Abstract
D-Allulose is an ultra-low calorie sweetener with broad market prospects. As an alternative to Izumoring, phosphorylation-dephosphorylation is a promising method for D-allulose synthesis due to its high conversion of substrate, which has been preliminarily attempted in enzymatic systems. However, in vitro phosphorylation-dephosphorylation requires polyphosphate as a phosphate donor and cannot completely deplete the substrate, which may limit its application in industry. Here, we designed and constructed a metabolic pathway in Escherichia coli for producing D-allulose from D-fructose via in vivo phosphorylation-dephosphorylation. PtsG-F and Mak were used to replace the fructose phosphotransferase systems (PTS) for uptake and phosphorylation of D-fructose to fructose-6-phosphate, which was then converted to D-allulose by AlsE and A6PP. The D-allulose titer reached 0.35 g/L and the yield was 0.16 g/g. Further block of the carbon flux into the Embden-Meyerhof-Parnas (EMP) pathway and introduction of an ATP regeneration system obviously improved fermentation performance, increasing the titer and yield of D-allulose to 1.23 g/L and 0.68 g/g, respectively. The E. coli cell factory cultured in M9 medium with glycerol as a carbon source achieved a D-allulose titer of ≈1.59 g/L and a yield of ≈0.72 g/g on D-fructose.
Introduction
D-Allulose is a United States Food and Drug Administration (FDA)-approved sweetener with ultra-low calorie content and unique physiological functions (; ; ), thus considered as a potential alternative to sucrose and owning broad market prospects (). Currently, D-allulose is industrially produced from D-fructose through enzymatic Izumoring (), which reversibly epimerizes D-fructose at its C-3 position using D-allulose 3-epimerase (DAE) or D-tagatose 3-epimerase (DTE) as a biocatalyst (). The major drawback of Izumoring is the low conversion of D-fructose, only reaching around 30% at equilibrium (; ; ). Continuous removal of D-allulose from the reaction system may improve conversion efficiency, but the coupling of isomer separation with Izumoring epimerization will definitely increase product cost (; ).
Recently, an in vitro enzymatic biosystem based on phosphorylation-dephosphorylation has been proposed for producing D-allulose from starch (). This strategy differed from Izumoring in its innovative use of epimerization between hexose monophosphates. After obtaining fructose-6-phosphate through phosphorylation and other reactions, allulose-6-phosphate epimerase (A6PE) catalyzed the reversible conversion of fructose-6-phosphate to allulose-6-phosphate, which was then dephosphorylated by allulose-6-phosphate phosphatase (A6PP) to generate D-allulose (). It is quite important that dephosphorylation was irreversible (), which broke the epimerization equilibrium and drove the reactions towards target product. Although the resulting conversion ratio of D-fructose was much higher than with Izumoring, a certain amount of D-fructose would remain in products (<18%) since A6PP also exhibited a side activity on dephosphorylating fructose-6-phosphate (). Moreover, the enzymatic phosphorylation reaction in this system required expensive polyphosphate (polyP) as a phosphate donor (; ), which might limit its large-scale application.
In contrast to enzymatic approach, fermentation may be a way that can fully release the application potential of phosphorylation-dephosphorylation strategy in the production of D-allulose from D-fructose, in which rational design of a microbial cell factory is the key to ensuring high fermentation performance (; ). Escherichia coli is one of the most widely used bacterial hosts for cell factory development due to its clear genetic background, easy manipulation, and rapid growth (). E. coli can utilize D-fructose as a sole carbon source and has three routes for D-fructose uptake and phosphorylation (; ), two of which are phosphoenolpyruvate (PEP): carbohydrate phosphotransferase systems (PTS). The fructose PTS (fruA, fruB) transports and concomitantly phosphorylates D-fructose to fructose-1-phosphate (). The mannose PTS (manXYZ) can recognize sugars with the 3, 4, 5-D-arabino-hexose configuration (), and the D-fructose taken up by this system appears in cells as fructose 6-phosphate (). The fructose PTS and mannose PTS use PEP as a phosphate donor, and the resulting fructose monophosphates will be further phosphorylated to fructose-1, 6-bisphosphate before entering the central metabolic pathway (). In addition to PTS, a mutant of glucose permease involved in the glucose PTS, which is specified by ptsG-F, has been found to possess the ability to transport D-fructose via facilitated diffusion (). Once D-fructose is passaged, it can be phosphorylated to fructose 6-phosphate by an intracellular fructo/manno kinase (mak) with ATP as a phosphate donor (). Therefore, the well-defined mechanisms for D-fructose transport and phosphorylation provide a prerequisite for application of phosphorylation-dephosphorylation in E. coli. Also, this bacterium is reported to own an endogenous allulose-6-phosphate epimerase encoded by alsE, whose kinetic parameters, substrate specificity and metal ion preference have been comprehensively investigated (), suggesting that it is possible for wild-type E. coli to efficiently convert fructose-6-phosphate to allulose-6-phosphate.
In this work, we designed a metabolic pathway for D-allulose production from D-fructose via phosphorylation-dephosphorylation in E. coli JM109 (DE3) (Figure 1). The fructose PTS was substituted by use of ptsG-F and mak, ensuring that D-fructose could be taken up and phosphorylated to fructose-6-phosphate by cells. The E. coli alsE was employed to catalyze the reversible reaction from fructose-6-phosphate to allulose-6-phosphate, followed by dephosphorylation by an allulose-6-phosphate phosphatase from Bacteroides fragilis (). The by-product synthesis pathways and the Embden-Meyerhof-Parnas (EMP) pathway were blocked to increase the yield of product. A PEP carboxykinase (pckA) from Actinobacillus succinogenes (), which catalyzed the formation of oxaloacetate (OAA) and ATP from PEP, CO2, and ADP, was introduced in E. coli cell factory to build an ATP regeneration system, with the purpose to enhance the supply of ATP as a phosphate donor for D-fructose phosphorylation. This work is expected to provide a strategy for efficient fermentative production of D-allulose, and the research achievements will promote the application of metabolic engineering in green biomanufacturing.
FIGURE 1
Materials and Methods
Strains and Media
The strains used in this study were listed in Table 1. E. coli Trans 10 was used for plasmid construction. E. coli JM109 (DE3) was employed as a host for protein expression and D-allulose production. Luria-Bertani (LB) medium was composed of 10.00 g/L NaCl, 10.00 g/L tryptone, and 5.00 g/L yeast extract. M9 minimal medium contained 0.50 g/L NaCl, 0.50 g/L NH4Cl, 0.84 mg/L ZnCl2, 44.10 mg/L CaCl2 2H2O, 8.30 mg/L FeCl3·6H2O, 0.13 mg/L CuCl2·2H2O, 0.10 mg/L CoCl2·2H2O, 0.02 mg/L MnCl2·4H2O, 0.25 g/L MgSO4·7H2O, 0.10 mg/L H3BO3, 7.52 g/L Na2HPO4·2H2O, 3.00 g/L KH2PO4, 50.00 mg/L EDTA, 1.00 mg/L thiamin, and 1.00 mg/L biotin.
TABLE 1
| Name | Relevant characteristics | References |
|---|---|---|
| Strains | ||
| E. coli Trans 10 | F−mcrA Δ(mrr-hsdRMS-mcrBC) φ80 lacZΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG | Trans gen biotech |
| E. coli JM109 (DE3) | EndA1 recA1 gyrA96 thi hsdR17 (rk−, mk+) relA1 supE44 λ− Δ(lac-proAB) [F′ traD36 proAB lacIq Δ(lacZ)M15] λ(DE3) | BeNa culture collection |
| E. coli (control) | E. coli JM109 (DE3) harboring pRSFDuet-1 | This study |
| E. coli (a6PP) | E. coli JM109 (DE3) harboring pRSFDuet-a6PP | This study |
| E. coli (alsE) | E. coli JM109 (DE3) harboring pRSFDuet-alsE | This study |
| E. coli (alsE, a6PP) | E. coli JM109 (DE3) harboring pRSFDuet-alsE-a6PP | This study |
| E. coli (alsE, a6PP, ΔfruA) | E. coli JM109 (DE3) harboring pETDuet-1 and pRSFDuet-alsE-a6PP with deletion of fruA | This study |
| E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA) | E. coli JM109 (DE3) harboring pETDuet-ptsG-F-mak and pRSFDuet-alsE-a6PP with deletion of fruA | This study |
| E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA, ΔpfkA) | E. coli JM109 (DE3) harboring pETDuet-ptsG-F-mak and pRSFDuet-alsE-a6PP with deletion of fruA and pfkA | This study |
| E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA, ΔpfkA, ΔpfkB) | E. coli JM109 (DE3) harboring pETDuet-ptsG-F-mak and pRSFDuet-alsE-a6PP with deletion of fruA, pfkA, and pfkB | This study |
| E. coli (ΔfruA, ΔpfkA, ΔpfkB) | E. coli JM109 (DE3) harboring pRSFDuet-1 with deletion of fruA, pfkA, and pfkB | This study |
| E. coli (pckA, ΔfruA, ΔpfkA, ΔpfkB) | E. coli JM109 (DE3) harboring pRSFDuet-pckA with deletion of fruA, pfkA, and pfkB | This study |
| E. coli (alsE, a6PP, ptsG-F, mak, pckA, ΔfruA, ΔpfkA, ΔpfkB) | E. coli JM109 (DE3) harboring pETDuet-ptsG-F-mak and pRSFDuet-alsE-a6PP-pckA with deletion of fruA, pfkA, and pfkB | This study |
| Plasmids | ||
| pRSFDuet-1 | Vector for protein expression under control of T7 promoter, kanR | Novagen |
| pETDuet-1 | Vector for protein expression under control of T7 promoter, AmpR | Novagen |
| pRSFDuet-a6PP | pRSFDuet-1 carrying a6PP | This study |
| pRSFDuet-alsE | pRSFDuet-1 carrying alsE | This study |
| pRSFDuet-pckA | pRSFDuet-1 carrying pckA | This study |
| pRSFDuet-alsE-a6PP | pRSFDuet-1 carrying alsE and a6PP | This study |
| pETDuet-ptsG-F-mak | pETDuet-1 carrying ptsG-F, and mak | This study |
| pRSFDuet-alsE-a6PP-pckA | pRSFDuet-1 carrying alsE, a6PP and pckA | This study |
| pKD46, pKD13, pCP20 | λ red recombination system | |
The strains and plasmids used in this study.
Plasmid Construction
The plasmids of pETDuet-1 (ampicillin-resistant) and pRSFDuet-1 (kanamycin-resistant) were purchased from Novagen and used to express proteins with T7 promoter. The genes of ptsG-F (), mak (Gene ID 949086), alsE (Gene ID 948595), a6PP (Gene ID 66330010), and pckA () were synthesized with codon optimization by Sangon Biotech (Shanghai). Cloning of ptsG-F and mak into pETDuet-1 was carried out by use of primers ptsG-F-F and ptsG-F-R, mak-F and mak-R, respectively. The primers for cloning alsE, a6PP, and pckA into pRSFDuet-1 were alsE-F and alsE-R, a6PP-F and a6PP-R, pckA-F and pckA-R. The primers used in this study were summarized in Table 2. The PCR products were digested with restriction endonucleases (New England Biolabs) and then ligated into plasmids by T4 DNA ligase (New England Biolabs). The recombinant plasmids constructed in this study were shown in Table 1.
TABLE 2
| Name | Primer sequence (5′→3′) | Description |
|---|---|---|
| Plasmid construction | ||
| ptsG-F-F | CGGGATCCGATGTTTAAGAATGCATTTGCTAAC | Clone and insert ptsG-F into BamH I and Hind III on pETDuet-1 |
| ptsG-F-R | CCCAAGCTTTTAGTGGTTACGGATGTACTC | |
| mak-F | GGAATTCCATATGGTGCGTATAGGTATCG | Clone and insert mak into Nde I and Kpn I on pETDuet-ptsG-F |
| mak-R | GGGGTACCTTACTCTTGTGGCCATAACCACGC | |
| a6PP-F | GGAATTCCATATGAAATACACCGTTTACCTGTTCG | Clone and insert a6PP into Nde I and Kpn I on pRSFDuet-1 |
| a6PP-R | GGGGTACCTTACAGCGGGCAACCAGATTTATCTTC | |
| alsE-F | CATGCCATGGGCATGAAAATCTCCCCCTC | Clone and insert alsE into Nco I and Hind III on pRSFDuet-1 or pRSFDuet-a6PP. |
| alsE-R | CCCAAGCTTTTATGCTGTTTTTGCATGAG | |
| pckA-F | CCGCTCGAGCCTGTAGAAATAATTTTGTTTAACTTTAATAAGGAGATATACCATGAGCTTATCTGAAAG | Clone and insert pckA into Xho I and Avr II on pRSFDuet-1 or pRSFDuet-a6PP-alsE |
| pckA-R | CCGCCTAGGTTATAACTGTGGACCAGCC | |
| Gene deletion | ||
| fruA-F | CTGACAGCAGGAGAGGCATAATGAAAACGCTGCTGATTATTGACGCTAATATTCCGGGGATCCGTCGACC | Delete fruA |
| fruA-R | GCCCTGTAACACACCTTTTATTACGCTGCTTTCGCTACTGCGTCCACTTCGTGTAGGCTGGAGCTGCTTCG | |
| pfkA-F | GTTCAGAGGTAGTCATGATTAAGAAAATCGGTGTGTTGACAAGCGGCGGTTGTGTAGGCTGGAGCTGCTTCG | Delete pfkA |
| pfkA-R | CGAAATCATTAATACAGTTTTTTCGCGCAGTCCAGCCAGTCACCTTTGAAATTCCGGGGATCCGTCGACC | |
| pfkB-F | CTGATTCGGTGCCAGACTGAAATCAGCCTATAGGAGGAAATGATGGTACGTATCTGTGTAGGCTGGAGCTGCTTCG | Delete pfkB |
| pfkB-R | GTTGGTGATGATTCCCCCAATGCTGGGGGAATGTTTTTGTTAGCGGGAAAGGATTCCGGGGATCCGTCGACC | |
The primers used in this study.
Protein Expression and Enzymatic Analysis
E. coli cells were grown in 200 ml LB medium with kanamycin (50 μg/ml) at 37°C and 220 rpm. After 3 h of cultivation, we added 0.4 mM isopropyl-β-D-thiogalactoside (IPTG) to the medium to induce the expression of A6PP or AlsE for 12 h. Cells were harvested by centrifugation at 4°C and 6,000 g for 10 min and re-suspended in Tris-HCl buffer (pH 7.5, 50 mM), which were then broken by use of an ultrasonic cell crusher JY92-IIN (Jingxin, Shanghai). The sonication was performed on ice for 5 min (2 s pulse on and 2 s pulse off) at 50% amplitude. Cell debris was removed by centrifugation at 4°C and 6,000 g for 5 min. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) was carried out using 8% polyacrylamide gels (Jinruisi Biotech, Nanjing) for analyzing the supernatant. We added the crude enzyme (20 μl, 10 mg/ml) to 1 ml Tris-HCl buffer (pH 7.5, 50 mM) containing 2.60 g/L fructose-6-phosphate, and the reaction was conducted at 37°C for 30 min for enzyme assay.
