CORRECTION article

Front. Cell Dev. Biol., 27 September 2018

Sec. Signaling

Volume 6 - 2018 | https://doi.org/10.3389/fcell.2018.00121

Corrigendum: Cystathionine β-Synthase Is Necessary for Axis Development in vivo

  • 1. Department of Pediatrics, Medical College of Wisconsin, Milwaukee, WI, United States

  • 2. Department of Obstetrics and Gynecology, University of Oklahoma Health Science Center, Oklahoma City, OK, United States

  • 3. Pediatrics Radiology, Developmental Vascular Biology Program, Children's Research Institute, Medical College of Wisconsin, Milwaukee, WI, United States

  • 4. Milwaukee Health Department, City of Milwaukee, Milwaukee, WI, United States

  • 5. Peggy and Charles Stephenson Cancer Center, University of Oklahoma Health Science Center, Oklahoma City, OK, United States

  • 6. Department of Pathology, University of Oklahoma Health Science Center, Oklahoma City, OK, United States

  • 7. Department of Cell Biology, University of Oklahoma Health Science Center, Oklahoma City, OK, United States

  • 8. Obstetrics and Gynecology, Medical College of Wisconsin, Milwaukee, WI, United States

In the original article, there was an error in Figure 2C as published. The sequence of the cbsa splice 1 (CBSA-S1) morpholino was incorrectly typed as

TACCTGCACAAAGTGAACACACAACCA

The correct sequence is

TACCTGCACAAAGTGAACACAACCA

The name of the morpholino was changed in the figure from cbsa splice (CBSA-S1) to cbsa splice 1 (CBSA-S1) to match the legend.

The corrected Figure 2 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.

Figure 2

The original article has been updated.

Statements

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Summary

Keywords

zebrafish, CRISPR, small molecules, methionine, homcystinuria, hydrogen sulfide, morpholino

Citation

Prabhudesai S, Koceja C, Dey A, Eisa-Beygi S, Leigh NR, Bhattacharya R, Mukherjee P and Ramchandran R (2018) Corrigendum: Cystathionine β-Synthase Is Necessary for Axis Development in vivo. Front. Cell Dev. Biol. 6:121. doi: 10.3389/fcell.2018.00121

Received

13 August 2018

Accepted

05 September 2018

Published

27 September 2018

Volume

6 - 2018

Edited and reviewed by

Gregory Kelly, University of Western Ontario, Canada

Updates

Copyright

*Correspondence: Resham Bhattacharya Priyabrata Mukherjee Ramani Ramchandran

This article was submitted to Signaling, a section of the journal Frontiers in Cell and Developmental Biology

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics