
LiF.WantuchH. A.LingerR. J.BelikoffE. J.ScottM. J. (2014). Transgenic Sexing System for Genetic Control of the Australian Sheep Blow Fly Lucilia cuprina. Insect Biochem. Mol. Biol.51, 80–88. 10.1016/j.ibmb.2014.06.001
30
LiF.YamamotoA.BelikoffE. J.BergerA.GriffithE. H.ScottM. J. (2021). A Conditional Female Lethal System for Genetic Suppression of the Global Fruit Crop Pest Drosophila Suzukii. Pest Manag. Sci.77 (11), 4915–4922. 10.1002/ps.6530
31
LiX.HeinrichJ. C.ScottM. J. (2001). piggyBac-Mediated Transposition in Drosophila melanogaster: an Evaluation of the Use of Constitutive Promoters to Control Transposase Gene Expression. Insect Mol. Biol.10, 447–455. 10.1046/j.0962-1075.2001.00283.x
32
MackayT. F. C.RichardsS.StoneE. A.BarbadillaA.AyrolesJ. F.ZhuD.et al (2012). The Drosophila melanogaster Genetic Reference Panel. Nature482 (7384), 173–178. 10.1038/nature10811
33
ParisM.BoyerR.JaenichenR.WolfJ.KarageorgiM.GreenJ.et al (2020). Near-chromosome Level Genome Assembly of the Fruit Pest Drosophila Suzukii Using Long-Read Sequencing. Sci. Rep.10 (1), 11227. 10.1038/s41598-020-67373-z
34
SassùF.NikolouliK.CaravantesS.TaretG.PereiraR.VreysenM. J. B.et al (2019). Mass-Rearing of Drosophila Suzukii for Sterile Insect Technique Application: Evaluation of Two Oviposition Systems. Insects10 (12), 448. 10.3390/insects10120448
35
SchliekelmanP.GouldF. (2000). Pest Control by the Release of Insects Carrying a Female-Killing Allele on Multiple Loci. ec93 (6), 1566–1579. 10.1603/0022-0493-93.6.1566
36
SheltonA. M.LongS. J.WalkerA. S.BoltonM.CollinsH. L.RevueltaL.et al (2020). First Field Release of a Genetically Engineered, Self-Limiting Agricultural Pest Insect: Evaluating its Potential for Future Crop Protection. Front. Bioeng. Biotechnol.7 (482). 10.3389/fbioe.2019.00482
37
SpradlingA. C.RubinG. M. (1983). The Effect of Chromosomal Position on the Expression of the Drosophila Xanthine Dehydrogenase Gene. Cell34 (1), 47–57. 10.1016/0092-8674(83)90135-6
38
TaitG.MermerS.StocktonD.LeeJ.AvosaniS.AbrieuxA.et al (2021). Drosophila Suzukii (Diptera: Drosophilidae): A Decade of Research towards a Sustainable Integrated Pest Management Program. J. Econ. Entomol.114 (5), 1950–1974. 10.1093/jee/toab158
39
ThomasD. D.DonnellyC. A.WoodR. J.AlpheyL. S. (2000). Insect Population Control Using a Dominant, Repressible, Lethal Genetic System. Science287 (5462), 2474–2476. 10.1126/science.287.5462.2474
40
WangB.LiK.WangA.ReiserM.SaundersT.LockeyR. F.et al (2015). Highly Efficient CRISPR/HDR-mediated Knock-In for Mouse Embryonic Stem Cells and Zygotes. Biotechniques59 (4), 201206–202208. 10.2144/000114339
Summary
Keywords
Drosophila suzukii, piggyBac transposon, sterile insect technique, spotted wing drosophila, fsRIDL
Citation
Yamamoto A, Yadav AK and Scott MJ (2022) Evaluation of Additional Drosophila suzukii Male-Only Strains Generated Through Remobilization of an FL19 Transgene. Front. Bioeng. Biotechnol. 10:829620. doi: 10.3389/fbioe.2022.829620
Received
06 December 2021
Accepted
27 January 2022
Published
15 March 2022
Volume
10 - 2022
Edited by
Amanda Choo, University of Adelaide, Australia
Reviewed by
Maria Vittoria Mancini, MRC-University of Glasgow Centre For Virus Research (MRC), United Kingdom
Ran Wang, Beijing Academy of Agricultural and Forestry Sciences, China
Updates

Check for updates
Copyright
© 2022 Yamamoto, Yadav and Scott.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Maxwell J. Scott, mjscott3@ncsu.edu
This article was submitted to Biosafety and Biosecurity, a section of the journal Frontiers in Bioengineering and Biotechnology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.