In the original article, there was an error in Figure 2C as published. The sequence of the cbsa splice 1 (CBSA-S1) morpholino was incorrectly typed as
TACCTGCACAAAGTGAACACACAACCA
The correct sequence is
TACCTGCACAAAGTGAACACAACCA
The name of the morpholino was changed in the figure from cbsa splice (CBSA-S1) to cbsa splice 1 (CBSA-S1) to match the legend.
The corrected Figure 2 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.
Figure 2
The original article has been updated.
Statements
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Summary
Keywords
zebrafish, CRISPR, small molecules, methionine, homcystinuria, hydrogen sulfide, morpholino
Citation
Prabhudesai S, Koceja C, Dey A, Eisa-Beygi S, Leigh NR, Bhattacharya R, Mukherjee P and Ramchandran R (2018) Corrigendum: Cystathionine β-Synthase Is Necessary for Axis Development in vivo. Front. Cell Dev. Biol. 6:121. doi: 10.3389/fcell.2018.00121
Received
13 August 2018
Accepted
05 September 2018
Published
27 September 2018
Volume
6 - 2018
Edited and reviewed by
Gregory Kelly, University of Western Ontario, Canada
Updates
Copyright
© 2018 Prabhudesai, Koceja, Dey, Eisa-Beygi, Leigh, Bhattacharya, Mukherjee and Ramchandran.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Resham Bhattacharya Resham-Bhattacharya@OUHSC.eduPriyabrata Mukherjee Priyabrata-Mukherjee@OUHSC.eduRamani Ramchandran rramchan@mcw.edu
This article was submitted to Signaling, a section of the journal Frontiers in Cell and Developmental Biology
†These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.