Gene Knockout
Deletion of fruA (Gene ID 946672), pfkA (Gene ID 948412), and pfkB (Gene ID 946230) was achieved by a λ red homologous recombination system (). The DNA fragments were amplified with pKD13 (kanamycin-resistant) as a template (), and the primers were listed in Table 2. E. coli JM109 (DE3) harboring pKD46 (ampicillin-resistant) were grown in LB medium with ampicillin (100 μg/ml) at 30°C and 220 rpm, until the cell density (OD600) reached ≈0.3. Then L-arabinose (4 g/L) was added to induce the expression of homologous recombinase at 37°C and 220 rpm for 1 h (). The DNA fragments were electroporated into the L-arabinose-induced cells for gene knockout. The plasmid of pCP20 (ampicillin and chloramphenicol-resistant) was used to remove the kanamycin resistance gene in recombinant cells ().
Fermentation
E. coli cells were inoculated in 4 ml LB medium containing appropriate antibiotics and grown overnight at 37°C and 220 rpm. Cells were transferred to the flask with 50 ml LB medium containing appropriate antibiotics and 4.00 g/L D-fructose. Potassium phosphate (100 mM) was used to maintain the pH of the fermentation broth, and IPTG (0.4 mM) was added to induce protein expression. Air-limited fermentation was carried out in the airtight bottle with either buffered-LB medium or M9 minimal medium containing appropriate antibiotics, 2.20 g/L D-fructose, 8.00 g/L glycerol, and 0.4 mM IPTG.
Analytical Approach
Cell density was determined by a microplate reader (Multiskan™ FC, Thermo Scientific). The ATP in cells was measured through an ATP Content Assay Kit (BC0300, Solarbio) as previously reported (). D-Allulose, D-fructose, and glycerol were determined using a high-performance liquid chromatograph (HPLC, HITACHI) equipped with a refractive index detector (RID) monitor. Sugar-Pak™ I Column (85°C, Waters) was used with deionized water as the mobile phase at a flow rate of 0.5 ml/min.
Results and Discussion
Biosynthesis of D-Allulose Through Phosphorylation-Dephosphorylation
Wild-type E. coli is able to grow on D-fructose as a carbon source owing to its fructose PTS and mannose PTS (). The D-fructose passaged via mannose PTS appears in cells as fructose-6-phosphate (), which can be epimerized to allulose-6-phosphate due to the presence of allulose-6-phosphate epimerase (alsE) (). Therefore, the key to establishing a phosphorylation-dephosphorylation pathway in E. coli for D-allulose synthesis is the introduction of an appropriate allulose-6-phosphate phosphatase for allulose-6-phosphate dephosphorylation.
We selected an allulose-6-phosphate phosphatase (a6PP) from B. fragilis since it exhibited a high activity at moderate temperatures. Expression of a6PP was carried out in E. coli JM109 (DE3), resulting in the strain E. coli (a6PP). As shown in Figure 2A, the SDS-PAGE results indicate that this enzyme was expressed in a soluble form with a molecular mass of ≈25 kDa. Unfortunately, it was found that E. coli (a6PP) could not produce D-allulose by fermentation even if D-fructose was supplemented in culture medium (LB), which is in good agreement with the experimental results of the in vitro assay (Figure 2B). We sonicated E. coli (a6PP) after induction and utilized the supernatant to catalyze the cascade of epimerization and dephosphorylation using fructose-6-phosphate as a substrate, and observed the absence of target product in the reaction system. Although we reconfirmed that the genome of E. coli JM109 (DE3) has the gene of alsE, its weak expression in cells might be unable to generate sufficient allulose-6-phosphate from fructose-6-phosphate. Therefore, we cloned and over-expressed alsE by use of E. coli (alsE), finding the molecular mass of AlsE was close to that of A6PP, but its expression level was quite low under the same promoter and induction conditions (Figure 2A). When a mixed crude enzyme solution of AlsE and A6PP was tested in vitro, it could produce 1.10 g/L D-allulose and 0.47 g/L D-fructose from 2.60 g/L fructose-6-phosphate within 30 min (Figures 2B,C), which demonstrates the functionalities of AlsE and A6PP in the pathway from fructose-6-phosphate to D-allulose and confirms the presence of an activity of A6PP on fructose-6-phosphate dephosphorylation. Then we co-expressed alsE and a6PP in E. coli JM109 (DE3), resulting in the strain E. coli (alsE, a6PP). Figure 3 shows that 0.07 g/L D-allulose could be generated when E. coli (alsE, a6PP) was cultured in the LB medium supplemented with 4.00 g/L D-fructose at 37°C for 60 h.
