Abstract
Endothelin, encoded by ET1, is a vasoactive substance primarily synthesized in vascular endothelial cells (VECs). Elevation of endothelin levels, due to transcriptional hyperactivation, has been observed in a host of cardiovascular diseases. We have previously shown that serum response factor (SRF) is a regulator of ET1 transcription in VECs. Here we report that angiotensin II (Ang II) induced ET1 transcription paralleled activation of glycogen synthase kinase 3 (GSK3) in cultured VECs. GSK3 knockdown or pharmaceutical inhibition attenuated Ang II induced endothelin expression. Of interest, the effect of GSK3 on endothelin transcription relied on the conserved SRF motif within the ET1 promoter. Further analysis revealed that GSK3 interacted with and phosphorylated SRF at serine 224. Phosphorylation of SRF by GSK3 did not influence its recruitment to the ET1 promoter. Instead, GSK3-mediated SRF phosphorylation potentiated its interaction with MRTF-A, a key co-factor for SRF, which helped recruit the chromatin remodeling protein BRG1 to the ET1 promoter resulting in augmented histone H3 acetylation/H3K4 trimethylation. Consistently, over-expression of a constitutively active GSK enhanced Ang II-induced ET1 transcription and knockdown of either MRTF-A or BRG1 abrogated the enhancement of ET1 transcription. In conclusion, our data highlight a previously unrecognized mechanism that contributes to the transcriptional regulation of endothelin. Targeting this GSK3-SRF axis may yield novel approaches in the intervention of cardiovascular diseases.
Introduction
The vascular endothelium not only functions as a physical barrier separating the circulation from the basal lamina but synthesizes and secretes a host of substances contributing to the maintenance and regulation of internal microenvironment either locally (via paracrine) or systemically (via endocrine) (). Endothelin, encoded by ET1, is a polypeptide derived from endothelial cells (). Endothelin primarily signals through one of the two cognate receptors, ETRA and ETRB. Whereas binding of endothelin to ETRA leads to contraction of vascular smooth muscle cells, the endothelin-ETRB interaction is thought to trigger endothelin clearance and vasorelaxation (). Elevated plasma endothelin levels have been observed in patients with hypertension (), pulmonary hypertension (), atherosclerosis (), diabetes (), and heart failure (). Concordantly, ETR antagonists have been demonstrated to be effective in the intervention of a host of cardiovascular and metabolic diseases ().
Increased production of endothelin is primarily achieved through transcriptional activation of the ET1 gene, which is localized on chromosome 6 in the human genome (). The proximal ET1 promoter is responsive to a number of stimuli including angiotensin II (Ang II), hypoxia, transforming growth factor (TGF), thrombin, and tumor necrosis factor (TNF) (; ; ; ; ). The stimulatory effects of these humoral factors on ET1 transcription are mediated by different sequence-specific transcription factors. For instance, we and others have shown that activator protein 1 (AP-1) is recruited to the -115/-108 region of the ET1 promoter in response to Ang II and mediates ET1 trans-activation in endothelial cells (; ; ). Hypoxia-induced ET1 trans-activation can be mediated by, according to , a complex that contains HIF-1α, AP-1, and GATA-2. Alternatively, we have previously shown that serum response factor (SRF) can be detected on the proximal ET1 promoter and mediates hypoxia induced ET1 trans-activation ().
In the vasculature, SRF is known to regulate the transcription of contractile genes in vascular smooth muscle cells by recognizing the so-called CArG box [CC(A/T)6GG] located on its target promoters (). The role of SRF in the regulation of endothelial function is relatively less well defined. It has been demonstrated independently by and by Holtz et al. () that endothelium-specific deletion of SRF in mice results in embryonic lethality owing to defective angiogenesis/vasculogenesis and hemorrhaging. Transcrptionally, SRF is essential for the activation of E-Cadherin (CDH5) and β-actin (ACTAB) to maintain endothelial homeostasis. The transcriptional activity of SRF is subject to multiple layers of modulation including post-translational modifications (PTMs). , for instance, have discovered that lysine residue 147 of SRF can be SUMOylated, which suppresses its transcriptional activity likely by interfering with its DNA binding potential. More recently, have reported that lysine residue 165 of SRF can be methylated by SET7 and de-methylated by KDM2B; dynamic SRF methylation is proposed to regulate its affinity for target promotes and contribute to muscle differentiation. By far, phosphorylation represents the most extensively characterized PTM for SRF. There is evidence to support a host of kinases, including MK2 (), PKA (), CaMKII (), GSK3β (), and PKC (), using SRF as a substrate. Whether or not SRF phosphorylation can contribute to ET1 transcription is yet to be examined. Here we report that GSK3β mediated SRF phosphorylation facilitates its interaction with key co-factors to mediate Ang II induced endothelin expression in endothelial cells.
Materials and Methods
Cell Culture
Immortalized human endothelial cells (EAhy926) were maintained in DMEM supplemented with 10% FBS as previously described (). ET1 promoter-luciferase constructs (), SRF expression constructs (; ) have been previously described. Constitutively active GSK3β, in which serine 9 was substituted by alanine (S9A), dominant negative GSK3β, in which arginine 96 was substituted by alanine (R96A), phosphorylation-defective SRF, in which serine 224 was substituted by alanine (S224A), and phosphorylation mimetic SRF in which serine 224 was substituted by aspartic acid (S224D), were generated by a QuikChange kit (Thermo Fisher Scientific, Waltham, MA, United States) and verified by direct sequencing as previously described (). Angiotensin II was purchased from Sigma (St. Louis, MO, United States). LY2090314 were purchased from Selleck (Houston, TX, United States). Small interfering RNAs were purchased from Dharmacon (Lafayette, CO, United States): siGSK3B#1, AAGTAATCCACCTCTGGCTAC; siGSK3B#2, GUAAUCCACCUCUGGCUAC; siMRTFA#1, GUG UCUUGGUGUAGUGU; siMRTFA#2, CUGCGUGCAU AUCAAGAAC; siBRG1#1, AACATGCACCAGATGCAC AAG; siBRG1#2, GCCCATGGAGTCCATGCAT. Transient transfections were performed with Lipofectamine 2000 (for DNA plasmids, Thermo Fisher Scientific, Waltham, MA, United States) or Lipofectamine RNAiMax (for siRNAs, Thermo Fisher Scientific, Waltham, MA, United States). Cells were harvested 48 h after transfection and reporter activity was measured using a luciferase reporter assay system (Promega, Madison, WI, United States) as previously described (; ).
Protein Extraction, Immunoprecipitation, and Western Blotting
Whole cell lysates were obtained by re-suspending cell pellets in RIPA buffer (50 mM Tris pH7.4, 150 mM NaCl, 1% Triton X-100) with freshly added protease inhibitor (Roche, Basel, Switzerland) as previously described (, , ; , ; ; ; ; ; ; ; ; ; ; ; ; Zhang et al., 2021). Specific antibodies were added to and incubated with cell lysates overnight before being absorbed by Protein A/G-plus Agarose beads (Santa Cruz, Santa Cruz, CA, United States). Precipitated immune complex was released by boiling with 1X SDS electrophoresis sample buffer. Proteins were separated by 8% polyacrylamide gel electrophoresis with pre-stained markers (Bio-Rad, Hercules, CA, United States) for estimating molecular weight and efficiency of transfer to blots. Proteins were transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA, United States) in a Mini-Trans-Blot Cell (Bio-Rad, Hercules, CA, United States). The membranes were blocked with 5% milk powder in Tris-buffered saline buffer (0.05% Tween 20, 150 mM NaCl, 100 mM Tris-HCl pH7.4) at 4°C overnight. Western blot analyses were performed with anti-GFP (Proteintech, 50430-2, Wuhan, China), anti-FLAG (Sigma, F3165, St. Louis, MO, United States), anti-GSK3β (Cell Signaling Tech, 12456, Danvers, MA, United States), anti-phospho-Ser9-GSK3β (Cell Signaling Tech, 5558), anti-GSK3α (Proteintech, 13419-1, Wuhan, China), anti-phospho-Ser21-GSK3α (Cell Signaling Tech, 9316, Danvers, MA, United States), anti-phospho-(S/T)F (Cell Signaling Tech, 9631, Danvers, MA, United States), anti-SRF (Cell Signaling Tech, 5147, Danvers, MA, United States), and anti-β-actin (Sigma, A2228, St. Louis, MO, United States) antibodies. For densitometrical quantification, densities of target proteins were normalized to those of β-actin as previously described (; ). Data are expressed as relative protein levels compared to the control group which is arbitrarily set as 1.
RNA Isolation and Real-Time PCR
RNA was extracted with the RNeasy RNA isolation kit (Qiagen, Hilden, Germany). Reverse transcriptase reactions were performed using a SuperScript First-strand Synthesis System (Invitrogen, Waltham, MA, United States) as previously described (Zhang et al., 2020; ). Real-time PCR reactions were performed on an ABI Prism 7500 system with the following primers: ET1, 5′-AGAGTGTGTCTACTTCTGCCA-3′ and 5′-CTTCCAAGTCCATACGGAACAA-3′; GSK3B, 5′-GG CAGCATGAAAGTTAGCAGA-3′ and 5′-GGCGACCAGT TCTCCTGAATC-3′. Ct values of target genes were normalized to the Ct values of housekeeping control gene (18s, 5′-CGCGGTTCTATTTTGTTGGT-3′ and 5′-TCGTCTTCGAAACTCCGACT-3′ for both human and mouse genes) using the ΔΔCt method and expressed as relative mRNA expression levels compared to the control group which is arbitrarily set as 1.
Chromatin Immunoprecipitation (ChIP)
Chromatin immunoprecipitation (ChIP) assays were performed essentially as described before. In brief, chromatin in control and treated cells were cross-linked with 1% formaldehyde. Cells were incubated in lysis buffer (150 mM NaCl, 25 mM Tris pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) supplemented with protease inhibitor tablet and PMSF. DNA was fragmented into ∼200 bp pieces using a Branson 250 sonicator (Brookfield, CT, United States). Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-MRTF-A (Santa Cruz, sc-10768), anti-SRF (Cell Signaling Tech, 5147, Danvers, MA, United States), anti-BRG1 (Abcam, ab110641, Cambridge, United Kingdom), anti-acetyl histone H3 (Millipore, 06-599, Burlington, MA, United States), and anti-trimethyl H3K4 (Millipore, 07-442, Burlington, MA, United States). Precipitated genomic DNA was amplified by real-time PCR with the following primers: ET1 proximal promoter, 5′-GGCGTCTGCCTCTGAAGT-3′ and 5′-GGGTAAACAGCTCCGACTT-3′. A total of 10% of the starting material is also included as the input. Data are then normalized to the input and expressed as% recovery relative the input as previously described (). All experiments were performed in triplicate wells and repeated three times.
Enzyme-Linked Immunosorbent Assay (ELISA)
Secreted endothelin in the culture media was measured by ELISA using a commercially available kit (R&D, DET100, Minneapolis, MN, United States) per vendor recommendations.
Statistical Analysis
Sample sizes reflected the minimal number needed for statistical significance based on power analysis and prior experience. Two-tailed Student’s t-test was performed using an SPSS package. Unless otherwise specified, p-values smaller than 0.05 were considered statistically significant.
Results
Ang II Induced Endothelin Expression Parallels GSK3 Activation
When cultured endothelial cells were exposed to Ang II treatment, ET1 expression levels were significantly up-regulated as measured by qPCR (Figure 1A) and ELISA (Figure 1B) in keeping with previous findings (; ). Of note, although GSK3β expression levels were not altered by Ang II treatment, GSK3β activity, as measured by loss of serine 9 phosphorylation, was up-regulated by Ang II treatment (Figures 1A,C). GSK3α is the other GSK3 isoform that shares similar structure with GSK3β but possesses distinct functions (). By comparison, neither expression nor activity of GSK3α was altered by Ang II treatment (Figures 1A,C).
FIGURE 1
GSK3 Is Essential for Ang II Induced Endothelin Expression
We asked whether GSK3 activation and endothelin expression was correlative or causative. In the first set of experiments, endogenous GSK3 was depleted with two separate pairs of siRNAs; GSK3 knockdown markedly attenuated Ang II induced endothelin expression (Figures 2A,B). In the second set of experiments, a specific GSK3 inhibitor (LY2090314) was added to the cells in the presence of Ang II; GSK3 inhibition by LY2090314 ameliorated endothelin induction in a dose-dependently manner (Figures 2C,D).
FIGURE 2
Next, we asked whether regulation of endothelin expression by GSK3 occurred at the transcriptional level. To this end, an ET1 promoter-luciferase construct was transfected into EAhy926 cells with or without a constitutively active (CA) GSK3β (S9A) or a dominant negative (DN) GSK3β (S9D). As shown in Figure 2E, over-expression of GSK3β CA enhanced the activation of the ET1 promoter whereas over-expression of GSK3β DN dampened the activation of the ET1 promoter. Interestingly, the effect of GSK3β on the ET1 promoter seemed to rely on the SRF site located between −48 and −41 relative to the transcription start site () as mutagenesis of this site completely abrogated the response of the ET1 promoter to GSK3β over-expression (Figure 2F).
GSK3 Interacts With and Phosphorylates SRF in Endothelial Cells
Previously, have reported that SRF can be phosphorylated by GSK3β in neurons to promote axonal growth. Immunoprecipitation assay was performed to verify GSK3β could interact with SRF in endothelial cells. EAhy926 cells were transduced with adenovirus carrying FLAG-tagged SRF and/or GFP-tagged GSK3β. An anti-FLAG could precipitate both SRF and GSK3β only when both were over-expressed thus confirming that SRF and GSK3β could interact with each other in endothelial cells (Figure 3A). Although Ang II treatment did not affect SRF expression levels in endothelial cells (Figures 1A,C), it significantly up-regulated SRF phosphorylation levels (Figure 3B). Based on these observations, we hypothesized that GSK3β might phosphorylate SRF to participate in ET1 transcription. As shown in Figure 3C, over-expression of GFP-tagged GSK3β CA alone was sufficient to augment SRF phosphorylation in the absence of Ang II whereas over-expression of GFP-tagged GSK3β DN suppressed Ang II-induced SRF phosphorylation. In addition, knockdown of endogenous GSK3β by siRNAs or GSK3β inhibition by a small-molecule compound (LY2090314) comparably attenuated SRF phosphorylation by Ang II treatment (Figures 3D,E).
FIGURE 3
Phosphorylation of SRF by GSK3 Is Essential for Ang II Induced Endothelin Expression
Next, we evaluated the relevance of GSK3β-mediated SRF phosphorylation in ET1 transcription. In the reporter assay, it was observed that over-expression of a phosphomimetic SRF (S234D) enhanced trans-activation of the ET1 promoter by Ang II whereas over-expression of a phosphor-defective SRF (S234A) weakened ET1 trans-activation (Figure 4A). Next, endogenous SRF in endothelial cells was depleted by siRNAs followed by re-introduction of ectopic SRF via adenviral transduction (Figure 4B). As shown in Figures 4C,D, whereas SRF depletion attenuated Ang II induced ET1 expression, introduction of SRF S234D more than compensated for the loss of endogenous SRF by restoring ET1 induction; SRF S234A, however, failed to recover the reduction of ET1 expression. In the next set of experiments, wild type (WT) or the phosphomimetic (S234D) SRF was over-expressed in SRF-depleted endothelial cells followed by GSK3β knockdown or inhibition. Whereas GSK3β knockdown or inhibition completely deprived the ability of WT SRF to rescue ET1 expression in SRF-depleted endothelial cells, the phosphomimetic SRF was refractory to the manipulation of GSK3β expression/activity (Figures 4E–H). Taken together, these data point to an interplay between SRF and GSK3β that contributes to Ang II induced ET1 trans-activation.
FIGURE 4
Phosphorylation of SRF by GSK3 Is Essential for Co-factor Recruitment
Consistent with our prior observation (), chromatin immunoprecipitation (ChIP) assay showed that Ang II treatment significantly enhanced the occupancies of SRF (Figure 5A) and MRTF-A (Figure 5B), a key co-activator of SRF, on the ET1 promoter. GSK3β depletion did not affect SRF binding (Figure 5A) but markedly dampened the binding of MRTF-A (Figure 5B). Typically, active transcription is associated with enrichment of trimethylated H3K4 (H3K4Me3) on the gene promoters (). On the contrary, transcriptional repression can be measured by enrichment of dimethylated H3K9 (H3K9Me2) on the gene promoters (). Previous studies have shown that SRF interacts with MRTF-A to regulate transcription by differentially modulating histone methylation levels (). ChIP assays showed that Ang II treatment triggered an increase in H3K4Me3 (Figure 5C) and a simultaneous decrease in H3K9Me2 (Figure 5D) on the ET1 promoter, both of which were reversed by GSK3β depletion. Consistently, the epigenetic factors involved in catalyzing these characteristic histone modifications, namely BRG1 (Figure 5E), SET1 (Figure 5F), and JMJD1A (Figure 5G), were similarly recruited to the ET1 promoter upon Ang II treatment but disrupted by GSK3β knockdown. In the second set of experiments, LY2090314 was added to the endothelial cells to inhibit GSK3β activity: GSK3b inhibition similarly led to dampened recruitment of MRTF-A (Figure 5I), BRG1 (Figure 5L), SET1 (Figure 5M), and JMJD1A (Figure 5N), erasure of trimethyl H3K4 (Figure 5J), and accumulation of dimethyl H3K9 (Figure 5K) without influencing SRF binding (Figure 5H) to the ET1 promoter.
FIGURE 5
Next, we performed Re-ChIP assay to evaluate whether GSK3-mediated SRF phosphorylation might be necessary for the assembly of a transcriptional complex on the ET1 promoter. As shown in Figure 6A, in the presence of WT SRF, Ang II treatment stimulated the assembly of an SRF-centered complex that contained MRTF-A, BRG1, SET1, and JMJD1A. When replaced by a phosphorylation-defective SRF (S234A), incorporation of co-factors into this transcriptional complex was severely compromised. Taken together, these data support a model wherein GSK3-mediated SRF phosphorylation licenses the assembly of a transcriptional complex to activate endothelin expression (Figure 6B).
FIGURE 6
Discussion
Post-translational modifications play a key role in the regulation of cardiovascular diseases (; ; ). Alteration of SRF activity contributes to the disruption of cardiovascular homeostasis and is associated with a wide range of cardiovascular diseases (). SRF relies on its interaction with co-factors to orchestrate specific transcriptional events and participate in disease pathogenesis (). Based on our findings here, we propose a model in which phosphorylation of SRF by GSK3β mediates Ang II induced ET1 transcription (Figure 6B).
We show here that GSK3β is activated by Ang II treatment in endothelial cells. This observation is consistent with a previous report by showing that Ang II treatment activates GSK3β in human primary umbilical endothelial cells. Similarly, blockade of Ang II signaling by a specific angiotensin II receptor antagonist Telmisartan inhibits GSK3β activity in endothelial cells (). On the contrary, Ang II infusion seems to have an inhibitory effect on GSK3β in cardiomyocytes () and smooth muscle cells (). One possible explanation could be that differential expression levels of angiotensin receptor 1 (AT1) and 2 (AT2) in these cells because AT1 and AT2 often exert opposing roles once engaged by angiotensin II ().
Our data suggest that GSK3β may contribute to ET1 transcription via SRF phosphorylation. These data, however, leave the door open to alternative interpretations. First, SRF phosphorylation status is influenced by multiple kinases other than GSK3β. For instance, SRF can be phosphorylated by MK2 at serine residue 103, which enhances its DNA binding activity (). Because MK2 can be placed downstream of Ang II and MK2 completely abrogates Ang II induced organ damage in vivo (), it is plausible that Ang II may induce ET1 transcription through MK2-mediated SRF phosphorylation. Alternatively, phosphorylation of SRF at threonine residue 160 by CaMKII potentiates its DNA binding (). Mounting evidences suggests that CaMKII signaling plays an essential role mediating the pathophysiological effects of Ang II (; ; ). It is reasonable to speculate that the ability of SRF to trans-activate ET1 expression may be attributable, at least in part, to CaMKII-catalyzed T160 phosphorylation. Second, other components of the SRF-centered transcriptional complex may be subject to GSK3β mediated phosphorylation. The Treisman laboratory has previously systemically profiled the phosphorylation status of MRTF-A in MEF cells with the finding that several serine/threonine residues may be targeted by GSK3β; collective mutation of these sites blocks nuclear trans-location of MRTF-A (). BRG1, SET1, and JMJD1A all have been demonstrated to be phosphorylated under specific circumstances (; ) although it remains to be determined whether GSK3β makes a contribution.
There are a few unsolved issues that warrant further investigation. First, we focused in the present study on the effect of SRF S234 phosphorylation on ET1 transcription. It is not clear how genomewide gene expression levels would be affected by this specific modification. A recent study by Li et al. have shown that dynamic regulation of SRF serine 103 phosphorylation by RSK3 and PP2A significantly impacts phenylephrine-induced gene transcription in cardiomyocytes. Specifically, the authors demonstrate, using ChIP-seq and PRO-seq, that the phosphomimetic SRF S103D appears to promote the association of SRF with enhancers, facilitate the recruitment of the basal transcription machinery, and preferentially augment the expression of early response and hypertrophic genes (). Similar strategies could exploited to determine how the SRF S234D mutant influence the endothelial transcriptome. Second, the functional relevance of the present study is not entirely clear. Global deletion of GSK3β exacerbates myocardial hypertrophy possibly due to hyperproliferation of cardiomyoblast (). On the other hand, GSK3β hypomorphic mice are protected from dilated cardiomyopathy and heart failure (). Endothelial-specific role for GSK3β is yet to be determined. Third, although our model suggests that SRF is a primary substrate for GSK3β, it does not rule out the possibility that GSK3β may indirectly regulate SRF activity. Both SRF and its most importantly cofactor MRTF-A are modulated by cytoskeletal remodeling (). GSK3β, by targeting multiple components of cytoskeleton, is considered a key mechanosensor in endothelial cells (). Therefore, it is conceivable that GSK3β may contribute to ET1 transcription by relaying the mechanic signal to the SRF complex. Finally, although we focused the effect of SRF phosphorylation on its interaction with histone methyltransferase/demethylase, the potential involvement of histone acetyltransferases/deacetylase cannot be excluded. Several histone acetyltransferases with distinct substrate specificities including PCAF (), p300 (), CBP (), and KAT8 (), have been shown to interact with SRF and participate in SRF-mediated transcriptional events. Previous studies have implicated p300 and CBP in the regulation of ET1 transcription in endothelial cells (; ). It would be of interest to determine whether recruitment of CBP and/or p300 might be affected by SRF phosphorylation.
Conclusion
In conclusion, our data portray GSK3β as a regulator of Ang II-induced ET1 transcription in endothelial cells by licensing the assembly of an phospho-SRF-MRTF-A-BRG1-SET1-JMJD1A complex. Further investigations are needed to solidify the role of this complex in regulating endothelial function and eventually devise novel therapeutic strategies by targeting this complex.
Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.
Author contributions
LZ conceived the project. YY, HW, HZ, XM, and YG designed and performed the experiments, and collected and analyzed the data. YX wrote the manuscript. YY and LZ secured funding and provided supervision. All authors contributed to the article and approved the submitted version.
Funding
This work was supported by grants from the National Natural Science Foundation of China (81870302), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and the Six Talent Peaks Project in Jiangsu Province.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2021.698254/full#supplementary-material
References
1
AbmanS. H. (2009). Role of endothelin receptor antagonists in the treatment of pulmonary arterial hypertension.Annu. Rev. Med.6013–23. 10.1146/annurev.med.59.110106.212434
2
BaoW.BehmD. J.NerurkarS. S.AoZ.BentleyR.MirabileR. C.et al (2007). Effects of p38 MAPK Inhibitor on angiotensin II-dependent hypertension, organ damage, and superoxide anion production.J. Cardiovasc. Pharmacol.49362–368. 10.1097/FJC.0b013e318046f34a
3
BasuU.CaseA. J.LiuJ.TianJ.LiY. L.ZimmermanM. C. (2019). Redox-sensitive calcium/calmodulin-dependent protein kinase IIalpha in angiotensin II intra-neuronal signaling and hypertension.Redox Biol.27:101230. 10.1016/j.redox.2019.101230
4
BechardM.DaltonS. (2009). Subcellular localization of glycogen synthase kinase 3beta controls embryonic stem cell self-renewal.Mol. Cell. Biol.292092–2104. 10.1128/MCB.01405-08
5
BlakerA. L.TaylorJ. M.MackC. P. (2009). PKA-dependent phosphorylation of serum response factor inhibits smooth muscle-specific gene expression.Arterioscler. Thromb. Vasc. Biol.292153–2160. 10.1161/ATVBAHA.109.197285
6
CardilloC.CampiaU.BryantM. B.PanzaJ. A. (2002). Increased activity of endogenous endothelin in patients with type II diabetes mellitus.Circulation1061783–1787. 10.1161/01.cir.0000032260.01569.64
7
CastanaresC.Redondo-HorcajoM.Magan-MarchalN.ten DijkeP.LamasS.Rodriguez-PascualF. (2007). Signaling by ALK5 mediates TGF-beta-induced ET-1 expression in endothelial cells: a role for migration and proliferation.J. Cell Sci.1201256–1266. 10.1242/jcs.03419
8
ChenB.FanZ.SunL.ChenJ.FengY.FanX.et al (2020a). Epigenetic activation of the small GTPase TCL contributes to colorectal cancer cell migration and invasion.Oncogenesis9:86. 10.1038/s41389-020-00269-9
9
ChenB.YuanY.SunL.ChenJ.YangM.YinY.et al (2020b). MKL1 Mediates TGF-β Induced RhoJ Transcription to Promote Breast Cancer Cell Migration and Invasion.Front. Cell Dev. Biol.8:832. 10.3389/fcell.2020.00832
10
ChenB.ZhaoQ.XuT.YuL.ZhuoL.YangY.et al (2020c). BRG1 activates PR65A transcription to regulate NO bioavailability in vascular endothelial cell.Front. Cell Dev. Biol.8:774. 10.3389/fcell.2020.00774
11
ChenB.ZhuY.ChenJ.FengY.XuY. (2021). Activation of TC10-Like transcription by lysine demethylase KDM4B in colorectal cancer cells.Front. Cell Dev. Biol.9:617549. 10.3389/fcell.2021.617549
12
ChengM. B.ZhangY.CaoC. Y.ZhangW. L.ShenY. F. (2014). Specific phosphorylation of histone demethylase KDM3A determines target gene expression in response to heat shock.PLoS Biol.12:e1002026. 10.1371/journal.pbio.1002026
13
CianfroccaR.TocciP.RosanoL.CapraraV.SestitoR.Di CastroV.et al (2016). Nuclear beta-arrestin1 is a critical cofactor of hypoxia-inducible factor-1alpha signaling in endothelin-1-induced ovarian tumor progression.Oncotarget717790–17804. 10.18632/oncotarget.7461
14
CuevasC. A.GonzalezA. A.InestrosaN. C.VioC. P.PrietoM. C. (2015). Angiotensin II increases fibronectin and collagen I through the beta-catenin-dependent signaling in mouse collecting duct cells.Am. J. Physiol. Renal Physiol.308F358–F365. 10.1152/ajprenal.00429.2014
15
DeleriveP.Martin-NizardF.ChinettiG.TrotteinF.FruchartJ. C.NajibJ.et al (1999). Peroxisome proliferator-activated receptor activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the activator protein-1 signaling pathway.Circ. Res.85394–402. 10.1161/01.res.85.5.394
16
DongW.KongM.ZhuY.ShaoY.WuD.LuJ.et al (2020). Activation of TWIST Transcription by Chromatin Remodeling Protein BRG1 Contributes to Liver Fibrosis in Mice.Front. Cell Dev. Biol.8:340. 10.3389/fcell.2020.00340
17
DongW.ZhuY.ZhangY.FanZ.ZhangZ.FanX.et al (2021). BRG1 Links TLR4 Trans-Activation to LPS-Induced SREBP1a Expression and Liver Injury.Front. Cell Dev. Biol.9:617073. 10.3389/fcell.2021.617073
18
ElyH. A.MellonP. L.CossD. (2011). GnRH induces the c-Fos gene via phosphorylation of SRF by the calcium/calmodulin kinase II pathway.Mol. Endocrinol.25669–680. 10.1210/me.2010-0437
19
EnevoldsenF. C.SahanaJ.WehlandM.GrimmD.InfangerM.KrugerM. (2020). Endothelin Receptor Antagonists: status Quo and Future Perspectives for Targeted Therapy.J. Clin. Med.9:824. 10.3390/jcm9030824
20
FanZ.KongM.LiM.HongW.FanX.XuY. (2020). Brahma Related Gene 1 (Brg1) Regulates Cellular Cholesterol Synthesis by Acting as a Co-factor for SREBP2.Front. Cell Dev. Biol.8:259. 10.3389/fcell.2020.00259
21
Fert-BoberJ.MurrayC. I.ParkerS. J.Van EykJ. E. (2018). Precision Profiling of the Cardiovascular Post-Translationally Modified Proteome: where There Is a Will, There Is a Way.Circ. Res.1221221–1237. 10.1161/CIRCRESAHA.118.310966
22
FluckM.BoothF. W.WaxhamM. N. (2000). Skeletal muscle CaMKII enriches in nuclei and phosphorylates myogenic factor SRF at multiple sites.Biochem. Biophys. Res. Commun.270488–494. 10.1006/bbrc.2000.2457
23
FrancoC. A.MericskayM.ParlakianA.Gary-BoboG.Gao-LiJ.PaulinD.et al (2008). Serum response factor is required for sprouting angiogenesis and vascular integrity.Dev. Cell15448–461. 10.1016/j.devcel.2008.07.019
24
GaetaniR.ZizziE. A.DeriuM. A.MorbiducciU.PesceM.MessinaE. (2020). When Stiffness Matters: mechanosensing in Heart Development and Disease.Front. Cell Dev. Biol.8:334. 10.3389/fcell.2020.00334
25
GajjalaP. R.FliserD.SpeerT.JankowskiV.JankowskiJ. (2015). Emerging role of post-translational modifications in chronic kidney disease and cardiovascular disease.Nephrol. Dial. Transplant.301814–1824. 10.1093/ndt/gfv048
26
HasdaiD.HolmesD. R.Jr.GarrattK. N.EdwardsW. D.LermanA. (1997). Mechanical pressure and stretch release endothelin-1 from human atherosclerotic coronary arteries in vivo.Circulation95357–362. 10.1161/01.cir.95.2.357
27
HeidenreichO.NeiningerA.SchrattG.ZinckR.CahillM. A.EngelK.et al (1999). MAPKAP kinase 2 phosphorylates serum response factor in vitro and in vivo.J. Biol. Chem.27414434–14443. 10.1074/jbc.274.20.14434
28
HoltzM. L.MisraR. P. (2008). Endothelial-specific ablation of serum response factor causes hemorrhaging, yolk sac vascular failure, and embryonic lethality.BMC Dev. Biol.8:65. 10.1186/1471-213X-8-65
29
HongW.KongM.QiM.BaiH.FanZ.ZhangZ.et al (2021). BRG1 mediates nephronectin activation in hepatocytes to promote T lymphocyte infiltration in ConA-induced hepatitis.Front. Cell Dev. Biol.8:587502. 10.3389/fcell.2020.587502
30
ImaiT.HirataY.EmoriT.YanagisawaM.MasakiT.MarumoF. (1992). Induction of endothelin-1 gene by angiotensin and vasopressin in endothelial cells.Hypertension19753–757. 10.1161/01.hyp.19.6.753
31
IyerD.ChangD.MarxJ.WeiL.OlsonE. N.ParmacekM. S.et al (2006). Serum response factor MADS box serine-162 phosphorylation switches proliferation and myogenic gene programs.Proc. Natl. Acad. Sci. U. S. A.1034516–4521. 10.1073/pnas.0505338103
32
KaschinaE.NamsolleckP.UngerT. (2017). AT2 receptors in cardiovascular and renal diseases.Pharmacol. Res.12539–47. 10.1016/j.phrs.2017.07.008
33
KerkelaR.KockeritzL.MacaulayK.ZhouJ.DobleB. W.BeahmC.et al (2008). Deletion of GSK-3beta in mice leads to hypertrophic cardiomyopathy secondary to cardiomyoblast hyperproliferation.J. Clin. Invest.1183609–3618. 10.1172/JCI36245
34
KongM.ChenX.LvF.RenH.FanZ.QinH.et al (2019a). Serum response factor (SRF) promotes ROS generation and hepatic stellate cell activation by epigenetically stimulating NCF1/2 transcription.Redox Biol.26:101302. 10.1016/j.redox.2019.101302
35
KongM.HongW.ShaoY.LvF.FanZ.LiP.et al (2019b). Ablation of serum response factor in hepatic stellate cells attenuates liver fibrosis.J. Mol. Med.971521–1533. 10.1007/s00109-019-01831-8
36
KongM.ZhuY.ShaoJ.FanZ.XuY. (2021). The Chromatin Remodeling Protein BRG1 Regulates SREBP Maturation by Activating SCAP Transcription in Hepatocytes.Front. Cell Dev. Biol.9:622866. 10.3389/fcell.2021.622866
37
KwonD. H.KangJ. Y.JoungH.KimJ. Y.JeongA.MinH. K.et al (2021). SRF is a nonhistone methylation target of KDM2B and SET7 in the regulation of skeletal muscle differentiation.Exp. Mol. Med.53250–263. 10.1038/s12276-021-00564-4
38
LeeM. E.DhadlyM. S.TemizerD. H.CliffordJ. A.YoshizumiM.QuertermousT. (1991). Regulation of endothelin-1 gene expression by Fos and Jun.J. Biol. Chem.26619034–19039.
39
LetiziaC.CerciS.De TomaG.D’AmbrosioC.De CiocchisA.CoassinS.et al (1997). High plasma endothelin-1 levels in hypertensive patients with low-renin essential hypertension.J. Hum. Hypertens.11447–451. 10.1038/sj.jhh.1000454
40
LiC. L.SathyamurthyA.OldenborgA.TankD.RamananN. (2014). SRF phosphorylation by glycogen synthase kinase-3 promotes axon growth in hippocampal neurons.J. Neurosci.344027–4042. 10.1523/JNEUROSCI.4677-12.2014
41
LiH.LiW.GuptaA. K.MohlerP. J.AndersonM. E.GrumbachI. M. (2010). Calmodulin kinase II is required for angiotensin II-mediated vascular smooth muscle hypertrophy.Am. J. Physiol. Heart Circ. Physiol.298H688–H698. 10.1152/ajpheart.01014.2009
42
LiH. L.WangA. B.HuangY.LiuD. P.WeiC.WilliamsG. M.et al (2005). Isorhapontigenin, a new resveratrol analog, attenuates cardiac hypertrophy via blocking signaling transduction pathways.Free Radic. Biol. Med.38243–257. 10.1016/j.freeradbiomed.2004.10.020
43
LiJ.TanY.PassarielloC. L.MartinezE. C.KritzerM. D.LiX.et al (2020). Signalosome-Regulated Serum Response Factor Phosphorylation Determining Myocyte Growth in Width Versus Length as a Therapeutic Target for Heart Failure.Circulation1422138–2154. 10.1161/CIRCULATIONAHA.119.044805
44
LiN.LiuS.ZhangY.YuL.HuY.WuT.et al (2020). Transcriptional activation of matricellular protein Spondin2 (SPON2) by BRG1 in vascular endothelial cells promotes macrophage chemotaxis.Front. Cell Dev. Biol.8:794. 10.3389/fcell.2020.00794
45
LiZ.KongX.ZhangY.YuL.GuoJ.XuY. (2020a). Dual roles of chromatin remodeling protein BRG1 in angiotensin II-induced endothelial-mesenchymal transition.Cell Death Dis.11:549. 10.1038/s41419-020-02744-y
46
LiZ.ZhangY.YuL.XiaoB.LiT.KongX.et al (2020b). BRG1 Stimulates Endothelial Derived Alarmin MRP8 to Promote Macrophage Infiltration in an Animal Model of Cardiac Hypertrophy.Front. Cell Dev. Biol.8:569. 10.3389/fcell.2020.00569
47
LiangM. H.ChuangD. M. (2006). Differential roles of glycogen synthase kinase-3 isoforms in the regulation of transcriptional activation.J. Biol. Chem.28130479–30484. 10.1074/jbc.M607468200
48
LiuL.ZhaoQ.LinL.YangG.YuL.ZhuoL.et al (2021). Myeloid MKL1 Disseminates Cues to Promote Cardiac Hypertrophy in Mice.Front. Cell Dev. Biol.9:583492. 10.3389/fcell.2021.583492
49
LvF.LiN.KongM.WuJ.FanZ.MiaoD.et al (2020). CDKN2a/p16 Antagonizes Hepatic Stellate Cell Activation and Liver Fibrosis by Modulating ROS Levels.Front. Cell Dev. Biol.8:176. 10.3389/fcell.2020.00176
50
MaoL.LiuL.ZhangT.QinH.WuX.XuY. (2020). Histone Deacetylase 11 Contributes to Renal Fibrosis by Repressing KLF15 Transcription.Front. Cell Dev. Biol.8:235. 10.3389/fcell.2020.00235
51
MatsuzakiK.MinamiT.TojoM.HondaY.UchimuraY.SaitohH.et al (2003). Serum response factor is modulated by the SUMO-1 conjugation system.Biochem. Biophys. Res. Commun.30632–38. 10.1016/s0006-291x(03)00910-0
52
MianoJ. M. (2010). Role of serum response factor in the pathogenesis of disease.Lab. Invest.901274–1284. 10.1038/labinvest.2010.104
53
MohamedR. M.MorimotoS.IbrahimI. A.ZhanD. Y.DuC. K.AriokaM.et al (2016). GSK-3beta heterozygous knockout is cardioprotective in a knockin mouse model of familial dilated cardiomyopathy.Am. J. Physiol. Heart Circ. Physiol.310H1808–H1815. 10.1152/ajpheart.00771.2015
54
OlsonE. N.NordheimA. (2010). Linking actin dynamics and gene transcription to drive cellular motile functions.Nat. Rev. Mol. Cell Biol.11353–365. 10.1038/nrm2890
55
OnuhJ. O.QiuH. (2020). Serum response factor-cofactor interactions and their implications in disease.FEBS J.2883120–3134. 10.1111/febs.15544
56
Padilla-BenavidesT.NasipakB. T.PaskavitzA. L.HaokipD. T.SchnablJ. M.NickersonJ. A.et al (2017). Casein kinase 2-mediated phosphorylation of Brahma-related gene 1 controls myoblast proliferation and contributes to SWI/SNF complex composition.J. Biol. Chem.29218592–18607. 10.1074/jbc.M117.799676
57
PanayiotouR.MirallesF.PawlowskiR.DiringJ.FlynnH. R.SkehelM.et al (2016). Phosphorylation acts positively and negatively to regulate MRTF-A subcellular localisation and activity.Elife5:e15460. 10.7554/eLife.15460
58
PiuntiA.ShilatifardA. (2021). The roles of Polycomb repressive complexes in mammalian development and cancer.Nat. Rev. Mol. Cell Biol.22326–345. 10.1038/s41580-021-00341-1
59
PrasadA. M.MorganD. A.NunoD. W.KetsawatsomkronP.BairT. B.VenemaA. N.et al (2015). Calcium/calmodulin-dependent kinase II inhibition in smooth muscle reduces angiotensin II-induced hypertension by controlling aortic remodeling and baroreceptor function.J. Am. Heart Assoc.4:e001949. 10.1161/JAHA.115.001949
60
PuttaguntaR.TedeschiA.SoriaM. G.HerveraA.LindnerR.RathoreK. I.et al (2014). PCAF-dependent epigenetic changes promote axonal regeneration in the central nervous system.Nat. Commun.5:3527. 10.1038/ncomms4527
61
QiuP.LiL. (2002). Histone acetylation and recruitment of serum responsive factor and CREB-binding protein onto SM22 promoter during SM22 gene expression.Circ. Res.90858–865. 10.1161/01.res.0000016504.08608.b9
62
RafiiS.ButlerJ. M.DingB. S. (2016). Angiocrine functions of organ-specific endothelial cells.Nature529316–325. 10.1038/nature17040
63
RubensC.EwertR.HalankM.WenselR.OrzechowskiH. D.SchultheissH. P.et al (2001). Big endothelin-1 and endothelin-1 plasma levels are correlated with the severity of primary pulmonary hypertension.Chest1201562–1569. 10.1378/chest.120.5.1562
64
ShilatifardA. (2012). The COMPASS family of histone H3K4 methylases: mechanisms of regulation in development and disease pathogenesis.Annu. Rev. Biochem.8165–95. 10.1146/annurev-biochem-051710-134100
65
SmithL. E.WhiteM. Y. (2014). The role of post-translational modifications in acute and chronic cardiovascular disease.Proteomics Clin. Appl.8506–521. 10.1002/prca.201400052
66
SongK. H.BaeS. J.ChangJ.ParkJ. H.JoI.ChoK. W.et al (2017). Telmisartan mitigates hyperglycemia-induced vascular inflammation by increasing GSK3beta-Ser(9) phosphorylation in endothelial cells and mouse aortas.Biochem. Biophys. Res. Commun.491903–911. 10.1016/j.bbrc.2017.07.134
67
StowL. R.JacobsM. E.WingoC. S.CainB. D. (2011). Endothelin-1 gene regulation.FASEB J.2516–28. 10.1096/fj.10-161612
68
SunL.ChenB.WuJ.JiangC.FanZ.FengY.et al (2020). Epigenetic regulation of a disintegrin and metalloproteinase (ADAM) promotes colorectal cancer cell migration and invasion.Front. Cell Dev. Biol.8:581692. 10.3389/fcell.2020.581692
69
WeiC. M.LermanA.RodehefferR. J.McGregorC. G.BrandtR. R.WrightS.et al (1994). Endothelin in human congestive heart failure.Circulation891580–1586. 10.1161/01.cir.89.4.1580
70
WengX.YuL.LiangP.ChenD.ChengX.YangY.et al (2015a). Endothelial MRTF-A mediates angiotensin II induced cardiac hypertrophy.J. Mol. Cell. Cardiol.8023–33. 10.1016/j.yjmcc.2014.11.009
71
WengX.YuL.LiangP.LiL.DaiX.ZhouB.et al (2015b). A crosstalk between chromatin remodeling and histone H3K4 methyltransferase complexes in endothelial cells regulates angiotensin II-induced cardiac hypertrophy.J. Mol. Cell. Cardiol.8248–58. 10.1016/j.yjmcc.2015.02.010
72
WortS. J.ItoM.ChouP. C.Mc MasterS. K.BadigerR.JazrawiE.et al (2009). Synergistic induction of endothelin-1 by tumor necrosis factor alpha and interferon gamma is due to enhanced NF-kappaB binding and histone acetylation at specific kappaB sites.J. Biol. Chem.28424297–24305. 10.1074/jbc.M109.032524
73
WuT.WangH.XinX.YangJ.HouY.FangM.et al (2020). An MRTF-A-Sp1-PDE5 Axis Mediates Angiotensin-II-Induced Cardiomyocyte Hypertrophy.Front. Cell Dev. Biol.8:839. 10.3389/fcell.2020.00839
74
WuX.DongW.ZhangT.RenH.WangJ.ShangL.et al (2020). Epiregulin (EREG) and Myocardin Related Transcription Factor A (MRTF-A) Form a Feedforward Loop to Drive Hepatic Stellate Cell Activation.Front. Cell Dev. Biol.8:591246. 10.3389/fcell.2020.591246
75
YamashitaK.DischerD. J.HuJ.BishopricN. H.WebsterK. A. (2001). Molecular regulation of the endothelin-1 gene by hypoxia. Contributions of hypoxia-inducible factor-1, activator protein-1, GATA-2, AND p300/CBP.J. Biol. Chem.27612645–12653. 10.1074/jbc.M011344200
76
YanagisawaM.KuriharaH.KimuraS.TomobeY.KobayashiM.MitsuiY.et al (1988). A novel potent vasoconstrictor peptide produced by vascular endothelial cells.Nature332411–415. 10.1038/332411a0
77
YangY.ChenD.YuanZ.FangF.ChengX.XiaJ.et al (2013). Megakaryocytic leukemia 1 (MKL1) ties the epigenetic machinery to hypoxia-induced transactivation of endothelin-1.Nucleic Acids Res.416005–6017. 10.1093/nar/gkt311
78
YangY.YangG.YuL.LinL.LiuL.FangM.et al (2020). An Interplay Between MRTF-A and the Histone Acetyltransferase TIP60 Mediates Hypoxia-Reoxygenation Induced iNOS Transcription in Macrophages.Front. Cell Dev. Biol.8:484. 10.3389/fcell.2020.00484
79
YuL.YangG.WengX.LiangP.LiL.LiJ.et al (2015). Histone Methyltransferase SET1 Mediates Angiotensin II-Induced Endothelin-1 Transcription and Cardiac Hypertrophy in Mice.Arterioscler. Thromb. Vasc. Biol.351207–1217. 10.1161/ATVBAHA.115.305230
80
ZhangW.YangR.FengY.HuB.ZhangJ.ZhangQ.et al (2017). Angiotensin II degrades myeloid cell leukemia 1 in human umbilical vein endothelial cells.IUBMB Life69321–327. 10.1002/iub.1607
81
ZhangY.WangH.SongM.XuT.ChenX.LiT.et al (2020). Brahma-Related Gene 1 Deficiency in Endothelial Cells Ameliorates Vascular Inflammatory Responses in Mice.Front. Cell Dev. Biol.8:578790. 10.3389/fcell.2020.578790
82
ZhangZ.ChenB.ZhuY.ZhangT.ZhangX.YuanY.et al (2021). The Jumonji domain-containing histone demethylase homolog 1D/lysine demethylase 7A (JHDM1D/KDM7A) is an epigenetic activator of RHOJ transcription in breast cancer cells.Front. Cell Dev. Biol.9:664375.
Summary
Keywords
transcriptional regulation, vascular endothelial cell, post-translational modification, phosphorylation, serum response factor
Citation
Yang Y, Wang H, Zhao H, Miao X, Guo Y, Zhuo L and Xu Y (2021) A GSK3-SRF Axis Mediates Angiotensin II Induced Endothelin Transcription in Vascular Endothelial Cells. Front. Cell Dev. Biol. 9:698254. doi: 10.3389/fcell.2021.698254
Received
21 April 2021
Accepted
09 July 2021
Published
26 July 2021
Volume
9 - 2021
Edited by
Prasun K. Datta, Tulane University, United States
Reviewed by
Francesca Di Sole, Des Moines University, United States; Manish Kumar Gupta, University of Central Florida, United States
Updates
Copyright
© 2021 Yang, Wang, Zhao, Miao, Guo, Zhuo and Xu.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Lili Zhuo, zhuolili@njmu.edu.cn
This article was submitted to Cellular Biochemistry, a section of the journal Frontiers in Cell and Developmental Biology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.