ORIGINAL RESEARCH article

Front. Cell Dev. Biol., 09 July 2021

Sec. Cellular Biochemistry

Volume 9 - 2021 | https://doi.org/10.3389/fcell.2021.640958

Age-Dependent Regulation of Notch Family Members in the Neuronal Stem Cell Niches of the Short-Lived Killifish Nothobranchius furzeri

  • 1. Laboratory of Biology (BIO@SNS), Scuola Normale Superiore, Pisa, Italy

  • 2. Department of Biology and Evolution of Marine Organisms (BEOM), Stazione Zoologica Anton Dohrn, Naples, Italy

Abstract

Background: The annual killifish Nothobranchius furzeri is a new experimental model organism in biology, since it represents the vertebrate species with the shortest captive life span and also shows the fastest maturation and senescence recorded in the laboratory. Here, we use this model to investigate the age-dependent decay of neurogenesis in the telencephalon (brain region sharing the same embryonic origin with the mammalian adult niches), focusing on the expression of the Notch pathway genes.

Results: We observed that the major ligands/receptors of the pathway showed a negative correlation with age, indicating age-dependent downregulation of the Notch pathway. Moreover, expression of notch1a was clearly limited to active neurogenic niches and declined during aging, without changing its regional patterning. Expression of notch3 is not visibly influenced by aging.

Conclusion: Both expression pattern and regulation differ between notch1a and notch3, with the former being limited to mitotically active regions and reduced by aging and the latter being present in all cells with a neurogenic potential, regardless of the level of their actual mitotic activity, and so is less influenced by age. This finally suggests a possible differential role of the two receptors in the regulation of the niche proliferative potential throughout the entire fish life.

Introduction

In the last decade, our group has intensively studied the annual fish Nothobranchius furzeri as a new experimental model in biology. N. furzeri has gained recognition as an animal model for aging studies, and currently, it is extensively studied in an increasing number of laboratories worldwide (; ; ; ; ; ; Wang et al., 2020). These fish inhabit ephemeral pools in the semiarid bushveld of Southern Mozambique characterized by scarce and erratic precipitations and have adapted to the seasonal drying of their environment by producing desiccation-resistant eggs that can remain dormant in the dry mud for 1 and maybe more years by entering into a diapause state (; ; ). Due to very short duration of the rainy season, the natural life span of these animals is limited to a maximum of a few months (; ; ). They represent the vertebrate species with the shortest captive life span and also the fastest maturation (; ). In addition, they express a series of conserved aging markers and are amenable to genetic manipulations, making them an attractive model system for aging research (, ; ; , ; ; ; ; ; ), as reviewed in and . The recent sequencing of the N. furzeri genome (; ; ) and the establishment of transgenic techniques for this species (; ; ; ; ; ) made N. furzeri a new versatile model organism to investigate the genetic basis of aging (; ). A striking characteristic of killifish development is the presence of diapause, a period when embryonic development is suspended at specific stages (; ), such as gastrulation (diapause 1), mid-somitogenesis (diapause 2), and pre-hatching (diapause 3). A surprising result that recently emerged is that the transcriptional patterns observed during aging and diapause overlap to a significant extent (), providing the motivation to study development-related genes in the context of aging.

Neurogenesis is the process that generates the nervous system during embryonic development. In mammals, neurogenesis is completed during perinatal life and is restricted to specific telencephalic niches during adult life (; ), but in fish brains, adult neurogenesis remains active, with stem cell niches distributed along the entire rostro-caudal extent of the ventricular surface (Zupanc and Horschke, 1995; ; ; ). Adult neurogenesis in mammals is known to decrease dramatically with age (; ; ; ), and although the level of adult neurogenesis remains higher compared to mammals, a decrease of this phenomenon has been observed during aging in zebrafish as well (; ; ). We therefore studied adult neuronal stem cells (NSCs) of N. furzeri in vivo and demonstrated an age-dependent decay in adult neurogenesis in terms of both incorporation of nucleotide analogs and expression of specific markers (). In addition, RNA sequencing (RNA-seq) experiments revealed age-dependent downregulation of neurogenesis genes during aging of N. furzeri brain and identified novel markers of adult NSCs ().

Even though fish neurogenic niches are more widespread than the mammalian homologous structures, the telencephalic niches share the same embryonic origin with the mammalian adult niches (). In particular, the ventral niche is homologous to the mammalian subventricular (subpallial) zone, whereas the dorsolateral region is homologous to the pallial zone (hippocampal mammalian niche). We also analyzed the germinal zone of the optic tectum that is very active in teleosts and whose stem cells retain a neuroepithelial phenotype (). This would allow us to differentiate between conserved expression patterns in the telencephalic niches from possible teleost-specific expression patterns detectable only in the optic tectum.

We concentrated our attention on the Notch pathway during aging of the NSCs. The Notch pathway is a key pathway for the control of neurogenesis and cell fate during both embryonic development (Yoon and Gaiano, 2005; ; ; ) and adult neurogenesis (; ; ; ). When activated by the ligands (Delta and Jagged), the Notch intracellular domain is cleaved and activates the transcription of effectors of the hairy family (her and hes genes in vertebrates) that act as repressors of gene transcription that block neurogenic genes (Yeo et al., 2007; ). Expression of notch genes is retained in adult NSCs where Notch activity can be detected by the activity of the hes5 promoter (). In zebrafish, notch family is composed of four members: notch1a, notch1b, notch2, and notch3 (; Westin and Lardelli, 1997). Studies in adult zebrafish have revealed a differential activity of notch1 and notch3. Inactivation of notch3 induces NSC amplification by reactivating them from a quiescent status, promoting symmetric divisions. On the other hand, abrogation of notch1 function induces new neuron generation, inducing a reduction of the number of activated NSCs (; ). Effects of aging on the Notch pathway remain poorly investigated. We reanalyzed RNA-seq and proteomics data to specifically assess the age-dependent expression of the components of the Notch pathway, and we studied the expression of notch1 and notch3 using in situ hybridization (ISH).

