Tetiana Kyrpa
Yelizaveta Prokhorova
Maksym Kharkhota2†- 1Institute of Cell Biology and Genetic Engineering National Academy of Sciences of Ukraine, Kyiv, Ukraine
- 2Danylo Zabolotny Institute of Microbiology and Virology National Academy of Sciences of Ukraine, Kyiv, Ukraine
Introduction
Global climate change exacerbates both abiotic and biotic stress factors, which affect not only agricultural crops but also native plant species that must adapt to rapidly changing ecosystems (Raza et al., 2025). One of the universal mechanisms of plant resistance to abiotic factors is an increase in the proportion of unsaturated fatty acids in membrane phospholipids (Xiao et al., 2022). Desaturases are enzymes that facilitate the formation of double bonds in fatty acids, transforming them from saturated to unsaturated (Ferrero et al., 2025). This increase in unsaturated fatty acid content enhances membrane plasticity and viscosity while lowering the crystallization temperature, thereby improving plant resilience against a range of abiotic stressors, including low temperatures, frost, and drought (Yu et al., 2021).
In addition to abiotic stress, the physiological health and productivity of plants hinge on various factors, including susceptibility to fungal and viral pathogens, which can hinder plant development, disrupt photosynthesis, and impair essential biochemical processes (Yang and Luo, 2021). Interestingly, abiotic stressors can sometimes create favourable conditions for pathogen development (Ortel et al., 2024). Some of the plants defence mechanisms are aimed at preventing pathogen entry, while others inhibit the progression of infections within the plant (El-Saadony et al., 2022). In many plant species, Thaumatin-Like Proteins (TLPs), which are structurally related to thaumatin II, are prevalent (Zhao et al., 2024), and show antifungal activity based on their capacity to disrupt the cell walls of pathogenic fungi (Osei-Obeng et al., 2024). These proteins have β-1,3-glucanase activity and can bind to degrade β-1,3-glucan, a fundamental component of fungal cell walls, facilitating further membrane destruction (Liu et al., 2021). Moreover, thaumatins may influence the activity of other proteins through metabolic pathway regulation (Zhao et al., 2024).
In this study, we introduced the cyanobacterium Δ-12-acyl-lipid desaturase gene (desA) from Synechocystis sp. PCC 6803 and the thaumatin II gene, (thII) from Thaumatococcus daniellii into the Nicotiana tabacum genome. The presence of a transgene in a plant can yield both advantageous and detrimental outcomes, as gene expression and protein functionality require additional resources, potentially leading to biochemical and physiological competition. Therefore, the desA gene was placed in a vector regulated by the cold-inducible CBF1 promoter from Arabidopsis thaliana. This study aimed to explore the concurrent functioning of two proteins with different substrate specificities, would exhibit augmented resistance to both abiotic and biotic stressors.
Materials and methods
Genetic constructs
This research used cloned sequences of the desA gene, which encodes the Δ12-acyl-lipid desaturase from Synechocystis sp. PCC 6803, and the thII gene from T. daniellii, which encodes a sweet-tasting thaumatin II protein structurally related to the TLP family. The desaturase genes were translationally fused to the licBM3 gene, which encodes a reporter protein derived from the thermostable lichenase of Clostridium thermocellum. The hybrid genes, desA:licBM3, were cloned into pBISN-based vectors containing the selectable nptII gene, regulated by the cold-induced promoter CBF1 from the A. thaliana. The thaumatin II gene was integrated into a pNMD46732-based vector, with a selectable bar, under the control of the constitutive 35S cauliflower mosaic virus (CaMV) DNA promoter.
Control groups included transgenic plants with vector constructs incorporating the GFP reporter gene instead of the desaturase gene (desA), as well as wild-type tobacco (N. tabacum). All genetic constructs and transgenic plants were sourced from the collection at the Institute of Cell Biology and Genetic Engineering.
Agrobacterium tumefaciens-mediated plant transformation
Leaf blades measuring 1–1.5 cm2 were excised and placed into a bacterial suspension, which was incubated for 1 hour at +25 °C in the dark. The explants were then collected, washed to remove excess bacterial culture, and transferred to MS medium. They were co-cultivated with Agrobacterium for 2 days at +25 °C (to promote Agrobacterium growth). After co-cultivation, the explants were washed in sterile distilled water, dried on sterile filter paper for 10–15 min, and then placed in MS medium supplemented with the phytohormones BAP (1 μg mL-1) and NAA (0.1 μg mL-1), along with 700 μg mL-1 cefotaxime to inhibit Agrobacterium growth. Regeneration of potential transgenic shoots was monitored over a period of 2–3 weeks, with regeneration occurring in vitro at 25 °C ± 3 °C under a 16-h photoperiod with light intensity of 100 μmol quanta (m2s).
Conditions for the polymerase chain reaction
Plant DNA was isolated using a standard CTAB method (Mark et al., 2024), and its concentration was determined by measuring optical density at 260 nm with a BioPhotometer spectrophotometer (Eppendorf, Germany). PCR was conducted using a 2720 Thermal Cycler (Applied Biosystems, USA), with primers thII-f (caccttcgagatcgtcaaccgctg) and thII-r (aagcttaggcagtagggcagaaagtg). Amplification conditions included 5 min at 94 °C; 30 cycles of 30 s at 94 °C, 45 s at 63 °C, and 45 s at 72 °C; followed by 5 min at 63 °C. Amplification products were separated via 1% agarose gel electrophoresis using TAE buffer and visualized with ethidium bromide. The O’GeneRuler 1 kb DNA Ladder (Fermentas, Lithuania) served as a DNA marker.
Qualitative determination of thermostable lichenase activity
The preparation of plant material and the reaction were carried out according to the protocol described earlier (Gerasymenko et al., 2015). A qualitative lichenase assay and part of analysis of the FA was conducted 40 min after exposure to cold stress (0 °C for 30 min, followed by −5 °C for 80 min).
Analysis of the fatty acid spectrum by gas chromatography and mass spectrometry
Samples for gas chromatography and mass spectrometry analysis were prepared according to previously published protocols (Gerasymenko et al., 2015). The analysis was conducted using an Agilent 6890N/5973 inert chromatographic-mass spectrometry system equipped with a DBFFAP capillary column (J&W Scientific, United States). Fatty acid methyl esters (FAMEs) were identified by comparing the obtained spectra with entries from the NIST 02 mass spectrum library and standard mixtures of bacterial FAMEs (47080U, Supelco).
For fatty acid analysis, mixed plant material from three lines of N. tabacum CBF1:desA:licBM3+thII, three lines of N. tabacum CBF1:desA:licBM3, two lines of N. tabacum CBF1:GFP:licBM3 obtained from transgenic plants, and N. tabacum were used. Six biological replicates and one analytical replicate were selected (upper unfolded leaves). The statistical significance of differences between average means was estimated using Student’s paired t-test, p-values were calculated using Excel standard functions.
Visualizations
The genetic transformation of transgenic N. tabacum, which demonstrated the insertion and expression of the desA gene, was carried out using a plasmid vector containing the thII gene. The active regeneration phase of the plants was observed within 1–1.2 months (Figure 1A). Two months post-transformation, regenerants were cultured on standard MS medium. After biomass growth, the presence of the thII gene insertion was confirmed via PCR (Figure 1B).
Figure 1. (A) Tobacco plant regeneration after genetic transformation. (B) PCR analysis of the genomic DNA of transgenic tobacco for desA insert. М - DNA mass ladder O`GeneRuler™ 1 kb DNA Ladder (Thermo Fischer Scientific); C + - positive control, pNPB14 plasmid DNA, C- - negative control, non-transformed plant, 1-6 – tested transformed tobacco (PCR-product - 949 bp). (C) PCR analysis for the presence of the thII gene insert: M - DNA mass ladder, C + - positive control, pNMD46732 plasmid DNA, C- - negative control, one to four total DNA from tobacco plant lines (PCR-product - 626 bp). (D) Qualitative test for lichenase activity: K + – positive control, Nicotiana tabacum expressing licBM3 gene, K- – negative control, non-transgenic plant; 1-4 – tobacco plant extract simultaneously expressing desA and thII.
The expression of the desaturase gene was indirectly assessed through the activity of the thermostable lichenase reporter protein (licBM3), since both the desaturase and lichenase genes are located within the same reading frame under the control of the cold-inducible promoter. The assay evaluates the lichenase’s ability to degrade the complex carbohydrate lichenan (Figure 1C). The number of replicates for gene insertion detection and lichenase activity testing was 3, all of which were positive.
Results indicated that the plants maintained lichenase activity, suggesting the continued expression of the desA gene and lichenase activity. Tobacco plants demonstrating confirmed insertion and expression of the 12-acyl-lipid desaturase genes exhibited heightened linoleic acid content. To compare fatty acid spectra, tobacco plants with an insertion both the desA and thII genes, those only the desA gene, those with the GFP:licBM3 gene, and wild-type tobacco plants were analyzed. The upper open leaves were used for this analysis, which was performed under normal physiological conditions and following cold stress exposure. An increase in linoleic acid (C18:2) proportion was observed in plants with the desA gene insertion, differing from the fatty acid spectrum analysis results of the transgenic control and wild-type tobacco plants. No significant distinctions in fatty acid composition between plants with the desaturase gene and those with both desaturase and thaumatin gene insertions were observed (Table 1).
Table 1. Fatty acid composition (%).
Contextualization
Developing biotechnological plants with transgenes that enhance resistance to various stress types represents a highly promising area of research (Ricroch et al., 2022). Currently, several biotechnological methods are employed to create new plant varieties via molecular breeding techniques (Sun et al., 2024). However, the effects of transgenes within plant organisms remain an inadequately explored subject (Fenzi et al., 2024). The influence of desaturase transgene expression on plant resistance to various abiotic factors is well-documented in many studies (Kumari et al., 2025), primarily because the proteins encoded by this gene have binding substrates within the plant due to their phylogenetic similarity to plant desaturases (Laureano et al., 2021). Similarly, thaumatin II protein is functionally relevant to plants (Hu et al., 2025). While several reports analyze and study the expression of specific transgenes in plants, few address the simultaneous insertion and expression of multiple transgenes with distinct substrate specificities. This paper presents preliminary findings on the generation of double transformants in tobacco plants, confirming the insertion of two different transgenes: the cyanobacterial desaturase and thaumatin II. However, the expression and pleiotropic effects of certain transgenes under stressful conditions may negatively affect or suppress the functionality of others (Cabrera et al., 2022), performing the functions of less stable proteins. This study aimed to elucidate how the expression of the desA gene, encoding Δ12-acyl-lipid desaturase from Synechocystis sp. PCC 6803, and the insertion of the thII gene from Thaumatococcus daniellii influence the function of these genes. TLPs are known to stabilize under extreme thermal and pH conditions due to their disulfide bridge structures, as well as resist protein degradation, potentially impacting the functionality of other proteins (Feng et al., 2024). So far, we have observed sustained expression of the desaturase gene and the activity of the target protein, with subsequent steps aimed at detecting the expression of the thaumatin gene and examining the plants' responses under stress conditions.
Conclusion
The conducted experiments to create plants exhibiting enhanced resistance to abiotic and biotic stresses yielded potentially successful outcomes. For the first time, the simultaneous insertion of the taumatine II gene into tobacco was studied, which did not interfere with the expression and activity of the desaturase enzyme associated with the desA gene. Current efforts are focused on testing and confirming the expression systems for the thaumatin gene, with further studies planned to assess the resistance of the double transformants to low-temperature stress and pathogenic threats.