FIGURE 2
FIGURE 3
Regulation of Metabolic Pathways to Increase Cell Factory Efficiency
Although E. coli (alsE, a6PP) was capable of producing D-allulose from D-fructose by fermentation, the titer and yield were quite low. The fructose PTS has been reported to play a predominant role in D-fructose transport and phosphorylation in E. coli (), so most of the D-fructose entering cells should be in the form of fructose-1-phosphate rather than fructose-6-phosphate. Fructose-1-phosphate is not a biosynthetic precursor for the D-allulose synthesis pathway and can only flow into the EMP pathway as a carbon source for cell growth. We thus deleted the gene of fruA to damage the fructose PTS in E. coli (alsE, a6PP). As illustrated in Figure 4A, the fermentation performance of E. coli (alsE, a6PP, ΔfruA) was slightly improved, with a D-allulose titer of 0.11 g/L and a yield of 0.09 g/g. However, D-fructose could not be depleted, and over 71% remained in the LB medium after 72 h. It is probable that the loss of fructose PTS severely reduced the ability of cells to take up D-fructose. We then employed the gene of ptsG-F to construct a facilitated diffusion passageway for D-fructose transport and the gene of mak for subsequent phosphorylation at its C-6 position (). The D-allulose titer of E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA) reached 0.35 g/L, with a product yield of 0.16 g/g (Figure 4B). In this case, we found an obvious deterioration in cell growth, probably due to the sharp drop in pH during fermentation, which was caused by the dephosphorylation of fructose-6-phosphate. As shown in Figure 4C, buffering LB medium with 100 mM potassium phosphate was able to limit this acidification to pH 5.7 after 72 h, and the D-allulose titer increased to 0.51 g/L, with depletion of 4.03 g/L D-fructose.
FIGURE 4
In E. coli cells, fructose-6-phosphate can also be phosphorylated into fructose-1, 6-bisphosphate by 6-phosphofructokinases (pfkA, pfkB) and utilized as a carbon source through the EMP pathway (). Therefore, blocking the phosphorylation of fructose-6-phosphate may favor the synthesis of D-allulose. The results in Figure 5A show that deletion of pfkA in E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA) increased the D-allulose titer and yield to 0.72 g/L and 0.18 g/g, respectively. When both pfkA and pfkB were knocked out (Figure 5B), the titer and yield were further improved, especially the product yield could reach 0.61 g/g on D-fructose, but it significantly affected cell growth, probably due to the limitation of the carbon flux into the EMP pathway. Moreover, the balance of the endogenous gene expression in E. coli cells might be affected after gene knockout, and a reported solution was to construct gene-inactivated libraries (; ).
FIGURE 5
Coupling of ATP Regeneration System to Improve Cofactor Supply
Replacing the fructose PTS with ptsG-F and mak allowed D-fructose to be transported and concomitantly phosphorylated to fructose-6-phosphate, a precursor for D-allulose synthesis. Another consequence of this substitution was that the phosphate donor required for D-fructose phosphorylation changed from PEP to ATP, so the D-allulose titer of E. coli should be closely tied to the ability of cell factory to provide ATP. Our results show that deletion of pfkA and pfkB increased the product yield by blocking the entry of fructose-6-phosphate into the EMP pathway, but it might lead to a restriction in cellular ATP generation. To maximize D-allulose level, it is essential to develop a complementary strategy that yields ATP.
Since inactivation of fructose PTS was believed to increase the PEP pool in E. coli cells (), it should be a prior consideration to utilize PEP-related reactions to enhance ATP formation. OAA is a source of four-carbon dicarboxylic acid for the tricarboxylic acid (TCA) cycle and can be formed reversibly from PEP in E. coli by using PEP-carboxylase (ppc) (; ). In contrast, the conversion of PEP to OAA in A. succinogenes is catalyzed by PEP-carboxykinase (pckA) (), which requires ADP as a phosphate acceptor and thus facilitates ATP generation in cells. We then expressed pckA via T7 promoter in E. coli (ΔfruA, ΔpfkA, ΔpfkB) and measured the changes in cellular ATP content. The data in Figure 6A show that use of pckA resulted in a 0.4-fold increase in ATP level, whereas this increase was able to rise to 1.1-fold by reducing air supply during cell cultivation, which is consistent with previous findings that PEP-carboxykinase catalyzed the reversible reaction towards the ATP-generating direction at high CO2 concentrations (). Figure 6B illustrates that the D-allulose titer and yield of E. coli (alsE, a6PP, ptsG-F, mak, pckA, ΔfruA, ΔpfkA, ΔpfkB) grown in buffered-LB medium with air-limitation condition reached 1.23 g/L and 0.68 g/g, respectively, as a result of increased ATP inside cells.
FIGURE 6
Production of D-Allulose in Minimal Medium With Air-Limited Condition
After achieving the construction and optimization of the cell factory pathways, we hoped to further improve the production of D-allulose through fermentation. The major problem encountered was cell growth defect caused by the block of the EMP pathway. Although LB is a nutritionally-rich medium in which yeast extract can act as a carbon source for E. coli, the developed cell factory did not grow well, with a cell density of less than 1.22 after 72 h (Figure 6B). Also, this medium has a relatively low buffering capacity that is not conducive to the cells engineered with dephosphorylation pathway, and is normally used to produce enzymes rather than synthetic chemicals due to its high cost. M9 minimal medium may be a better choice compared to LB, but the premise of using M9 in our case is to select a suitable carbon source that can be utilized by E. coli cells without the participation of 6-phosphofructokinases.
Theoretically, E. coli (alsE, a6PP, ptsG-F, mak, pckA, ΔfruA, ΔpfkA, ΔpfkB) should restore its growth on glycerol, an abundant three-carbon by-product of biodiesel industry. Glycerol can be metabolized to dihydroxyacetone phosphate (DHAP) via either fermentative or respiratory route, and the conversion of DHAP to PEP requires only the EMP pathway downstream of 6-phosphofructokinases (; ). Therefore, we attempted to produce D-allulose with glycerol-containing M9 medium and air-limited condition. In order to fully exhibit the advantages of phosphorylation-dephosphorylation over Izumoring in substrate conversion ratio, the initial D-fructose concentration in medium was controlled at 2.20 g/L. The data in Figure 7 show that glycerol was utilized by E. coli (alsE, a6PP, ptsG-F, mak, pckA, ΔfruA, ΔpfkA, ΔpfkB) as expected, and cell growth defect was not observed, resulting in a cell density of 2.21 after 100 h. The favorable growth conditions increased the titer of D-allulose to 1.59 g/L. It should be noted that D-fructose could be exhausted after fermentation, and most of it was used for synthesis of the target product, with a yield of 0.72 g/g.
FIGURE 7
Our achievements in this study perfectly overcome the D-fructose conversion bottleneck existing in fermentative production of D-allulose, and suggest a breakthrough in application of phosphorylation-dephosphorylation strategy in cell factories. Currently, the conversion ratio of D-fructose using Izumoring-based cell factories was only 19.6% (). In contrast, the new synthetic route can completely consume D-fructose, which may facilitate the subsequent separation of D-allulose from culture broth. In future work, we plan to optimize the expression of allulose-6-phosphate epimerase by gene screening or tag fusion, which may greatly increase D-allulose titer while maintaining a high product yield.
Statements
Data availability statement
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.
Author contributions
L-HF and X-CL provided research proposals and funding support. QG and C-YL organized the database and wrote the first draft of the manuscript. L-JZ, S-HZ, and Y-XZ participated in the data analysis. S-YZ and H-DZ reviewed the manuscript. All authors have made a substantial, direct, and intellectual contribution to the work and approved it for publication.
Funding
This study was funded by the National Natural Science Foundation of China (No. 21978014), and Quanzhou City Science and Technology Program of China (No. 2021CT006).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
AristidouA. A.SanK.-Y.BennettG. N. (1999). Improvement of Biomass Yield and Recombinant Gene Expression in Escherichia coli by Using Fructose as the Primary Carbon Source. Biotechnol. Prog.15 (1), 140–145. 10.1021/bp980115v
2
BabaT.AraT.HasegawaM.TakaiY.OkumuraY.BabaM.et al (2006). Construction of Escherichia coli K‐12 In‐frame, Single‐gene Knockout Mutants: the Keio Collection. Mol. Syst. Biol.2. 2006.0008. 10.1038/msb4100050
3
BosshartA.WagnerN.BechtoldM.PankeS. (2012). Improving the Thermostability of D-Tagatose 3-epimerase for the Production of the Rare Sugar D-Psicose. New Biotechnol.29, S199. 10.1016/j.nbt.2012.08.559
4
ChanK. K.FedorovA. A.FedorovE. V.AlmoS. C.GerltJ. A. (2008). Structural Basis for Substrate Specificity in Phosphate Binding (Beta/alpha)8-Barrels: D-Allulose 6-Phosphate 3-Epimerase from Escherichia coli K-12. Biochemistry47 (36), 9608–9617. 10.1021/bi800821v
5
ChatterjeeR.MillardC. S.ChampionK.ClarkD. P.DonnellyM. I. (2001). Mutation of the ptsG Gene Results in Increased Production of Succinate in Fermentation of Glucose by Escherichia coli. Appl. Environ. Microbiol.67 (1), 148–154. 10.1128/AEM.67.1.148-154.2001
6
ChiangC.-J.HoY.-J.HuM.-C.ChaoY.-P. (2020). Rewiring of Glycerol Metabolism in Escherichia coli for Effective Production of Recombinant Proteins. Biotechnol. Biofuels13 (1), 205. 10.1186/s13068-020-01848-z
7
DatsenkoK. A.WannerB. L. (2000). One-step Inactivation of Chromosomal Genes in Escherichia coli K-12 Using PCR Products. Proc. Natl. Acad. Sci. U.S.A.97 (12), 6640–6645. 10.1073/pnas.120163297
8
DuG.ZhuC.XuM.WangL.YangS.-T.XueC. (2021). Energy-efficient Butanol Production by Clostridium Acetobutylicum with Histidine Kinase Knockouts to Improve Strain Tolerance and Process Robustness. Green Chem.23, 2155–2168. 10.1039/d0gc03993d
9
DugarG.SvenssonS. L.BischlerT.WäldchenS.ReinhardtR.SauerM.et al (2016). The CsrA-FliW Network Controls Polar Localization of the Dual-Function Flagellin mRNA in Campylobacter Jejuni. Nat. Commun.7, 11667. 10.1038/ncomms11667
10
GuoQ.ZhengL.-J.LuoX.GaoX.-Q.LiuC.-Y.DengL.et al (2021). Engineering Escherichia coli for D-Allulose Production from D-Fructose by Fermentation. J. Agric. Food Chem.69 (45), 13578–13585. 10.1021/acs.jafc.1c05200
11
KimH.-J.HyunE.-K.KimY.-S.LeeY.-J.OhD.-K. (2006). Characterization of an Agrobacterium Tumefaciens D -Psicose 3-Epimerase that Converts D -Fructose to D -Psicose. Appl. Environ. Microbiol.72 (2), 981–985. 10.1128/AEM.72.2.981-985.2006
12
KornbergH. L. (2001). Routes for Fructose Utilization by Escherichia coli. J. Mol. Microbiol. Biotechnol.3 (3), 355–359.
13
KornbergH. L. (1990). Fructose Transport by Escherichia coli. Phil. Trans. R. Soc. Lond. B326 (1236), 505–513. 10.1098/rstb.1990.0028
14
KornbergH. L.LambourneL. T. M.SproulA. A. (2000). Facilitated Diffusion of Fructose via the Phosphoenolpyruvate/glucose Phosphotransferase System of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A.97 (4), 1808–1812. 10.1073/pnas.97.4.1808
15
LeeS. Y.KimH. U.ChaeT. U.ChoJ. S.KimJ. W.ShinJ. H.et al (2019). Author Correction: A Comprehensive Metabolic Map for Production of Bio-Based Chemicals. Nat. Catal.2, 942–944. 10.1038/s41929-019-0358-8
16
LiC.LinJ.GuoQ.ZhangC.DuK.LinH.et al (2018). D-psicose 3-epimerase Secretory Overexpression, Immobilization, and D-Psicose Biotransformation, Separation and Crystallization. J. Chem. Technol. Biotechnol.93 (2), 350–357. 10.1002/jctb.5360
17
LiY.ShiT.HanP.YouC. (2021). Thermodynamics-driven Production of Value-Added D-Allulose from Inexpensive Starch by an In Vitro Enzymatic Synthetic Biosystem. ACS Catal.11 (9), 5088–5099. 10.1021/acscatal.0c05718
18
LinH.BennettG. N.SanK.-Y. (2005). Effect of Carbon Sources Differing in Oxidation State and Transport Route on Succinate Production in Metabolically Engineered Escherichia coli. J. Ind. Microbiol. Biotechnol.32 (3), 87–93. 10.1007/s10295-005-0206-5
19
LuoY.ZhangT.WuH. (2014). The Transport and Mediation Mechanisms of the Common Sugars in Escherichia coli. Biotechnol. Adv.32 (5), 905–919. 10.1016/j.biotechadv.2014.04.009
20
MillerB. G.RainesR. T. (2004). Identifying Latent Enzyme Activities: Substrate Ambiguity within Modern Bacterial Sugar Kinases. Biochemistry43 (21), 6387–6392. 10.1021/bi049424m
21
MuW.ChuF.XingQ.YuS.ZhouL.JiangB. (2011). Cloning, Expression, and Characterization of a D-Psicose 3-epimerase from Clostridium Cellulolyticum H10. J. Agric. Food Chem.59 (14), 7785–7792. 10.1021/jf201356q
22
MuW.ZhangW.FengY.JiangB.ZhouL. (2012). Recent Advances on Applications and Biotechnological Production of D-Psicose. Appl. Microbiol. Biotechnol.94 (6), 1461–1467. 10.1007/s00253-012-4093-1
23
NagataY.KanasakiA.TamaruS.TanakaK. (2015). D-psicose, an Epimer of D-Fructose, Favorably Alters Lipid Metabolism in Sprague-Dawley Rats. J. Agric. Food Chem.63 (12), 3168–3176. 10.1021/jf502535p
24
NguyenV. D.LeT.-H.KimJ.-I.LeeJ. W.KooY.-M. (2009). Separation of D-Psicose and D-Fructose Using Simulated Moving Bed Chromatography. J. Sep. Sci.32 (11), 1987–1995. 10.1002/jssc.200800753
25
PontrelliS.ChiuT.-Y.LanE. I.ChenF. Y.-H.ChangP.LiaoJ. C. (2018). Escherichia coli as a Host for Metabolic Engineering. Metab. Eng.50, 16–46. 10.1016/j.ymben.2018.04.008
26
ShibaT.TsutsumiK.IshigeK.NoguchiT. (2000). Inorganic Polyphosphate and Polyphosphate Kinase: Their Novel Biological Functions and Applications. Biochem. (Mosc)65 (3), 315–323.
27
SinghA.Cher SohK.HatzimanikatisV.GillR. T. (2011). Manipulating Redox and ATP Balancing for Improved Production of Succinate in E. coli. Metab. Eng.13 (1), 76–81. 10.1016/j.ymben.2010.10.006
28
SuL.SunF.LiuZ.ZhangK.WuJ. (2018). Highly Efficient Production of Clostridium Cellulolyticum H10 D-Psicose 3-epimerase in Bacillus Subtilis and Use of These Cells to Produce D-Psicose. Microb. Cell Fact.17 (1), 188. 10.1186/s12934-018-1037-1
29
SunY.HayakawaS.OgawaM.IzumoriK. (2005). Evaluation of the Site Specific Protein Glycation and Antioxidant Capacity of Rare Sugar−Protein/Peptide Conjugates. J. Agric. Food Chem.53 (26), 10205–10212. 10.1021/jf051565n
30
WangK.WangX.LuoH.WangY.WangY.TuT.et al (2022). Synergetic Fermentation of Glucose and Glycerol for High-Yield N-Acetylglucosamine Production in Escherichia coli. Int. J. Mol. Sci.23 (2), 773. 10.3390/ijms23020773
31
WangY.CarderH. M.WendlandtA. E. (2020). Synthesis of Rare Sugar Isomers through Site-Selective Epimerization. Nature578 (7795), 403–408. 10.1038/s41586-020-1937-1
32
WangY.JiaoJ.ZhangS.ZhengC.WuM. (2019). RIP3 Inhibition Protects Locomotion Function through Ameliorating Mitochondrial Antioxidative Capacity after Spinal Cord Injury. Biomed. Pharmacother.116, 109019. 10.1016/j.jhazmat.2021.12586410.1016/j.biopha.2019.109019
33
XiaoQ.NiuJ.LiuH.LiuY.ZhouX. (2019). High Conversion of D-Fructose into D-Allulose by Enzymes Coupling with an ATP Regeneration System. Mol. Biotechnol.61 (6), 432–441. 10.1007/s12033-019-00174-6
34
XuN.LiuY.JiangH.LiuJ.MaY. (2020). Combining Protein and Metabolic Engineering to Construct Efficient Microbial Cell Factories. Curr. Opin. Biotechnol.66, 27–35. 10.1016/j.copbio.2020.06.001
35
YangH.LuX.HuJ.ChenY.ShenW.LiuL. (2018). Boosting Secretion of Extracellular Protein by Escherichia coli via Cell Wall Perturbation. Appl. Environ. Microbiol.84 (20), e01382–01318. 10.1128/AEM.01382-18
36
YouC.ShiT.LiY.HanP.ZhouX.ZhangY.-H. P. (2017). An In Vitro Synthetic Biology Platform for the Industrial Biomanufacturing of Myo-Inositol from Starch. Biotechnol. Bioeng.114 (8), 1855–1864. 10.1002/bit.26314
37
ZhanT.ChenQ.ZhangC.BiC.ZhangX. (2020). Constructing a Novel Biosynthetic Pathway for the Production of Glycolate from Glycerol in Escherichia coli. ACS Synth. Biol.9 (9), 2600–2609. 10.1021/acssynbio.0c00404
38
ZhangW.FangD.XingQ.ZhouL.JiangB.MuW. (2013). Characterization of a Novel Metal-dependent D-Psicose 3-epimerase from Clostridium Scindens 35704. PLoS One8 (4), e62987. 10.1371/journal.pone.0062987
39
ZhuC.DuG.ZhangJ.XueC. (2021). A High‐efficient Strategy for Combinatorial Engineering Paralogous Gene Family: A Case Study on Histidine Kinases in Clostridium. Biotechnol. Bioeng.118, 2770–2780. 10.1002/bit.27796
Summary
Keywords
D-allulose, Escherichia coli, fermentation, metabolic engineering, cell factory
Citation
Guo Q, Liu C-Y, Zheng L-J, Zheng S-H, Zhang Y-X, Zhao S-Y, Zheng H-D, Fan L-H and Lin X-C (2022) Metabolically Engineered Escherichia coli for Conversion of D-Fructose to D-Allulose via Phosphorylation-Dephosphorylation. Front. Bioeng. Biotechnol. 10:947469. doi: 10.3389/fbioe.2022.947469
Received
18 May 2022
Accepted
07 June 2022
Published
22 June 2022
Volume
10 - 2022
Edited by
Xiao-Jun Ji, Nanjing Tech University, China
Updates
Copyright
© 2022 Guo, Liu, Zheng, Zheng, Zhang, Zhao, Zheng, Fan and Lin.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Li-Hai Fan, fanlh@fzu.edu.cn; Xiao-Cheng Lin, xclin@fzu.edu.cn
† These authors have contributed equally to this work and share first authorship
This article was submitted to Synthetic Biology, a section of the journal Frontiers in Bioengineering and Biotechnology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.