Materials and Methods

Fish Breeding and Housing Conditions

All experiments were performed on group-house N. furzeri of the MZM-04/10 strain. The protocols of fish maintenance were carried out in accordance with all animal use practices approved by the Italian Ministry of Health (Number 96/2003a). Ethynyl deoxyuridine (EdU)-injected samples used for the experiments were derived from archived material of the animal stock as previously used by .

Eggs were maintained on wet peat moss at room temperature in sealed Petri dishes. When embryos had developed, eggs were hatched by flushing the peat with tap water at 16–18°C. Embryos were scooped with a cut plastic pipette and transferred to a clean vessel. Fry were fed with newly hatched Artemia nauplii for the first 2 weeks and then weaned with finely chopped Chironomus larvae. Starting at the fourth week of life, fish were moved to 40-L tanks at a maximum density of 20 fish per tank equipped with air-driven sponge filters. The aquarium room’s temperature was set at a constant 26°C. Twice a week, the bottom of the tanks was siphoned and 50% of the water was exchanged with tempered tap water.

In vivo Ethynyl Deoxyuridine Injection

To localize the neurogenic niches in the brain, fishes were treated with a single intraperitoneal injection of the modified thymidine analog EdU (5-ethynyl-2’-deoxyuridine), which is specifically incorporated in the DNA during the S-phase of proliferating cells. To do that, the Click-iT® EdU Alexa Fluor® 488 Imaging Kit from Invitrogen-Thermo Fisher Scientific (cat. no.: C10337) was used: fish were first shortly anesthetized by using a sedation dosage of tricaine methanesulfonate (MS-222), and 50 μl of a 10-μM EdU solution was injected intraperitoneally in the experimental fish. Finally, animals were euthanized with MS-222 4 h after injection and immediately dissected. Preparation and use of MS222 and all procedures conform to the prescription of European (Directive 2010/63/UE) and Italian laws (DL 26/04-03-2014).

Brain Tissue Collection and Preparation

Whole brains from five young (7 weeks) and five old (25 weeks) animals (listed in Table 1) were dissected and fixed by immersion in 4% paraformaldehyde/0.1 M phosphate buffer (pH 7.4) and then cryoprotected with a two-step immersion at 20% and then 30% sucrose solution for at least 12 h each. Finally, the tissues were embedded at –20°C in Neg50 cryo-embedding medium (Thermo Scientific); series of 16-μm-thick sections were cut with a Leica cryostat and collected on Superfrost plus slides® (Thermo Scientific).

TABLE 1

ProtocolFish species and strainAge (weeks)Animals numberN Tot
RNA Seq Data set 1 Species: Nothobranchius furzeri Strain: MZM04/105525
125
205
275
395
RNA Seq Data set 2 Species: Nothobranchius furzeri Strain: MZM04/105412
124
394
Proteomic Data set Species: Nothobranchius furzeri Strain: MZM04/105515
125
395
123
393
Histology (EdU-ISH)Species: Nothobranchius furzeri Strain: MZM04/105510
275
63

Total list of experimental animals used in the study.

EdU, ethynyl deoxyuridine; FDR, false discovery rate; ISH, in situ hybridization.

In situ Hybridization and Ethynyl Deoxyuridine Staining

In situ Hybridization

All ISH protocols have been performed on 16-μm-thick cryo-sections of fish brain. Slides were dried for 2 h at 37°C, washed in phosphate buffered saline (PBS) twice for 3 min, and then treated for 8 min with Proteinase K (diluted 1:80,000 starting from stocks of 20 mg/ml). After that, slides were washed in glycine (2 mg/ml in PBT solution = PBS + tween 20 0.1%) twice for 5 min to stop the reaction. Then, sections were fixed with paraformaldehyde (PFA) 4% for 20 min at room temperature and washed in PBT (three times for 3 min). Pre-hybridization was performed by covering the slides with 200 μl of hybridization buffer under parafilm coverslips (to avoid evaporation) at hybridization temperature (60°C) for 30 min inside a wet chamber. Hybridization was performed covering each slide with a solution of the specific antisense 3’DIG-labeled probe diluted in 500 μl of hybridization buffer to a final concentration of 1 μg/ml. Parafilm coverslips were used, and slides were incubated at hybridization temperature overnight. Before using them, diluted RNA probes have been denatured for 2 min at 94°C. In order to avoid drying out the slides, the whole process has been carried out in a wet chamber with PBS.

After hybridization, 2 × saline-sodium citrate (SSC) has been used to remove the coverslip. Slides were first washed in 2 × SSC, twice for 20 min, and then in 0.2 × SSC twice for 20 min, always at hybridization temperature. A final washing step was done in PBT three times for 5 min at room temperature.

For the probe revelation, slides were incubated with blocking solution for 30 min at room temperature and then with Anti-Dig-AP Fab Fragments Ab [1/2,000] in blocking solution overnight at 4°C.

Washing in PBT, three times for 5 min, and in NMNT (NaCL/trisHCl/MgCl2/Tween20 0,1%/ Tetramisole solution), three times for 5 min at room temperature, has been conducted before adding Fast Red solution (Roche Tablets; 1 in 2 ml Tris–HCl 0.1 M, pH = 8.2). To avoid the formation of precipitate, Fast Red tablets have been vortexed for 5 min in Tris–HCl and then filtered. Observation has been conducted every 20 min with a Zeiss fluorescence microscope until the signal detection. The staining has been stopped by washing well with PBS (at least three times for 5 min) at room temperature.

The young and old samples have been treated in parallel, and to be able compare the dimension of the expression domains between different ages, we stopped the colorimetric reaction in both at the same time. After ISH slides were treated for EdU immunolabeling, images were acquired using a confocal microscope (Leica TCS).

EdU Staining

After the ISH procedure, slides were processed to stain the population of proliferating cells in the neurogenic niches: EdU+ cells were fluorescently labeled with a bright photostable Alexa Fluor® 488 dye in a fast, highly specific click reaction, according to the purchaser’s instruction.