Data availability statement
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.
Author contributions
TK: Investigation, Visualization, Software, Data curation, Resources, Conceptualization, Writing – review and editing, Formal Analysis, Project administration, Supervision, Methodology, Writing – original draft, Validation, Funding acquisition. YP: Validation, Project administration, Data curation, Methodology, Writing – review and editing, Investigation, Formal Analysis. MaK: Resources, Conceptualization, Project administration, Data curation, Methodology, Writing – review and editing, Formal Analysis, Investigation. MyK: Conceptualization, Software, Funding acquisition, Investigation, Visualization, Writing – review and editing, Resources, Validation, Project administration, Supervision, Data curation.
Funding
The author(s) declared that financial support was received for this work and/or its publication. The research was funded by a grant National Academy of Science of Ukraine to research laboratories/groups of young scientists to conduct research in priority areas of science and technology development (UkrISTEI grant no. 0120U100130).
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
Cabrera, A., Edelstein, H. I., Glykofrydis, F., Love, K. S., Palacios, S., Tycko, J., et al. (2022). The sound of silence: transgene silencing in Mammalian cell engineering. Cell Syst. 13, 950–973. doi:10.1016/j.cels.2022.11.005
El-Saadony, M. T., Saad, A. M., Soliman, S. M., Salem, H. M., Ahmed, A. I., Mahmood, M., et al. (2022). Plant growth-promoting microorganisms as biocontrol agents of plant diseases: mechanisms, challenges and future perspectives. Front. Plant Sci. 13, 923880. doi:10.3389/fpls.2022.923880
Feng, L., Wei, S., and Li, Y. (2024). Thaumatin-like proteins in legumes: functions and potential Applications—A review. Plants 13, 1124. doi:10.3390/plants13081124
Fenzi, M., Foyer, J., Boisvert, V., and Perales, H. (2024). Recalcitrant maize: conserving agrobiodiversity in the era of genetically modified organisms. Plants People Planet 6, 1129–1141. doi:10.1002/ppp3.10426
Ferrero, E., Vaz, F. M., Cheillan, D., Brusco, A., and Marelli, C. (2025). The ELOVL proteins: very and ultra long-chain fatty acids at the crossroads between metabolic and neurodegenerative disorders. Mol. Genet. Metab. 144, 109050. doi:10.1016/j.ymgme.2025.109050
Gerasymenko, I. M., Sakhno, L. A., Kyrpa, T. N., Ostapchuk, A. M., Hadjiev, T. A., Goldenkova-Pavlova, I. V., et al. (2015). Characterization of Nicotiana tabacum plants expressing hybrid genes of cyanobacterial Δ9 or Δ12 acyl-lipid desaturases and thermostable lichenase. Russ. J. Plant Physiology 62, 283–291. doi:10.1134/S1021443715030073
Hu, Y., Gong, C., Yang, Z., Han, H., Tian, T., Yang, X., et al. (2025). Functional divergence of plant-derived thaumatin-like protein genes in two closely related whitefly species. Adv. Sci. 12, e2502193. doi:10.1002/advs.202502193
Kumari, K., Gusain, S., and Joshi, R. (2025). Engineering cold resilience: implementing gene editing tools for plant cold stress tolerance. Planta 261, 2. doi:10.1007/s00425-024-04578-w
Laureano, G., Cavaco, A. R., Matos, A. R., and Figueiredo, A. (2021). Fatty acid desaturases: uncovering their involvement in grapevine defence against downy mildew. Int. J. Mol. Sci. 22, 5473. doi:10.3390/ijms22115473