Finally, slides were closed with a specific mounting (Fluoroshield, Sigma) and analyzed with a confocal microscope (Leica TCS).

Cloning of Notch1a and Notch3 and Probe Preparation

Total RNA was extracted from N. furzeri whole brains using miRNeasy Mini Kit (Qiagen), then total cDNA was retro transcribed from 1 μg of RNA. PCR was performed on cDNA using a GoTaq polymerase (Promega), 60°C for annealing temperature, and 60 s elongation time using the following primers:

  • Notch1aF: GCCCGACCATCCTTTTCTGA

  • Notch1aT7-R: GCAATGCAGAAGCCCTACTC-GGCCG GGACAAGTGCAATACC

  • Notch3F: AATGCTTGTCAAACCCGTGC

  • Notch3T7-R: CATCTGTCTGGATCCCTCGC-GGCCGG GACAAGTGCAATACC.

  • Primers were designed using the NCBI Primer-BLAST, and the RNA sequences were identified on the NCBI website and were, respectively:

  • notch3 GenBank: HADY01014643.1

  • notch1a GenBank: HADY01022403.1.

0.5 μg of PCR products that contain T7 RNA polymerase promoter at the 3’ ends were used as templates for in vitro transcription. The sequence of the amplicon was sent for direct sequencing (Genechrome, Rome, Italy) to confirm the identity of the amplified probe.

Probes were transcribed using DIG RNA labeling kit (SP6/T7) (Roche), according to the manufacturer’s protocol.

RNA Sequencing Data Analysis

To assess gene expression of notch pathway and proliferation genes, we realized graphics of RNA expression starting from RNA-seq datasets derived from publicly available and published cross-sectional experiments (1; 2). We combined two RNA-seq datasets of brain aging in N. furzeri: a dataset covering five time points (5, 12, 20, 27, and 39 weeks) and five biological replicates for each age and the second containing four replicates per age (5, 12, and 39 weeks). These ages correspond to sexual maturity, young adult, adult (as defined by a decrease in growth rate), median life span, and old (∼30% survivorship) (). In total, these represent 37 different samples spanning five different ages. All the pieces of information concerning the age, strain, and number of animals considered for the analysis are summarized in Table 1. We first applied the function Deseq in the suite R to normalize the counts (to have more information about the normalization algorithm used by the Deseq2 package, please refer to the paper by , and to the package manual at the link: http://www.bioconductor.org/packages/release/bioc/vignettes/DESeq2/inst/doc/DESeq2.html). We then extracted the normalized counts of the two datasets and divided them for the average expression of their respective 5 week samples to be able to combine them.

We also analyzed a publicly available proteomic dataset (3). The dataset contains five replicates for age (5, 12, and 39 weeks, listed in Table 1) and is a combination of two separate experiments performed utilizing tandem mass tag and analyzing the same 12 week animals twice in two different contrasts: 39 vs. 12 weeks and 5 vs. 12 weeks. We therefore combined the data normalizing the protein expression dividing them for the mean value of the 12 weeks animals and plotted the resulting values. For both transcriptomics and proteomics data, we performed statistical analysis calculating the Spearman correlation value, the p-value adjusted, and the false discovery rate (FDR) to assess the statistical significance of the observed expression variability. All analyses were performed utilizing the suite R.

Results

To obtain a global overview on the gene expression of members of the Notch family, we analyzed published RNA-seq (), taking as the first time point of analysis the data obtained from 5-week-old animals, which corresponds to the time of sexual maturation followed by 12 weeks (young adult), 20 weeks (mature adult), 27 weeks (old), and 39 weeks (geriatric). Figure 1 reports the age-dependent regulation of gene expression coding for members of the Notch signaling pathway as identified by the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway (dre00430): eight Notch ligands, four receptors, and three effectors. Out of these, four ligands (dla, dlb, dld, and jag2), notch1a, and proliferative genes (mki67 and pcna) showed a negative correlation with age, indicating an age-dependent downregulation of the Notch pathway, and it is consistent with an age-dependent reduction of adult neurogenesis detected previously by neuroanatomical techniques () and RNA-seq (). More precisely, the observed decrease is greater in the time frame between 5 and 12 weeks of age (Figure 1), while the downregulation decelerates between 12 and 27 weeks. Statistical significance of expression changes can be assessed by the correlation and p-value data listed in Table 2.

FIGURE 1

TABLE 2

Transcriptomics, Dataset 1
Transcriptomics, Dataset 2
Proteomics
geneSpearman CVpValFDRSpearman CVpValFDRSpearman CVpValFDR
dla–7.54629E + 149.382986565 49819e-076.00511140 191884e-06–5.91312E + 140.0428679750 3941390.07620973340 34024
dlb–8.17445E + 141.996229181 9553e-083.19396669 112848e-07–9.461E + 143.271765152 57932e-062.093929697 65076e-05
dlc–1.41441E + 130.447867241 8674790.5971563224 89972–2.95656E + 140.9273255929 170550.9572393217 20831
dld–6.64356E + 144.587876016 78168e-050.0001835150406 71267–7.39141E + 140.00601894061 9577860.0128404066 550994
DLK1–4.74243E + 140.800006284 6218840.8258129389 64525–7.39141E + 140.00601894061 9577860.01284040665 50994
dll4–5.49124E + 140.769219214 2540420.8205004952 043115.32181E + 140.07489 84360.1141309493 5522
her4.24.16003E + 140.019930908 16851240.0455563615 280283–7.39141E + 140.006018940619 577860.01284040665 50994
her6–2.25889E + 130.221751400 5830590.4174144010 975245.91312E + 140.8551579930 784240.9121685259 50319
jag1b–5.65764E + 140.7624224206 480250.8205004952 043114.7305E + 140.1203734281 978960.1750886228 33304
jag2–4.05603E + 140.02358690140 077460.05031872298 831917.68706E + 140.0034824680 37712130.00928658143 389901
MKI67–8.55302E + 148.8838891798 5594e-102.84284453755 39e-08–9.461E + 143.271765152 57932e-062.0939296976 5076e-05
notch1a–6.48132E + 148.064381403 0168e-050.000258060204 896537–6.80009E + 140.0149674939 8356050.0299349879 671209
notch1b–7.75429E + 143.0068523781 9565e-073.20730920340 869e-06–9.461E + 143.2717651525 7932e-062.0939296976 5076e-05
notch3–5.92804E + 130.000441182018 4972990.00117648538 265946–4.13919E + 140.181014993 9781560.251846948 1435210.64253962 03994750.009787763993 868380.0261977326 229934
pcna–2.04257E + 140.2703778006 737890.4806716456 42292–8.27837E + 140.00088528528 96537030.0025753753 880835–0.3023715913 295750.2733497681 763610.3629205847 07689

Spearman correlation value and respective p-values and adjusted p-values for gene and proteins listed in Figure 1.

FDR, false discovery rate.

The amplitude of regulation was largest for the delta ligands (with the exception of dlc that, however, is ∼20 times lower expressed than the other three delta genes) and notch1a. Although notch3 expression shows the same downregulation trend between 5 and 12 weeks, the overall reduction is consistently smaller, how attested by the relative RNA-seq data analysis (Figure 1) and the expression pattern in the brain tissue (Figure 2).

FIGURE 2

–Atlas) represent the horizontal overview of the whole killifish brain; red-squared areas indicate the position of the figure panels based on the corresponding letters.

We were also able to find proteomic data regarding the levels of Notch3 and proliferating cell nuclear antigen (PCNA); even if the transcripts of the two genes show no evident age-dependent reduction, at the protein level, a mechanism of compensation seems to occur (Figure 1). A partial decoupling between RNA and protein level during aging already has been demonstrated in this model (), and this observation could be included in this context, but from the data obtained, a Notch3 reduction can be excluded.

We decided to investigate the expression of notch1a (Gene ID Nfu_g_1_006683, annotated using the zebrafish ortholog ENSDARG00000052094) and notch3 (Gene ID Nfu_g_1_007618, annotated using the zebrafish ortholog ENSDARG00000052139). As described in the Introduction, these genes play different roles in controlling NSC proliferation and differentiation in the zebrafish brain (; ). Although both genes are downregulated with age, the amplitude of regulation (i.e., 5 vs. 39 weeks) is different: 40% for notch1a vs. 15% for notch3.

In order to localize the expression domains of notch1a and notch3 in the N. furzeri brain, we performed ISH on horizontal sections concentrating on the neurogenic niches of the telencephalon and optic tectum that we previously described in detail ().

Figure 3 (modified from ) shows a whole-mount brain of young N. furzeri, where all neurogenic niches are visualized by incorporation of EdU and green fluorescent labeling (4 h after injection) and serves as a reference for the ensuing ISH images of the study.

FIGURE 3

). A schematic drawing of the dorsal view of N. furzeri brain is shown on the left, where all principal brain regions are defined (OB, olfactory bulb; Tel, telencephalon; OT, optic tectum; CRB, cerebellum), and neurogenic niche distribution indicated by green dots and sequential Roman numeral indexes; dotted red lines indicate the extension of a niche (or part of it) on the ventral side of the cerebral structure, here not represented. (A) Dorsal view of the brain. (B) Telencephalic region. (C,D) Ventral view of the brain at lower (C) and higher (D) magnification. Nine neurogenic niches are identified in these panels: I, telencephalic niche corresponding to the subpallial region; II and III, telencephalic niches corresponding to the pallial regions; IV, preoptic niche; V, rostro-dorsal part of the niche in the optic tectum (OT); VI, caudal part of niche in the OT; VII and VIII, medial and caudal niches of the cerebellum; IX, caudal niche along the roof of the IV ventricle, visible in panel (A). Arrowheads (B,D) indicate areas of higher concentration of proliferating cells in the caudal margin of niche III.

The messenger of notch1a was coexpressed, although not exclusively limited, to active neurogenic niches, as demonstrated by double labeling with the mitotic marker EdU (Figure 4). In the telencephalon, expression of notch1a was mostly seen in EdU cells that were close neighbors of a notch1a EdU+ cell, as expected, given the antimitotic activity of Notch pathway activation. A few cells were double labeled for notch1a and EdU (white arrows in Figures 4F,G), as already reported in zebrafish (). It should be noticed that notch1a expression in the telencephalon was more prominent in the anterior and medial parts of the telencephalon (Figures 4E–G) that correspond to a subpallial highly mitotic area (area I in Figure 3), while the number of labeled cells is smaller in the lateral margin of the telencephalon that is a pallial, low active mitotic area (area II in Figure 3). Expression becomes higher in a lateroposterior area where mitotic activity is moderate (Figure 4B, area III in Figure 3). In the optic tectum, expression of notch1a is strictly limited to neuroepithelial stem cell niches (Figures 4C,D) where partial double labeling of notch1a and EdU is observed.

FIGURE 4

–Atlas) represents the horizontal overview of the whole killifish brain; red-squared areas indicate the position of the figure panels based on the corresponding letters. White arrows show the presence of double-stained Edu+/notch1a cells.

In agreement with the RNA-seq data (Figure 1), expression of notch1a markedly declines during aging in all neurogenic niches without changing the regional pattern of labeling (Figure 5).

FIGURE 5

–Atlas) represents the horizontal overview of the whole killifish brain; red-squared areas indicate the position of the figure panels based on the corresponding letters.