Liu, Y., Liu, L., Asiegbu, F. O., Yang, C., Han, S., Yang, S., et al. (2021). Molecular identification and antifungal properties of four thaumatin-like proteins in spruce (Picea likiangensis). Forests 12, 1268. doi:10.3390/f12091268
Mark, D., Tairo, F., Ndunguru, J., Kweka, E., Saggaf, M., Bachwenkizi, H., et al. (2024). Assessing the effect of sample storage time on viral detection using a rapid and cost-effective CTAB-based extraction method. Plant Methods 20, 64. doi:10.1186/s13007-024-01175-6
Ortel, C. C., Roberts, T. L., and Rupe, J. C. (2024). A review of the interaction between potassium nutrition and plant disease control. Agrosystems, Geosciences Environ. 7, e20489. doi:10.1002/agg2.20489
Osei-Obeng, P., Kiirika, L. M., and Nyende, A. B. (2024). Antifungal activity of citral against Fusarium wilt in tomatoes and induction of the upregulation of glucanase, chitinase, and thaumatin-like protein plant defense genes. J. Nat. Pesticide Res. 10, 100097. doi:10.1016/j.napere.2024.100097
Raza, A., Khare, T., Zhang, X., Rahman, M. M., Hussain, M., Gill, S. S., et al. (2025). Novel strategies for designing climate-smart crops to ensure sustainable agriculture and future food security. J. Sustain. Agric. Environ. 4, e70048. doi:10.1002/sae2.70048
Ricroch, A. E., Martin-Laffon, J., Rault, B., Pallares, V. C., and Kuntz, M. (2022). Next biotechnological plants for addressing global challenges: the contribution of transgenesis and new breeding techniques. N. Biotechnol. 66, 25–35. doi:10.1016/j.nbt.2021.09.001
Sun, L., Lai, M., Ghouri, F., Nawaz, M. A., Ali, F., Baloch, F. S., et al. (2024). Modern plant breeding techniques in crop improvement and genetic diversity: from molecular markers and gene editing to artificial intelligence—A critical review. Plants 13, 2676. doi:10.3390/plants13192676
Xiao, R., Zou, Y., Guo, X., Li, H., and Lu, H. (2022). Fatty acid desaturases (FADs) modulate multiple lipid metabolism pathways to improve plant resistance. Mol. Biol. Rep. 49, 9997–10011. doi:10.1007/s11033-022-07568-x
Yang, H., and Luo, P. (2021). Changes in photosynthesis could provide important insight into the interaction between wheat and fungal pathogens. Int. J. Mol. Sci. 22, 8865. doi:10.3390/ijms22168865
Yu, L., Zhou, C., Fan, J., Shanklin, J., and Xu, C. (2021). Mechanisms and functions of membrane lipid remodeling in plants. Plant J. 107, 37–53. doi:10.1111/tpj.15273
Keywords: climate change, desaturases, plant stress, thaumatin, tobacco
Citation: Kyrpa T, Prokhorova Y, Kharkhota M and Kuchuk M (2026) Double defense: enhancing tobacco with cyanobacterial and thaumatin genes. Front. Bioeng. Biotechnol. 14:1667530. doi: 10.3389/fbioe.2026.1667530
Received: 16 July 2025; Accepted: 05 January 2026;
Published: 16 January 2026.
Edited by:
George Tzotzos, Marche Polytechnic University, ItalyReviewed by:
Juan De Dios Franco-Navarro, Spanish National Research Council (CSIC), SpainAhmed M. Saad, Zagazig University, Egypt
Copyright © 2026 Kyrpa, Prokhorova, Kharkhota and Kuchuk. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Tetiana Kyrpa, dC1raXJwYUB1a3IubmV0
†ORCID: Tetiana Kyrpa, orcid.org/0000-0002-3520-405X; Yelizaveta Prokhorova, orcid.org/0000-0003-4227-7772; Maksym Kharkhota, orcid.org/0000-0003-4734-2887; Mykola Kuchuk, orcid.org/0000-0001-7365-7474