Although the RNA-seq data show a minor drop in the notch3 expression between 5 and 12 weeks of age, our ISH results suggest that already at 7 weeks, we can observe a level of notch3 RNA expression that is comparable to the level observed at 27 weeks of age. As opposed to notch1a, the expression of notch3 was not limited to active neurogenic niches (EdU positive), but it was equally observed in all stem cell niches, regardless of the visible mitotic activity level in the region (Figure 5). In the young adult telencephalon, expression of notch 3 was similar in regions that vary greatly in mitotic level: the subpallial highly mitotic area (Figures 6A–D, area I in Figure 3) throughout the frontal margin of the telencephalon, that is, a pallial, lower active mitotic area (Figures 6A–C), and in the lateroposterior area with moderate mitotic activity (Figures 6A–E, area II and III in Figure 3). In the optic tectum, expression of notch3 is not limited to neuroepithelial stem cell niches (Figures 6F–G, anterior and posterior margin niches of the OT, respectively), but extends into the ventricular margin of the optic tectum (Figure 6B) which clearly shows only a red staining and it is formed by radial glia with extremely low mitotic activity ().

FIGURE 6

–Atlas) represents the horizontal overview of the whole killifish brain; red-squared areas indicate the position of the figure panels, based on the corresponding letters. White arrows show the presence of double-stained Edu+/notch3 cells.

Discussion

In conclusion, by comparing the RNA-seq results with what has emerged from the histological analysis of the ISH experiments, both expression pattern and regulation differ between notch1a and notch3. Expression of the former is limited to mitotically active regions and consequently is greatly reduced by aging. Expression of the latter is observed in all cells that have a neurogenic potential, regardless of the level of their actual mitotic activity, and is less influenced by age both at the transcript and protein levels.

The reduction of the expression of notch1a (as well as that of mki67 and pcna) shows the bigger amplitude between the ages of 5 and 12 weeks, the period in which the brain grows considerably. Based on the techniques utilized in this work (RNA-seq data analysis and ISH), it cannot be formally excluded that the reduction observed could be due to the relative reduction in the fraction of cells expressing notch1a on the total amount of cells in the brain. However, the fact that its normalized expression is reduced at the brain level is nonetheless a significant observation. Typically, all pathways involved in growth and differentiation are strongly involved in the metabolic processes that determine the future aging and life span of an individual; it also has been demonstrated that the specific expression of metabolic-related genes already at early life stages could be predictive of life expectancy of Nothobranchius (). Thus, growth and aging are two processes that are strictly correlated and cannot be easily disentangled.

On the other hand, notch3 transcript seems to be less affected by aging and even to increase its protein level over time. Unfortunately, the dataset that we analyzed did not contain information about Notch1a or other Notch proteins.

From the literature, it is known that the reduction of notch1a induces stem cells to divide asymmetrically, whereas the reduction of notch3 promotes symmetrical divisions (; ). Thus, a different antiproliferative role could be inferred for the two genes, depending on the differential proliferation outcome.

Our results show that in N. furzeri telencephalon, notch1a is expressed, although not exclusively, in proliferating regions, mainly localizing in close proximity to EdU+ cells, areas in which the expression of notch1a seems to be more concentrated.

In zebrafish, it has been described that the high majority of proliferative radial glia and about 50% of proliferative non-radial glia express notch1a (), while in killifish, we observed that almost all proliferative Edu+ cells of the telencephalic niches do not express notch1a, supporting the notion of the antiproliferative role of this gene, as also supported by the work of , in which they showed the mutually exclusive expression of proliferative markers and effectors of Notch pathway. The limited number of double-stained EdU-notch1a cells (Figure 4 white arrows) could represent cells lacking the expression of notch3, thus undergoing the symmetrical above the asymmetrical division (inhibited by notch1a expression). These cells could belong to the pool of slow-cycling, glial-like NSCs, already observed in our previous work where double-stained S100+/EdU+ cells were present in this area in exiguous number ().

In zebrafish telencephalon, notch3 has been described to have an expression pattern similar to notch1a in radial glial cells but to be rarely expressed in the non-glial proliferative population (). In our observations, notch3 shows a more widespread area of staining with respect to the neurogenic niches, but also in this case, we could identify a few double-labeled EdU+/notch3+ cells.

In zebrafish optic tectum, the majority of proliferating cells are reported to express notch1a and notch3 (). In our case, notch1a expression resembles closely the situation already described for the telencephalon: very few cells, both in the anterior and posterior neurogenic niches, present a double Edu/notch1a staining. On the contrary, notch3 seems to have a higher level of colocalization with EdU+ cells with respect to notch1a. The interpretation of this finding is ambiguous: it is known that neurogenic niches of the optic tectum have in fish a neuroepithelial origin () and are characterized by fast-cycling cells supposedly undergoing symmetrical divisions. It is possible that in these areas, notch3 does not have the canonical function of symmetrical division inhibition. To assess that, further investigations would be needed.

Taken together, our observations finally suggest that, as already demonstrated for zebrafish (), also in our model, a possible differential role of the two receptors could exist in neurogenic activity control by acting on distinct cellular subpopulations, so to realize a fine-tuned regulation of the proliferative potential of the niches throughout the entire fish life.

Statements

Data availability statement

Publicly available datasets were analyzed in this study. This data can be found here: : http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE52462; : http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE125373; : http://www.ebi.ac.uk/pride/archive/projects/PXD012314.

Ethics statement

The animal study was reviewed and approved by Italian Ministry of Health (Number 96/2003a).

Author contributions

ETT designed the study. ETT and SB performed in situ hybridization, confocal acquisition, imaging, and wrote the manuscript. SB performed RNAseq analysis. Both authors read and approved the final manuscript.

Acknowledgments

We thank Alessandro Cellerino for providing logistic and scientific support, Giorgia Battistoni for helping to perform the in situ hybridization experiments and confocal acquisitions, and Roberto Ripa for helping to perform the cloning of the probes. This work was partially supported by the MFAG 11511 (AIRC Association) to ETT.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer, CL, declared a past collaboration with one of the authors, ETT, to the handling editor.

References

  • 1

    AdolfB.ChapoutonP.LamC. S.ToppS.TannhauserB.StrahleU.et al (2006). Conserved and acquired features of adult neurogenesis in the zebrafish telencephalon.Dev. Biol.295278293. 10.1016/j.ydbio.2006.03.023

  • 2

    AllardJ. B.KameiH.DuanC. (2013). Inducible transgenic expression in the short-lived fish Nothobranchius furzeri.J. Fish Biol.8217331738. 10.1111/jfb.12099

  • 3

    AlunniA.KrecsmarikM.BoscoA.GalantS.PanL.MoensC. B.et al (2013). Notch3 signaling gates cell cycle entry and limits neural stem cell amplification in the adult pallium.Development14033353347. 10.1242/dev.095018

  • 4

    BaumgartM.GrothM.PriebeS.SavinoA.TestaG.DixA.et al (2014). RNA-seq of the aging brain in the short-lived fish N. furzeri – conserved pathways and novel genes associated with neurogenesis.Aging Cell13965974. 10.1111/acel.12257

  • 5

    BaumgartM.PriebeS.GrothM.HartmannN.MenzelU.PandolfiniL.et al (2016). Longitudinal RNA-Seq analysis of vertebrate aging identifies mitochondrial complex I as a small-molecule-sensitive modifier of lifespan.Cell Syst.2122132. 10.1016/j.cels.2016.01.014

  • 6

    Ben AbdallahN. M.SlomiankaL.VyssotskiA. L.LippH. P. (2010). Early age-related changes in adult hippocampal neurogenesis in C57 mice.Neurobiol. Aging31151161. 10.1016/j.neurobiolaging.2008.03.002

  • 7

    BenayounB. A.PollinaE. A.BrunetA. (2015). Epigenetic regulation of ageing: linking environmental inputs to genomic stability.Nat. Rev. Mol. Cell. Biol.16593610. 10.1038/nrm4048

  • 8

    BierkampC.Campos-OrtegaJ. A. (1993). A zebrafish homologue of the Drosophila neurogenic gene Notch and its pattern of transcription during early embryogenesis.Mech. Dev.4387100. 10.1016/0925-4773(93)90027-u

  • 9

    BlazekR.PolacikM. J.ReichardM. (2013). Rapid growth, early maturation and short generation time in African annual fishes.Evodevo4:24.

  • 10

    CellerinoA.ValenzanoD. R.ReichardM. (2016). From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.Biol. Rev. Camb. Philos. Soc.91511533. 10.1111/brv.12183

  • 11

    ChapoutonP.WebbK. J.StigloherC.AlunniA.AdolfB.HeslB.et al (2011). Expression of hairy/enhancer of split genes in neural progenitors and neurogenesis domains of the adult zebrafish brain.J. Comp. Neurol.51917481769. 10.1002/cne.22599

  • 12

    CuiR.WillemsenD.ValenzanoD. R. (2020). Nothobranchius furzeri (African Turquoise Killifish).Trends Genet.36540541. 10.1016/j.tig.2020.01.012

  • 13

    D’angeloL. (2013). Brain atlas of an emerging teleostean model: nothobranchius furzeri.Anat. Rec.296681691. 10.1002/ar.22668

  • 14

    de Oliveira-CarlosV.GanzJ.HansS.KaslinJ.BrandM. (2013). Notch receptor expression in neurogenic regions of the adult zebrafish brain.PLoS One8:e73384. 10.1371/journal.pone.0073384

  • 15

    Di CiccoE.TozziniE. T.RossiG.CellerinoA. (2011). The short-lived annual fish Nothobranchius furzeri shows a typical teleost aging process reinforced by high incidence of age-dependent neoplasias.Exp. Gerontol.46249256. 10.1016/j.exger.2010.10.011

  • 16

    DolfiL.RipaR.AntebiA.ValenzanoD. R.CellerinoA. (2019). Cell cycle dynamics during diapause entry and exit in an annual killifish revealed by FUCCI technology.Evodevo.10:29. 10.1186/s13227-019-0142-5

  • 17

    DornA.Musilov’aZ.PlatzerM.ReichwaldK.CellerinoA. (2014). The strange case of East African annual fishes: aridification correlates with diversification for a savannah aquatic group?BMC Evol. Biol.14:210. 10.1186/s12862-014-0210-3

  • 18

    DozawaM.KonoH.SatoY.ItoY.TanakaH.OhshimaT. (2014). Valproic acid, a histone deacetylase inhibitor, regulates cell proliferation in the adult zebrafish optic tectum.Dev. Dyn.24314011415. 10.1002/dvdy.24173

  • 19

    EdelmannK.GlashauserL.SprungalaS.HeslB.FritschleM.NinkovicJ.et al (2013). Increased radial glia quiescence, decreased reactivation upon injury and unaltered neuroblast behavior underlie decreased neurogenesis in the aging zebrafish telencephalon.J. Comp. Neurol.52130993115. 10.1002/cne.23347

  • 20

    FumagalliM. R.Font-ClosF.MilanS.ZapperiS.La PortaC. A. M. (2020). Comparative analysis of metabolic and transcriptomic features of Nothobranchius furzeri.J. R. Soc. Interface17:20200217. 10.1098/rsif.2020.0217

  • 21

    FurnessA. I.LeeK.ReznickD. N. (2015). Adaptation in a variable environment: phenotypic plasticity and bet-hedging during egg diapause and hatching in an annual killifish.Evolution6914611475. 10.1111/evo.12669

  • 22

    GenadeT.BenedettiM.TerzibasiE.RoncagliaP.ValenzanoD. R.CattaneoA.et al (2005). Annual fishes of the genus Nothobranchius as a model system for aging research.Aging Cell4223233. 10.1111/j.1474-9726.2005.00165.x

  • 23

    GrandelH.KaslinJ.GanzJ.WenzelI.BrandM. (2006). Neural stem cells and neurogenesis in the adult zebrafish brain: origin, proliferation dynamics, migration and cell fate.Dev. Biol.295263277. 10.1016/j.ydbio.2006.03.040

  • 24

    HandS. C.DenlingerD. L.PodrabskyJ. E.RoyR. (2016). Mechanisms of animal diapause: recent developments from nematodes, crustaceans, insects, and fish.Am. J. Physiol. Regul. Integr. Comp. Physiol.310R1193R1211.

  • 25

    HarelI.BenayounB. A.MachadoB. E.Priya SinghP.HuC.-K.PechM. F.et al (2015). A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.Cell16010131026. 10.1016/j.cell.2015.01.038

  • 26

    HartmannN.EnglertC. (2012). A microinjection protocol for the generation of transgenic killifish (Species: Nothobranchius furzeri).Dev. Dyn.24111331141. 10.1002/dvdy.23789

  • 27

    HartmannN.ReichwaldK.LechelA.GrafM.KirschnerJ.DornA.et al (2009). Telomeres shorten while Tert expression increases during ageing of the short-lived fish Nothobranchius furzeri.Mech. Ageing Dev.130290296. 10.1016/j.mad.2009.01.003

  • 28

    HartmannN.ReichwaldK.WittigI.DroseS.SchmeisserS.LuckC.et al (2011). Mitochondrial DNA copy number and function decrease with age in the short-lived fish Nothobranchius furzeri.Aging Cell10824831. 10.1111/j.1474-9726.2011.00723.x

  • 29

    HuC. K.WangW.Brind’AmourJ.SinghP. P.ReevesG. A.LorinczM. C.et al (2020). Vertebrate diapause preserves organisms long term through Polycomb complex members.Science367870874. 10.1126/science.aaw2601

  • 30

    ItoY.TanakaH.OkamotoH.OhshimaT. (2010). Characterization of neural stem cells and their progeny in the adult zebrafish optic tectum.Dev. Biol.3422638. 10.1016/j.ydbio.2010.03.008

  • 31

    KabiljoJ.MurkoC.PuschO.ZupkovitzG. (2019). Spatio-temporal expression profile of sirtuins during aging of the annual fish Nothobranchius furzeri.Gene Expr. Patterns331119. 10.1016/j.gep.2019.05.001

  • 32

    KanungoJ.GoswamiM. T.PantH. C. (2018). Notch and Cdk5 in Zebrafish Mindbomb Mutant: co-regulation or Coincidence?.Folia Biol.643540.

  • 33

    KaslinJ.KroehneV.BenatoF.ArgentonF.BrandM. (2013). Development and specification of cerebellar stem and progenitor cells in zebrafish: from embryo to adult.Neural Dev.8:9. 10.1186/1749-8104-8-9

  • 34

    Kelmer SacramentoE.KirkpatrickJ. M.MazzettoM.BaumgartM.BartolomeA.Di SanzoS.et al (2020). Reduced proteasome activity in the aging brain results in ribosome stoichiometry loss and aggregation.Mol. Syst. Biol.16:e9596. 10.15252/msb.20209596

  • 35

    KimY.NamH. G.ValenzanoD. R. (2016). The short-lived African turquoise killifish: an emerging experimental model for ageing.Dis. Model. Mech.9115129. 10.1242/dmm.023226

  • 36

    KnothR.SingecI.DitterM.PantazisG.CapetianP.MeyerR. P.et al (2010). Murine features of neurogenesis in the human hippocampus across the lifespan from 0 to 100 years.PLoS One5:e8809. 10.1371/journal.pone.0008809

  • 37

    KuhnH. G.Dickinson-AnsonH.GageF. H. (1996). Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation.J. Neurosci.1620272033. 10.1523/jneurosci.16-06-02027.1996

  • 38

    KuroyanagiY.OkuyamaT.SuehiroY.ImadaH.ShimadaA.NaruseK.et al (2010). Proliferation zones in adult medaka (Oryzias latipes) brain.Brain Res.13233340. 10.1016/j.brainres.2010.01.045

  • 39

    LoveM.IHuberW.AndersS. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.Genome Biol.15:550. 10.1186/s13059-014-0550-8

  • 40

    LugertS.BasakO.KnucklesP.HausslerU.FabelK.GotzM.et al (2010). Quiescent and active hippocampal neural stem cells with distinct morphologies respond selectively to physiological and pathological stimuli and aging.Cell Stem Cell6445456. 10.1016/j.stem.2010.03.017

  • 41

    MatsuiH.KenmochiN.NamikawaK. (2019). Age- and α-Synuclein-Dependent Degeneration of Dopamine and Noradrenaline Neurons in the Annual Killifish Nothobranchius furzeri.Cell Rep.2617271733.e6. 10.1016/j.celrep.2019.01.015

  • 42

    McIntoshR.NorrisJ.ClarkeJ. D.AlexandreP. (2017). Spatial distribution and characterization of non-apical progenitors in the zebrafish embryo central nervous system.Open Biol.7:160312. 10.1098/rsob.160312

  • 43

    MingG. L.SongH. (2011). Adult neurogenesis in the mammalian brain: significant answers and significant questions.Neuron70687702. 10.1016/j.neuron.2011.05.001

  • 44

    MontesanoA.De FeliceE.LeggieriA.PalladinoA.LuciniC.ScoccoP.et al (2019). Ontogenetic Pattern Changes of Nucleobindin-2/Nesfatin-1 in the Brain and Intestinal Bulb of the Short Lived African Turquoise Killifish.J. Clin. Med.9:103. 10.3390/jcm9010103

  • 45

    PekcecA.BaumgartnerW.BankstahlJ. P.SteinV. M.PotschkaH. (2008). Effect of aging on neurogenesis in the canine brain.Aging Cell7368374. 10.1111/j.1474-9726.2008.00392.x

  • 46

    PierfeliceT.AlberiL.GaianoN. (2011). Notch in the vertebrate nervous system: an old dog with new tricks.Neuron69840855. 10.1016/j.neuron.2011.02.031

  • 47

    PlatzerM.EnglertC. (2016). Nothobranchius furzeri: a Model for Aging Research and More.Trends Genet.32543552. 10.1016/j.tig.2016.06.006

  • 48

    ReichwaldK.LauberC.NandaI.KirschnerJ.HartmannN.SchoriesS.et al (2009). High tandem repeat content in the genome of the short-lived annual fish Nothobranchius furzeri: a new vertebrate model for aging research.Genome. Biol.10:R16. 10.1186/gb-2009-10-2-r16

  • 49

    ReichwaldK.PetzoldA.KochP.DownieB. R.HartmannN.PietschS.et al (2015). Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.Cell16315271538. 10.1016/j.cell.2015.10.071

  • 50

    RipaR.DolfiL.TerrignoM.PandolfiniL.ArcucciV.GrothM.et al (2016). MicroRNA miR-29 controls a compensatory response to limit neuronal iron accumulation during adult life and aging.BMC Biol.15:9. 10.1186/s12915-017-0354-x

  • 51

    StankiewiczA. J.McGowanE. M.YuL.ZhdanovaI. V. (2017). Impaired Sleep, Circadian Rhythms and Neurogenesis in Diet-Induced Premature Aging.Int. J. Mol. Sci.18:2243. 10.3390/ijms18112243

  • 52

    SuedaR.KageyamaR. (2020). Regulation of active and quiescent somatic stem cells by Notch signaling.Dev. Growth Differ.625966. 10.1111/dgd.12626

  • 53

    SuhH.DengW.GageF. H. (2009). Signaling in adult neurogenesis.Annu. Rev. Cell Dev. Biol.25253275.

  • 54

    TerzibasiE.ValenzanoD. R.CellerinoA. (2007). The short-lived fish Nothobranchius furzeri as a new model system for aging studies.Exp. Gerontol.428189. 10.1016/j.exger.2006.06.039

  • 55

    Terzibasi TozziniE.DornA.Ng’omaE.PolacikM.BlazekR.ReichwaldK.et al (2013). Parallel evolution of senescence in annual fishes in response to extrinsic mortality.BMC Evol. Biol.13:77. 10.1186/1471-2148-13-77

  • 56

    Than-TrongE.Ortica-GattiS.MellaS.NepalC.AlunniA.Bally-CuifL. (2018). Neural stem cell quiescence and stemness are molecularly distinct outputs of the Notch3 signalling cascade in the vertebrate adult brain.Development145:dev161034. 10.1242/dev.161034

  • 57

    TozziniE. T.BaumgartM.BattistoniG.CellerinoA. (2012). Adult neurogenesis in the short-lived teleost Nothobranchius furzeri: localization of neurogenic niches, molecular characterization and effects of aging.Aging Cell11241251. 10.1111/j.1474-9726.2011.00781.x

  • 58

    UrbánN.GuillemotF. (2014). Neurogenesis in the embryonic and adult brain: same regulators, different roles.Front Cell Neurosci.8:396. 10.3389/fncel.2014.00396

  • 59

    ValenzanoD. R.BenayounB. A.SinghP. P.ZhangE.EtterP. D.HuC. K.et al (2015). The African turquoise killifish genome provides insights into evolution and genetic architecture of lifespan.Cell16315391554. 10.1016/j.cell.2015.11.008

  • 60

    ValenzanoD. R.SharpS.BrunetA. (2011). Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.G31531538. 10.1534/g3.111.001271

  • 61

    ValenzanoD. R.TerzibasiE.CattaneoA.DomeniciL.CellerinoA. (2006). Temperature affects longevity and age-related locomotor and cognitive decay in the short-lived fish Nothobranchius furzeri.Aging Cell5275278. 10.1111/j.1474-9726.2006.00212.x

  • 62

    van TeteringG.VooijsM. (2011). Proteolytic cleavage of Notch: “HIT and RUN”.Curr. Mol. Med.11255269. 10.2174/156652411795677972

  • 63

    VrtílekM.ŽákJ.PolačikM.BlažekR.ReichardM. (2018). Longitudinal demographic study of wild populations of African annual killifish.Sci. Rep.8:4774. 10.1038/s41598-018-22878-6

  • 64

    WangW.HuC. K.ZengA.AlegreD.HuD.GottingK.et al (2020). Changes in regeneration-responsive enhancers shape regenerative capacities in vertebrates.Science369:eaaz3090. 10.1126/science.aaz3090

  • 65

    WestinJ.LardelliM. (1997). Three novel Notch genes in zebrafish: implications for vertebrate Notch gene evolution and function.Dev. Genes Evol.2075163. 10.1007/s004270050091

  • 66

    YeoS. Y.KimM.KimH. S.HuhT. L.ChitnisA. B. (2007). Fluorescent protein expression driven by her4 regulatory elements reveals the spatiotemporal pattern of Notch signaling in the nervous system of zebrafish embryos.Dev. Biol.301555567. 10.1016/j.ydbio.2006.10.020

  • 67

    YoonK.GaianoN. (2005). Notch signaling in the mammalian central nervous system: insights from mouse mutants.Nat. Neurosci.8709715. 10.1038/nn1475

  • 68

    ZupancG. K.HorschkeI. (1995). Proliferation zones in the brain of adult gymnotiform fish: a quantitative mapping study.J. Comp. Neurol.353213233. 10.1002/cne.903530205

Summary

Keywords

notch pathway, ageing, killifish, adult neurogenesis, in situ hybridization, RNA sequencing

Citation

Bagnoli S and Terzibasi Tozzini E (2021) Age-Dependent Regulation of Notch Family Members in the Neuronal Stem Cell Niches of the Short-Lived Killifish Nothobranchius furzeri. Front. Cell Dev. Biol. 9:640958. doi: 10.3389/fcell.2021.640958

Received

12 December 2020

Accepted

26 May 2021

Published

09 July 2021

Volume

9 - 2021

Edited by

Fernando Antunes, University of Lisbon, Portugal

Reviewed by

Jan Kaslin, Australian Regenerative Medicine Institute, Australia; Carla Lucini, University of Naples Federico II, Italy

Updates

Copyright

*Correspondence: Eva Terzibasi Tozzini,

This article was submitted to Cellular Biochemistry, a section of the journal Frontiers in Cell and Developmental Biology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics